Nucleotide sequence of the glnA-glnL intercistronic region of Escherichia coli

The nucleotide (nt) sequence of a 682-bp fragment containing the 3' end of the glnA gene, the region between the glnA and glnL genes, and the 5' end of the glnL gene from Escherichia coli was determined. This segment contains the region coding for the last 107 amino acids (aa) of glutamine synthetase, including the adenylylation site of this enzyme. The analysis of this sequence revealed two REP sequences, a Rho-independent terminator, the putative glnL promoter and the possible binding site for the glnG product, NRI.     

Nucleotide sequence of the glnA control region of Escherichia coli

The RNA polymerase binding sites present along a DNA segment encompassing the glnA, glnL, and glnG genes have been identified in a hybrid plasmid carrying this chromosomal region of Escherichia coli. The DNA sequence was determined of an 817 base pair segment that contains the region coding for the first 42 amino acids of the NH2-terminal and of the glnA structural gene, as well as its regulatory region. Analysis of this nucleotide sequence revealed three probable RNA polymerase recognition sites, imperfect palindromes, inverted repeats, and direct repeated sequences.     

The DNA sequence at the T7 C promoter.

Restriction fragments of T7 DNA which selectively bind E. coli RNA polymerase have been identified. These include fragments located close to the beginning of gene 1 where according to Minkley and Pribnow (1973) there is a promoter called C. The smallest fragment from this region which binds RNA polymerase has been sequenced. It contains a promoter-like sequence, at an appropriate distance from the sequence TACA which Minkley and Pribnow suggested should lie at the initiation site of C. RNA synthesised in vitro from these fragments has been sequenced. The RNA sequence corresponds to the sequence to the right of the C promoter. The C promoter differs significantly from the A1 A2 and A3 promoters in sequence. Its structure and position suggest it plays a role in T7 infection.     

Characterization of a gene, glnL, the product of which is involved in the regulation of nitrogen utilization in Escherichia coli.

DNA was prepared from a strain of Escherichia coli bearing a mutation which confers the GlnC phenotype (inability to reduce the expression of glnA and other nitrogen-regulated operons in response to ammonia in the growth medium). A fragment of this DNA carrying glnA, the structural gene for glutamine synthetase, was cloned on plasmid pBR322. By using recombination in vitro, we mapped the GlnC mutation to a region between glnA and glnG. This region defines a gene, glnL, which codes for a trans-acting product; the GlnC mutant produces an altered product. The glnL product plays a key role in the communication of information concerning the quality and abundance of the nitrogen source in the growth medium to a destination responsible for the regulation of glnA and other genes for enzymes responsible for nitrogen utilization.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

Nucleotide sequence of Escherichia coli pyrG encoding CTP synthetase

The amino acid sequence of Escherichia coli CTP synthetase was derived from the nucleotide sequence of pyrG. The derived amino acid sequence, confirmed at the N terminus by protein sequencing, predicts a subunit of 544 amino acids having a calculated Mr of 60,300 after removal of the initiator methionine. A glutamine amide transfer domain was identified which extends from approximately amino acid residue 300 to the C terminus of the molecule. The CTP synthetase glutamine amide transfer domain contains three conserved regions similar to those in GMP synthetase, anthranilate synthase, p-aminobenzoate synthase, and carbamoyl-P synthetase. The CTP synthetase structure supports a model for gene fusion of a trpG-related glutamine amide transfer domain to a primitive NH3-dependent CTP synthetase. The major 5' end of pyrG mRNA was localized to a position approximately 48 base pairs upstream of the translation initiation codon. Translation of the gene eno, encoding enolase, is initiated 89 base pairs downstream of pyrG. The pyrG-eno junction is characterized by multiple mRNA species which are ascribed to monocistronic pyrG and/or eno mRNAs and a pyrG eno polycistronic mRNA.     

