Aminoacyl-tRNA formation in the extreme thermophile Thermus thermophilus

Thermophilic organisms must be capable of accurate translation at temperatures in which the individual components of the translation machinery and also specific amino acids are particularly sensitive. Thermus thermophilus is a good model organism for studies of thermophilic translation because many of the components in this process have undergone structural and biochemical characterization. We have focused on the pathways of aminoacyl-tRNA synthesis for glutamine, asparagine, proline, and cysteine. We show that the T. thermophilus prolyl-tRNA synthetase (ProRS) exhibits cysteinyl-tRNA synthetase (CysRS) activity although the organism also encodes a canonical CysRS. The ProRS requires tRNA for cysteine activation, as is known for the characterized archaeal prolyl-cysteinyl-tRNA synthetase (ProCysRS) enzymes. The heterotrimeric T. thermophilus aspartyl-tRNA(Asn) amidotransferase can form Gln-tRNA in addition to Asn-tRNA: however, a 13-amino-acid C-terminal truncation of the holoenzyme A subunit is deficient in both activities when assayed with homologous substrates. A survey of codon usage in completed prokaryotic genomes identified a higher Glu:Gln ratio in proteins of thermophiles compared to mesophiles.     

A plasmid vector for an extreme thermophile, Thermus thermophilus

The host-vector system for an extreme thermophile, Thermus thermophilus HB27, was developed. The host strain has a mutation in tryptophan synthetase gene (trpB), and the mutation was determined to be a missense mutation by DNA sequence analysis. A Thermus-E. coli shuttle vector pYK109 was constructed. pYK109 consists of Thermus cryptic plasmid pTT8, tryptophan synthetase gene (trpB) of Thermus T2 and E. coli plasmid vector pUC13. pYK109 transformed T. thermophilus HB27 trpB5 to Trp+ at a frequency of 10(6) transformants per microgram DNA.     

Screening of stable proteins in an extreme thermophile, Thermus thermophilus

The leuB gene codes for 3-isopropylmalate dehydrogenase of the leucine biosynthetic pathway in an extreme thermophile, Thermus thermophilus. The leuB gene of the thermophile was replaced with a temperature-sensitive chimeric leuB gene. The resultant transformant was adapted to high temperature, a thermostable mutant strain being obtained. A single base substitution that replaces isoleucine at 93 with leucine was found in the chimeric leuB gene of the thermostable mutant. The resultant amino acid residue coincided with the corresponding residue of the T. thermophilus enzyme. It was confirmed that the mutant enzyme is more stable than the original chimeric enzyme. This system can be used to produce stabilized mutants of other enzymes without structural knowledge of them.     

The genome sequence of the extreme thermophile Thermus thermophilus

Thermus thermophilus HB27 is an extremely thermophilic, halotolerant bacterium, which was originally isolated from a natural thermal environment in Japan. This organism has considerable biotechnological potential; many thermostable proteins isolated from members of the genus Thermus are indispensable in research and in industrial applications. We present here the complete genome sequence of T. thermophilus HB27, the first for the genus Thermus. The genome consists of a 1,894,877 base pair chromosome and a 232,605 base pair megaplasmid, designated pTT27. The 2,218 identified putative genes were compared to those of the closest relative sequenced so far, the mesophilic bacterium Deinococcus radiodurans. Both organisms share a similar set of proteins, although their genomes lack extensive synteny. Many new genes of potential interest for biotechnological applications were found in T. thermophilus HB27. Candidates include various proteases and key enzymes of other fundamental biological processes such as DNA replication, DNA repair and RNA maturation.     

