A cDNA clone containing the entire coding sequence of a mouse H-2Kd histocompatibility antigen

We have isolated a cDNA clone carrying a 1560 bp long insert which contains the entire coding and 3' untranslated regions of an H-2K(d) mouse histocompatibility antigen. Its sequence and overal features are described. They point to the existence of unique properties of DNA sequences associated with the H-2K(d) antigen.     

Identification of an active gene by using large-scale cDNA sequencing

A 3′-directed partial cDNA clone that matches exactly a genomic sequence in GenBank was isolated while collecting transcribed sequences from adult lung by a random approach. This is the first report of active gene identification on genomic sequence without the aid of Northern hybridization.     

Study of an H-2Kd mutant strain: C.B6-H-2dm4

A new H-2 mutant involving the H-2d haplotype is described--C.B6-H-2dm4 (dm4). This mutant strain carries a gain and loss mutation which maps to the Kd gene of the H-2 complex. Serological testing comparing the mutant and the parental BALB/cKh strain failed to detect any difference between the two strains and no antibodies could be produced, although a reciprocal mixed lymphocyte reaction was observed between mutant and parent.     

Structural definition of the H-2Kd peptide-binding motif

Classic major histocompatibility complex (MHC) proteins associate with antigen- and self-derived peptides in an allele-specific manner. Herein we present the crystal structure of the MHC class I protein H-2K(d) (K(d)) expressed by BALB/c mice in complex with an antigenic peptide derived from influenza A/PR/8/34 nucleoprotein (Flu, residues 147-155, TYQRTRALV). Analysis of our structure in conjunction with the sequences of naturally processed epitopes provides a comprehensive understanding of the dominant K(d) peptide-binding motif. We find that Flu residues Tyr(P2), Thr(P5), and Val(P9) are sequestered into the B, C, and F pockets of the K(d) groove, respectively. The shape and chemistry of the polymorphic B pocket make it an optimal binding site for the side chain of Tyr(P2) as the dominant anchoring residue of nonameric peptides. The non-polar F pocket limits the amino acid repertoire at P9 to hydrophobic residues such as Ile, Leu, or Val, whereas the C pocket restricts the size of the P5-anchoring side chain. We also show that Flu is accommodated in the complex through an unfavorable kink in the otherwise extended peptide backbone due to the presence of a prominent ridge in the K(d) groove. Surprisingly, this backbone conformation is strikingly similar to D(b)-presented peptides despite the fact that these proteins employ distinct motif-anchoring strategies. The results presented in this study provide a solid foundation for the understanding of K(d)-restricted antigen presentation and recognition events.     

Brain-specific expression of MAP2 detected using a cloned cDNA probe

We describe the isolation of a set of overlapping cDNAs encoding mouse microtubule associated protein 2 (MAP2), using an anti-MAP antiserum to screen a mouse brain cDNA expression library cloned in bacteriophage lambda gt11. The authenticity of these clones was established by the following criteria: (a) three non-identical clones each expressing a MAP2 immunoreactive fusion protein were independently isolated from the expression library; each of these clones cross-hybridized at the nucleic acid level; (b) anti-MAP antiserum was affinity purified using nitrocellulose-bound fusion protein; these antibodies detected only MAP2 in an immunoblot experiment of whole brain microtubule protein; (c) a series of cDNA "walking" experiments was done so as to obtain a non-overlapping cloned fragment corresponding to a different part of the same mRNA molecule. Upon subcloning this non-overlapping fragment into plasmid expression vectors, a fusion protein was synthesized that was immunoreactive with an anti-MAP2 specific antiserum. Thus, a single contiguous cloned mRNA molecule encodes at least two MAP2-specific epitopes; (d) the cloned cDNA probes detect an mRNA species in mouse brain that is of a size (approximately 9 kb) consistent with the coding capacity required by a 250,000-D protein. The MAP2-specific cloned cDNA probes were used in RNA blot transfer experiments to assay for the presence of MAP2 mRNA in a variety of mouse tissues. Though brain contained abundant quantities of MAP2 mRNA, no corresponding sequences were detectable in RNA prepared from liver, kidney, spleen, stomach, or thymus. We conclude that the expression of MAP2 is brain-specific. Use of the MAP2 specific cDNA probes in genomic Southern blot transfer experiments showed the presence of a single gene encoding MAP2 in mouse. The microheterogeneity of MAP2 is therefore ascribable either to alternative splicing within a single gene, or to posttranslational modification(s), or both. Under conditions of low stringency, the mouse MAP2 cDNA probe cross-hybridizes with genomic sequences from rat, human, and (weakly) chicken, but not with sequences in frog, Drosophila, or sea urchin DNA. Thus, there is significant interspecies divergence of MAP2 sequences. The implications of the above observations are discussed in relationship to the potential biological function of MAP2.     

