Relationship Between Moloney Murine Leukemia and Sarcoma Virus RNAs: Purification and Hybridization Map of Complementary DNAs from Defined Regions of Moloney Murine Sarcoma Virus 124

Complementary DNAs (cDNA's) specific for various regions of the Moloney murine sarcoma virus (MSV) 124 RNA genome were prepared by cross-hybridization techniques. A cDNA specific for the first 1,000 nucleotides adjacent to the RNA 3' end (cDNA 3') was prepared and shown to also be complementary to the 3'-terminal 1,000 nucleotides of a related Moloney murine leukemia virus (MLV) genome. A cDNA complementary to the "MSV-specific" portion of the MSV 124 genome was prepared. This cDNA was shown not to anneal to Moloney MLV RNA and to anneal to a portion of the viral RNA of about 1,500 to 1,800 nucleotides in length, located 1,000 nucleotides from the 3' end of MSV RNA. A cDNA common to the genome of MSV and MLV was also obtained and shown to anneal to the 5'-terminal two-thirds, as well as to the 3'-terminal 1,000 nucleotides, of the MSV RNA genome. This cDNA also annealed to the RNA from MLV and mainly to the 5'-terminal half of the MLV genome. It is concluded that the 6-kilobase Moloney MSV 124 RNA genome has a sequence arrangement that includes (i) a 3' portion of about 1,000 nucleotides, which is also present at the 3' terminus of MLV; (ii) an MSV-specific region, not shared with MLV, which extends between 1,000 and 2,500 nucleotides from the 3' terminus; and (iii) a second "common" region, again shared with MLV, which extends from 2,500 nucleotides to the 5' terminus. This second common region appears to be located in the 5' half of the 10-kilobase MLV genome as well. Experiments in which a large excess of cold MLV cDNA was annealed to (3)H-labeled polyadenylic acid-containing fragments of MSV RNA gave results consistent with this arrangement of the MSV genome.     

Distinct RNA elements confer specificity to flavivirus RNA cap methylation events

The 5' end of the flavivirus plus-sense RNA genome contains a type 1 cap (m(7)GpppAmG), followed by a conserved stem-loop structure. We report that nonstructural protein 5 (NS5) from four serocomplexes of flaviviruses specifically methylates the cap through recognition of the 5' terminus of viral RNA. Distinct RNA elements are required for the methylations at guanine N-7 on the cap and ribose 2'-OH on the first transcribed nucleotide. In a West Nile virus (WNV) model, N-7 cap methylation requires specific nucleotides at the second and third positions and a 5' stem-loop structure; in contrast, 2'-OH ribose methylation requires specific nucleotides at the first and second positions, with a minimum 5' viral RNA of 20 nucleotides. The cap analogues GpppA and m(7)GpppA are not active substrates for WNV methytransferase. Footprinting experiments using Gppp- and m(7)Gppp-terminated RNAs suggest that the 5' termini of RNA substrates interact with NS5 during the sequential methylation reactions. Cap methylations could be inhibited by an antisense oligomer targeting the first 20 nucleotides of WNV genome. The viral RNA-specific cap methylation suggests methyltransferase as a novel target for flavivirus drug discovery.     

Specific binding of host cellular proteins to multiple sites within the 3' end of mouse hepatitis virus genomic RNA.