Aminoacyl-tRNA synthetases from an extreme thermophile, Thermus thermophilus HB8

Thermostable aminoacyl-tRNA synthetases specific to Val, Ile, Met and Glu were purified from an extreme thermophile, Thermus thermophilus HB8. As for the subunit compositions and molecular weights, these four aminoacyl-tRNA synthetases are similar to the corresponding enzymes from E. coli and B. stearothermophilus. Val-tRNA, Ile-tRNA and Met-tRNA synthetases from T. thermophilus have two tightly bound zinc ions, whereas Glu-tRNA synthetase does not. The amino acid compositions and secondary structures of Val-tRNA, Ile-tRNA and Met-tRNA synthetases are quite similar to one another. The conformational transition involving the anticodon of E. coli tRNAGlu as complexed with Glu-tRNA synthetase from T. thermophilus is necessary for the aminoacylation activity.     

Cytochrome oxidase from an extreme thermophile. Thermus thermophilus HB8

The cytochrome oxidase (EC 1.9.3.1) of $\text{Thermus}\text{thermophilus}$ HB8 was isolated from the membrane fraction, and was highly purified. The oxidase contained heme $\text{a}$ and heme $\text{c}$ as the prosthetic groups. The purified preparation showed a single band in polyacrylamide gel electrophoresis, and three major polypeptides with apparent molecular weights of 52,000, 37,000 and 29,000 were observed in the presence of sodium dodecyl sulfate. The enzyme reacted rapidly with $\text{T}\text{.}\text{thermophilus}$ cytochrome c-552. The oxidation of $\text{T}\text{.}\text{thermophilus}$ cytochrome $\text{c}$-555,549 by the enzyme was very slow, and was stimulated by the addition of cytochrome $\text{c}$-552. The enzyme was highly stable to heat.     

Streptomycin-resistant and streptomycin-dependent mutants of the extreme thermophile Thermus thermophilus

We have isolated spontaneous streptomycin-resistant, streptomycin-dependent and streptomycin-pseudo-dependent mutants of the thermophilic bacterium Thermus thermophilus IB-21. All mutant phenotypes were found to result from single amino acid substitutions located in the rpsL gene encoding ribosomal protein S12. Spontaneous suppressors of streptomycin dependence were also readily isolated. Thermus rpsL mutations were found to be very similar to rpsL mutations identified in mesophilic organisms. This similarity affords greater confidence in the utility of the crystal structures of Thermus ribosomes to interpret biochemical and genetic data obtained with Escherichia coli ribosomes. In the X-ray crystal structure of the T. thermophilus HB8 30 S subunit, the mutated residues are located in close proximity to one another and to helices 18, 27 and 44 of 16 S rRNA. X-ray crystallographic analysis of ribosomes from streptomycin-resistant, streptomycin-pseudo-dependent and streptomycin-dependent mutants described here is expected to reveal fundamental insights into the mechanism of tRNA selection, translocation, and conformational dynamics of the ribosome.     

Enigmas of biosyntheses of unusual polyamines in an extreme thermophile,Thermus thermophilus

Thermus thermophilus, an extreme thermophile belonging to Domain Bacteria, produces unusual polyamines in addition to standard polyamines. To understand mechanisms of changes of polyamine compositions of the thermophile upon change of growth conditions such as environmental temperature, metabolic pathways of polyamine biosyntheses of T. thermophilus have been studied and a new polyamine metabolic pathway was proposed. However, many enigmas remain to be solved in future studies. In this paper, biosyntheses of two non-standard polyamines, thermospermine and sym-homospermidine which are also produced and play important roles in plant cells, of the extreme thermophile are discussed in relation to the biosynthetic reactions in plants.     

Genetic transformation of the extreme thermophile Thermus thermophilus and of other Thermus spp.