The amyloid precursor-like protein 2 and the adenoviral E3/19K protein both bind to a conformational site on H-2Kd and regulate H-2Kd expression

A protein of unknown physiological function, called amyloid precursor-like protein 2 (APLP2), forms an association with the murine class I molecule K(d) that is up-regulated by the presence of the adenoviral protein E3/19K. We have extended these findings to show that APLP2 and E3/19K associate preferentially with folded K(d) and not with the open form. APLP2 was detectable at the cell surface, but its surface expression was not up-regulated by the concurrent expression of K(d). Experimental down-regulation of APLP2 expression caused a consistent increase in the surface expression of K(d), indicating that APLP2 normally reduces K(d) surface expression. These data suggest a role for APLP2 in controlling the maturation of major histocompatibility complex class I molecules.     

cDNA cloning of a novel heterogeneous nuclear ribonucleoprotein gene homologue in Caenorhabditis elegans using hamster prion protein cDNA as a hybridization probe.

The mammalian prion protein (PrPc) is a cellular protein of unknown function, an altered isoform of which (PrPsc) is a component of the infectious particle (prion) thought to be responsible for spongiform encephalopathies in humans and animals. The evolutionary conservation of the PrP gene has been reported in the genomes of many vertebrates as well as certain invertebrates. In the genome of nematode Caenorhabditis elegans, the sequence capable of hybridizing with the mammalian PrP cDNA probe has been demonstrated, predicting the presence of the PrP gene homologue in C.elegans. In this study, Southern analysis with the hamster PrP cDNA (HaPrP) probe confirmed the previous observation. Moreover, Northern analysis revealed that the sequence is actively transcribed in adult worms. Thus, we screened C.elegans cDNA libraries with the HaPrP probe and isolated a cDNA that hybridizes to the same sequence in C.elegans that hybridized with the HaPrP probe in the Southern and Northern analyses. The deduced amino acid sequence of this cDNA, however, is substantially homologous with heterogeneous nuclear ribonucleoprotein (hnRNP) core proteins rather than mammalian PrPc. The hnRNPs contain the glycine-rich domain in the C-terminal half of the molecule, which also seemed to be in PrPc at the N-terminal half of the molecule. Both of the glycine-rich domains are composed of tracts with high G + C content, indicating that these tracts may due to the hybridizing signals. These results suggest that this cDNA clone is derived from a novel hnRNP gene homologue in C.elegans but not from a predicted PrP gene homologue.     

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus.     

NMR studies of an oligoproline-containing peptide analogue that binds specifically to the H-2Kd histocompatibility molecule

T lymphocytes expressing variable cell surface antigen receptors recognize "processed" forms of antigen, presented on the surface of other cells by molecules of the major histocompatibility complex (MHC). Naturally processed antigenic peptides can be replaced by synthetic ones. The synthetic peptide AYPPPPPTLA (P5) is an active competitor to the antigenic peptide HLA A24 170-182 (sequence RYLENGKETLQRA) that is recognized by A24 specific T cells in association with the H-2Kd class I MHC molecule. In P5 the five prolines were designed to play the role of a rigid spacer between the residue Y and the T-L unit, so as to mimic the role of Y171, T178, and L179 in the HLA A24 antigenic peptide, since these residues have proven to be the most important with respect to the binding of the HLA A24 peptide with the H-2Kd MHC molecule. Nuclear magnetic resonance studies allow us to demonstrate that in aqueous solution P5 adopts at least three long-lived conformations that can be classified with respect to the Y2-P3-P4 amide bonds as trans-trans, cis-trans, and cis-cis. Among these, the trans-trans form is present in 67% of the molecules while the two others share the remaining 33%.     

Efficient cDNA cloning method using solid phase DNA probe.