The initial step in mouse hepatitis virus (MHV) RNA replication is the synthesis of negative-strand RNA from a positive-strand genomic RNA template. Our approach to begin studying MHV RNA replication is to identify the cis-acting signals for RNA synthesis and the proteins which recognize these signals at the 3' end of genomic RNA of MHV. To determine whether host cellular and/or viral proteins interact with the 3' end of the coronavirus genome, an RNase T1 protection/gel mobility shift electrophoresis assay was used to examine cytoplasmic extracts from mock- and MHV-JHM-infected 17Cl-1 murine cells for the ability to form complexes with defined regions of the genomic RNA. We demonstrated the specific binding of host cell proteins to multiple sites within the 3' end of MHV-JHM genomic RNA. By using a set of RNA probes with deletions at either the 5' or 3' end or both ends, two distinct binding sites were located. The first protein-binding element was mapped in the 3'-most 42 nucleotides of the genomic RNA [3' (+42) RNA], and the second element was mapped within an 86-nucleotide sequence encompassing nucleotides 171 to 85 from the 3' end of the genome (171-85 RNA). A single potential stem-loop structure is predicted for the 3' (+)42 RNA, and two stem-loop structures are predicted for the 171-85 RNA. Proteins interacting with these two elements were identified by UV-induced covalent cross-linking to labeled RNAs followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis. The RNA-protein complex formed with the 3'-most 42 nucleotides contains approximately five host polypeptides, a highly labeled protein of 120 kDa and four minor species with sizes of 103, 81, 70, and 55 kDa. The second protein-binding element, contained within a probe representing nucleotides 487 to 85 from the 3' end of the genome, also appears to bind five host polypeptides, 142, 120, 100, 55, and 33 kDa in size, with the 120-kDa protein being the most abundant. The RNA-protein complexes observed with MHV-infected cells in both RNase protection/gel mobility shift and UV cross-linking assays were identical to those observed with uninfected cells. The possible involvement of the interaction of host proteins with the viral genome during MHV replication is discussed.     

Localization of the Q beta replicase recognition site in MDV-1 RNA

Fragments of MDV-1 RNA (a small, naturally occurring template for Q beta replicase) that were missing nucleotides at either their 5' end or their 3' end were still able to form a complex with Q beta replicase. By assaying the binding ability of fragments of different length, it was established that the binding site for Q beta replicase is determined by nucleotide sequences that are located near the middle of MDV-1 RNA. Fragments missing nucleotides at their 5' end were able to serve as templates for the synthesis of complementary strands, but fragments missing nucleotides at their 3' end were inactive, indicating that the 3'-terminal region of the template is required for the initiation of RNA synthesis. The nucleotide sequences of both the 3' terminus and the central binding region of MDV-1 (+) RNA are almost identical to sequences at the 3' terminus and at an internal region of Q beta (-) RNA.     

Effects of mutations of the initiation nucleotides on hepatitis C virus RNA replication in the cell

Replication of nearly all RNA viruses depends on a virus-encoded RNA-dependent RNA polymerase (RdRp). Our earlier work found that purified recombinant hepatitis C virus (HCV) RdRp (NS5B) was able to initiate RNA synthesis de novo by using purine (A and G) but not pyrimidine (C and U) nucleotides (G. Luo et al., J. Virol. 74:851-863, 2000). For most human RNA viruses, the initiation nucleotides of both positive- and negative-strand RNAs were found to be either an adenylate (A) or guanylate (G). To determine the nucleotide used for initiation and control of HCV RNA replication, a genetic mutagenesis analysis of the nucleotides at the very 5' and 3' ends of HCV RNAs was performed by using a cell-based HCV replicon replication system. Either a G or an A at the 5' end of HCV genomic RNA was able to efficiently induce cell colony formation, whereas a nucleotide C at the 5' end dramatically reduced the efficiency of cell colony formation. Likewise, the 3'-end nucleotide U-to-C mutation did not significantly affect the efficiency of cell colony formation. In contrast, a U-to-G mutation at the 3' end caused a remarkable decrease in cell colony formation, and a U-to-A mutation resulted in a complete abolition of cell colony formation. Sequence analysis of the HCV replicon RNAs recovered from G418-resistant Huh7 cells revealed several interesting findings. First, the 5'-end nucleotide G of the replicon RNA was changed to an A upon multiple rounds of replication. Second, the nucleotide A at the 5' end was stably maintained among all replicon RNAs isolated from Huh7 cells transfected with an RNA with a 5'-end A. Third, initiation of HCV RNA replication with a CTP resulted in a >10-fold reduction in the levels of HCV RNAs, suggesting that initiation of RNA replication with CTP was very inefficient. Fourth, the 3'-end nucleotide U-to-C and -G mutations were all reverted back to a wild-type nucleotide U. In addition, extra U and UU residues were identified at the 3' ends of revertants recovered from Huh7 cells transfected with an RNA with a nucleotide G at the 3' end. We also determined the 5'-end nucleotide of positive-strand RNA of some clinical HCV isolates. Either G or A was identified at the 5' end of HCV RNA genome depending on the specific HCV isolate. Collectively, these findings demonstrate that replication of positive-strand HCV RNA was preferentially initiated with purine nucleotides (ATP and GTP), whereas the negative-strand HCV RNA replication is invariably initiated with an ATP.     