Genetic transformation of auxotrophs of the extreme thermophile Thermus thermophilus HB27 to prototrophy was obtained at high frequencies of 10(-2) to 10(-1) when proliferating cell populations were exposed to chromosomal DNA from a nutritionally independent wild-type strain. The transformation frequency was proportional to the DNA concentration from 10 pg/ml to 100 ng/ml. T. thermophilus HB27 cells did not require chemical treatment to induce competence, although optimal transformation was obtained by the addition of a divalent cation (Ca2+ or Mg2+). Competence was maintained throughout the growth phase, with the highest transformation frequencies at pH 6 to 9 and at 70 degrees C. T. thermophilus HB27 and four other typical Thermus strains, T. thermophilus HB8, T. flavus AT62, T. caldophilus GK24, and T. aquaticus YT1, were also transformed to streptomycin resistance by DNA from their own spontaneous streptomycin-resistant mutants. A cryptic plasmid, pTT8, from T. thermophilus HB8 was introduced into T. thermophilus HB27 Pro- at a frequency of 10(-2).     

Overexpression of genes of an extreme thermophile Thermus thermophilus, in Escherichia coli cells.

The 3-isopropylmalate dehydrogenase gene from an extreme thermophile, Thermus thermophilus, was not expressed in Escherichia coli unless a palindromic structure around the ribosome binding site was eliminated or a leader open reading frame was introduced into the upstream flanking region of the gene. This report suggests a way to increase the expression of this gene, with a high G+C content, in E. coli.     

Kinetic and thermodynamic studies of peptidyltransferase in ribosomes from the extreme thermophile Thermus thermophilus

Throughout evolution, emerging organisms survived by adapting existing biochemical processes to new reaction conditions. Simple protein enzymes balanced changes in structural stability with changes that permitted optimal catalysis by adjustments in both entropic and enthalpic contributions to the free energy of activation for the reaction. Study of adaptive mechanisms by large multicomponent enzymes such as the ribosome has been largely unexplored. Here we have determined the kinetic and thermodynamic parameters of peptidyltransferase in ribosomes from the extreme thermophile Thermus thermophilus. Activity of thermophilic enzymes can be assayed over a wide range of temperatures, enabling one to measure accurate catalytic rates and determine enthalpic and entropic contributions to the free energy of activation of the reaction. Differences in the reaction conditions used here and in published studies on mesophilic ribosomes prevent direct comparison, but our data on Thermus ribosomes suggest that these ribosomes have adapted to changing environments using the same strategies as simple protein enzymes, balancing stability and flexibility without loss of catalytic rate. This strategy must be a very ancient process, perhaps first used by primitive ribosomes in the RNA World.     

Molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, Thermus thermophilus HB8.

The gene coding for isocitrate dehydrogenase of an extreme thermophile, Thermus thermophilus HB8, was cloned and sequenced. This gene consists of a single open reading frame of 1,485 bp preceded by a Shine-Dalgarno ribosome binding site. Promoter- and terminatorlike sequences were detected upstream and downstream of the open reading frame, respectively. The G + C content of the coding region was 65.6%, and that of the third nucleotide of the codons was 90.3%. On the basis of the deduced amino acid sequence, the Mr of the monomeric enzyme was calculated as 54,189, an Mr which is similar to that of the purified protein determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A comparison of the amino acid sequence of the T. thermophilus enzyme with that of the Escherichia coli enzyme showed (i) a 37% overall similarity; (ii) the conservation of the Ser residue, which is known to be phosphorylated in the E. coli enzyme, and of the surrounding sequence; and (iii) the presence of 141 extra residues at the C terminus of the T. thermophilus enzyme. T. thermophilus isocitrate dehydrogenase showed a high sequence homology (33% of the amino acid sequence is identical) to isopropylmalate dehydrogenase from the same organism and was suggested to have evolved from a common ancestral enzyme.     