We are now developing a novel and efficient method using solid phase DNA probe to isolate a particular recombinant cDNA from single stranded cDNA library. Target clone coding metapyrocatechase (MPC) and cDNA library constructed from mRNA of U-937 (human lymphoma cell line) were converted to single stranded form by superinfection of helper phage (M13KO7). Probe DNA (25 mer) composed of a portion of the target cDNA was synthesized, attached to an HPLC gel and used as a solid phase DNA probe. Hybridization between probe DNA and target clone was performed in an Eppendorf tube within a few hours. Competent cell (JM109) was transformed with about one-twentieth of hybridized and eluted fraction by Hanahan's method. From the mixture of 1 ng of MPC vector and 5 micrograms of cDNA library, we obtained 50 colonies containing MPC gene out of 63 transformed colonies.     

A monoclonal antibody to viral glycoprotein blocks virus-immune effector T cells operating at H-2Dd but not at H-2Kd1.

A particular monoclonal antibody that binds to the influenza virus HA molecule inhibits HA-specific thymus-derived lymphocytes mediating cytotoxicity in the context of H-2Dd but not of H-2Kd. Another monoclonal antibody blocks both sets of HA-specific effector T cells. This observation, together with related findings from other laboratories, is considered to support the idea that T cell recognition is directed against some association of viral and H-2 glycoproteins, as proposed in the original formulation of the "altered self" concept.     

Identification and purification of functional human beta-cells by a new specific zinc-fluorescent probe.

Pancreatic beta-cells contain large amounts of zinc. We took advantage of this to try to localize, quantify, and isolate insulin-producing cells from islet preparations. Our study was designed to identify a non-toxic zinc-sensitive fluorescent probe able to selectively label labile zinc in viable beta-cells and to exhibit excitation and emission wavelengths in the visible spectrum, making this technique exploitable by most instruments. We tested Newport Green, a probe excitable at 485 nm with a dissociation constant in the micromolar range corresponding to a low affinity for zinc. The loading of the lipophilic esterified form of Newport Green was easy, rapid, specific, and non-toxic to cells. Confocal microscopy highlighted an intense fluorescence associated with secretory granules. Regression analyses showed a good relationship between zinc fluorescence and islet number (r = 0.98) and between zinc fluorescence and insulin content (r = 0.81). The determination of Zn fluorescence per DNA enabled us to assess the quality of the different islet preparations intended for islet allografting in terms of both purity and viability. Cell sorting of dissociated Newport Green-labeled cells resulted in a clear separation of beta-cells, as judged by insulin content per DNA and immunocytochemical analysis. This zinc probe, the first able to specifically label living cells in the visible spectrum, appears very promising for beta-cell experimentation, both clinically and for basic research.     

Highly diverse T cell recognition of a single Plasmodium berghei peptide presented by a series of mutant H-2Kd molecules.

We have tested 21 independent CTL clones for recognition of a single peptide derived from the Plasmodium berghei circumsporozoite protein in the context of 13 mutants of the murine MHC class I molecule H-2Kd. In this series of Kd mutants, amino acid residues located on the upper surface of the alpha-helices were individually substituted by alanine. Remarkably, most clones displayed individual recognition patterns on the Kd mutants. We had previously found that this series of CTL clones was likewise highly diverse in terms of both TCR primary structure and peptide fine specificity. Our data thus reinforce the concept that multiple T cell epitopes are available on the surface of a single peptide-MHC class I complex for recognition by specific TCR.     

Detection of a unique human V kappa IV germline gene by a cloned cDNA probe.

We have cloned the cDNA encoding the KIV chain of a human antibody with specificity against the major carbohydrate antigen of Streptococcus A. The cDNA has been used as a genetic probe to estimate the number of germline VKIV genes in human DNA. The presence of unique hybridizing bands on digestion of human DNA with several restriction endonucleases and the equivalence of the DNA in a band to a single gene per haploid genome point to the conclusion that there is a unique human VKIV germline gene. The corollary of this conclusion is that the diversity of human VKIV chains must be exclusively due to somatic mutation. This is supported by examination of the sequences of human KIV chain genes and their KIV chain products. Fusion of the unique germline VKIV gene (1) with one of several JK segments, followed by somatic mutations in the V region of the rearranged KIV gene, can account for the known sequences. The restricted germline gene repertoire may account for the small proportion of human KIV chains in the human K chain sequence library (2).