Nucleotide sequence of yeast gene CP A1 encoding the small subunit of arginine-pathway carbamoyl-phosphate synthetase. Homology of the deduced amino acid sequence to other glutamine amidotransferases

A yeast DNA fragment carrying the gene CP A1 encoding the small subunit of the arginine pathway carbamoyl-phosphate synthetase has been sequenced. Only one continuous coding sequence on this fragment was long enough to account for the presumed molecular mass of CP A1 protein product. It codes for a polypeptide of 411 amino acids having a relative molecular mass, Mr, of 45 358 and showing extensive homology with the product of carA, the homologous Escherichia coli gene. CP A1 and carA products are glutamine amidotransferases which bind glutamine and transfer its amide group to the large subunits where it is used for the synthesis of carbamoyl-phosphate. A comparison of the amino acid sequences of CP A1 polypeptide with the glutamine amidotransferase domains of anthranilate and p-amino-benzoate synthetases from various sources has revealed the presence in each of these sequences of three highly conserved regions of 8, 11 and 6 amino acids respectively. The 11-residue oligopeptide contains a cysteine which is considered as the active-site residue involved in the binding of glutamine. The distances (number of amino acid residues) which separate these homology regions are accurately conserved in these various enzymes. These observations provide support for the hypothesis that these synthetases have arisen by the combination of a common ancestral glutamine amidotransferase subunit with distinct ammonia-dependent synthetases. Little homology was detected with the amide transfer domain of glutamine phosphoribosyldiphosphate amidotransferase which may be the result of a convergent evolutionary process. The flanking regions of gene CP A1 have been sequenced, 803 base pairs being determined on the 5' side and 382 on the 3' side. Several features of the 5'-upstream region of CP A1 potentially related to the control of its expression have been noticed including the presence of two copies of the consensus sequence d(T-G-A-C-T-C) previously identified in several genes subject to the general control of amino acid biosynthesis.     

Cloning and characterization of a gene from Rhizobium melilotii 2011 coding for ribosomal protein S1.

A 7 kb chromosomal DNA fragment from R. melilotii was cloned, which complemented temperature-sensitivity of an E. coli amber mutant in rpsA, the gene for ribosomal protein S1 (ES1). From complementation and maxicell analysis a 58 kd protein was identified as the homolog of protein S1 (RS1). DNA sequence analysis of the R. melilotii rpsA gene identified a protein of 568 amino acids, which showed 47% identical amino acid homology to protein S1 from E. coli. The RS1 protein lacked the two Cys residues which had been reported to play an important role for the function of ES1. Two repeats containing Shine-Dalgarno sequences were identified upstream of the structural gene. Binding studies with RNA polymerase from E. coli and Pseudomonas putida located one RNA-polymerase binding site close to the RS1 gene and another one several hundred basepairs upstream. One possible promoter was also identified by DNA sequence comparison with the corresponding E. coli promoter.     

Cloning and expression of the Thiobacillus ferrooxidans glutamine synthetase gene in Escherichia coli.

The glutamine synthetase (GS) gene glnA of Thiobacillus ferrooxidans was cloned on recombinant plasmid pMEB100 which enabled Escherichia coli glnA deletion mutants to utilize (NH4)2SO4 as the sole source of nitrogen. High levels of GS-specific activity were obtained in the E. coli glnA deletion mutants containing the T. ferrooxidans GS gene. The cloned T. ferrooxidans DNA fragment containing the glnA gene activated histidase activity in an E. coli glnA glnL glnG deletion mutant containing the Klebsiella aerogenes hut operon. Plasmid pMEB100 also enabled the E. coli glnA glnL glnG deletion mutant to utilize arginine or low levels of glutamine as the sole source of nitrogen. There was no detectable DNA homology between the T. ferrooxidans glnA gene and the E. coli glnA gene.     

Internal homologies of the Ba fragment from human complement component Factor B, a class III MHC antigen

The amino acid sequence of Ba, a fragment of the complement protein Factor B, has been determined from the sequence of its corresponding cDNA. Ba is composed of 234 amino acids and from the sequence two striking regions of internal homology are apparent which are related to a third less homologous region. Analysis of cloned genomic DNA using an 81-bp cDNA probe containing coding information for part of a leader peptide and nine amino acids at the N terminus of Ba has established the extent of the 5' end of the Factor B gene and shown that the region of the gene encoding Ba is approximately 1.6 kb in length.     

耐辐射奇球菌超氧化物歧化酶基因的克隆与序列分析

By using a 453 bp length gene fragment of superoxide dismutase(SOD)as a probe,which was firstly amplified from Deinococcus radiodurans genomic DNA by PCR with degenerate oligonucleotide primers corresponding to the conservative regions of known SODs,a putative SOD gene was identified from the database of D.radiodurans whole genome.Its 636 bp length open reading frame and 5′ and 3′ flanking sequence was determined.The conventional E.coli ribosomal and RNA polymerase binding sites were found upstream from SOD encoding region and an inverted repeat sequence downstream of the termination codon.The deduced 211 amino acid sequence of the structural gene showed a high similarity to other manganese and iron containing SODs in normally conserve regions.