Functions of isolated domains of methionyl-tRNA synthetase from an extreme thermophile, Thermus thermophilus HB8

Methionyl-tRNA synthetase (MetRS, 2 X 75 kDa) was purified to homogeneity from an extreme thermophile, Thermus thermophilus HB8. The polypeptide chain of MetRS was cleaved by limited digestion with trypsin into four domains: T1 (29 kDa), T2 (23 kDa), T3 (14.5 kDa), and T4 (7.5 kDa), which were aligned in that order. MetRS was also cleaved into similar fragments with a variety of other proteases. Domains T1, T2, T3, and T4 were isolated by column chromatography. "Tandem domain" T1-T2 (56 kDa) is fully active in the aminoacylation of tRNA and is further cleaved with trypsin into domains T1 and T2. Domain T1 is the smallest aminoacylation unit so far reported. Domain T2 (enzymatically inactive) interacts with tRNAMetf, as found by UV-induced cross-linking. Isolated domain T3 forms a dimer and is responsible for the dimer assembly of two protomers in MetRS. Domain T4 is a flexible tail of MetRS. These domains, in particular T1 and T2, will be important for detailed structure analyses in relation to aminoacylation activity.     

Molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, Thermus thermophilus HB8.

The gene coding for isocitrate dehydrogenase of an extreme thermophile, Thermus thermophilus HB8, was cloned and sequenced. This gene consists of a single open reading frame of 1,485 bp preceded by a Shine-Dalgarno ribosome binding site. Promoter- and terminatorlike sequences were detected upstream and downstream of the open reading frame, respectively. The G + C content of the coding region was 65.6%, and that of the third nucleotide of the codons was 90.3%. On the basis of the deduced amino acid sequence, the Mr of the monomeric enzyme was calculated as 54,189, an Mr which is similar to that of the purified protein determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A comparison of the amino acid sequence of the T. thermophilus enzyme with that of the Escherichia coli enzyme showed (i) a 37% overall similarity; (ii) the conservation of the Ser residue, which is known to be phosphorylated in the E. coli enzyme, and of the surrounding sequence; and (iii) the presence of 141 extra residues at the C terminus of the T. thermophilus enzyme. T. thermophilus isocitrate dehydrogenase showed a high sequence homology (33% of the amino acid sequence is identical) to isopropylmalate dehydrogenase from the same organism and was suggested to have evolved from a common ancestral enzyme.     

Pyrimidine biosynthesis genes (pyrE and pyrF) of an extreme thermophile, Thermus thermophilus.

We have isolated uracil auxotrophic mutants of an extreme thermophile, Thermus thermophilus. A part of the pyrimidine biosynthetic operon including genes for orotate phosphoribosyltransferase (pyrE) and for orotidine-5'-monophosphate decarboxylase (pyrF) was cloned and sequenced. The pyrE gene can be a bidirectional marker for the gene manipulation system of the thermophile.     

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.     

A new type of NADH dehydrogenase specific for nitrate respiration in the extreme thermophile Thermus thermophilus

A four-gene operon (nrcDEFN) was identified within a conjugative element that allows Thermus thermophilus to use nitrate as an electron acceptor. Three of them encode homologues to components of bacterial respiratory chains: NrcD to ferredoxins; NrcF to iron-sulfur-containing subunits of succinate-quinone oxidoreductase (SQR); and NrcN to type-II NADH dehydrogenases (NDHs). The fourth gene, nrcE, encodes a membrane protein with no homologues in the protein data bank. Nitrate reduction with NADH was catalyzed by membrane fractions of the wild type strain, but was severely impaired in nrc::kat insertion mutants. A fusion to a thermophilic reporter gene was used for the first time in Thermus spp. to show that expression of nrc required the presence of nitrate and anoxic conditions. Therefore, a role for the nrc products as a new type of membrane NDH specific for nitrate respiration was deduced. Consistent with this, nrc::kat mutants grew more slowly than the wild type strain under anaerobic conditions, but not in the presence of oxygen. The oligomeric structure of this Nrc-NDH was deduced from the analysis of insertion mutants and a two-hybrid bacterial system. Attachment to the membrane of NrcD, NrcF, and NrcN was dependent on NrcE, whose cytoplasmic C terminus interacts with the three proteins. Interactions were also detected between NrcN and NrcF. Inactivation of nrcF produced solubilization of NrcN, but not of NrcD. These data lead us to conclude that the Nrc proteins form a distinct third type of bacterial respiratory NDH.