Binding of ribosomes to the 5' leader sequence (N = 258) of RNA 3 from alfalfa mosaic virus.

RNA 3 of alfalfa mosaic virus (AlMV) contains information for two genes: near the 5' end an active gene coding for a 35 Kd protein and, near the 3' end, a silent gene coding for viral coat protein. We have determined a sequence of 318 nucleotides which contains the potential initiation codon for the 35 Kd protein at 258 nucleotides from the 5' end. This long leader sequence can form initiation complexes containing three 80 S ribosomes. A shorter species of RNA, corresponding to a molecule of RNA 3 lacking the cap and the first 154 nucleotides (RNA 3') has been isolated. The remaining leader sequence of 104 nucleotides in RNA 3' forms a single 80 S initiation complex with wheat germ ribosomes. The location of the regions of the leader sequence of RNA 3 involved in initiation complex formation with 80 S ribosomes is reported.     

Mechanism of ribonucleic acid chain initiation. 1. A non-steady-state study of ribonucleic acid synthesis without enzyme turnover

A non-steady-state kinetic method has been developed to observe the initiation of long RNA chains by Escherichia coli RNA polymerase without the enzyme turnover. This method was used to determine the order of binding of the first two nucleotides to the enzyme in RNA synthesis with the first two nucleotides to the enzyme in RNA synthesis with poly(dA-dT) as the template. It was shown that initiator [ATP, uridyly(3'-5')adenosine, or adenyly(3'-5')uridylyl-(3'-5')adenosine] binds first to the enzyme-template complex, followed by UTP binding. The concentration dependence of UTP incorporation into the initiation complex suggests that more than one UTP molecule may bind to the enzyme-DNA complex during the initiation process. Comparison of the kinetic parameters derived from these studies with those obtained under steady-state conditions indicates that the steps involving binding of initiator or UTP during initiation cannot be rate limiting in the poly(dA-dT)-directed RNA synthesis. The non-steady-state technique also provides a method for active-site titration of RNA polymerase. The results show that only 36 +/- 9% of the enzyme molecules are active in a RNA polymerase preparation of high purity and specific activity. In addition, the minimal length of poly(dA-dT) involved in RNA synthesis by one RNA polymerase molecule was estimated to be approximately 500 base pairs.     

RNA end-labeling and RNA ligase activities can produce a circular rRNA in whole cell extracts from trypanosomes.

We have found two enzymatic activities in whole cell extracts from Trypanosoma brucei; an end-labeling reaction involving a single uridine at the 3' end of ribosomal RNAs (rRNAs) and an RNA ligase activity joining 5' monophosphates to 3' hydroxyl groups. The RNA ligase acts upon one of the small rRNAs (180 nucleotides) from the trypanosome ribosomal repeat unit, forming a circular RNA. The specific circularization of this small rRNA is probably dependent on the secondary structure of the molecule and is not detectable in vivo.     

The identification of the A-type RNA helices in a 55mer RNA by selective incorporation of deuterium-labelled nucleotide residues (Uppsala NMR-window concept)

The 55-nt long RNA, modelling a three-way junction, with non-uniformly incorporated deuterated nucleotides has been synthesised in a pure form. The NMR-window part in this partially deuterated 55mer RNA consists of natural non-enriched nucleotide blocks at the three-way junction (shown in a square box in Fig. 2), whereas all other nucleotides of the rest of the molecule are partially deuterated (> 97 atom% 2H at C2', C3', C5', C5, and approximately 50 atom% 2H at C4'). The secondary structure of this 55mer RNA was determined by 2D 1H NOESY spectroscopy in D2O or in 10% D2O-H2O mixture. The use of deuterated building blocks in the specific region of the 55mer RNA allowed us to identify two distinct A-type RNA helices in a straightforward manner by observing connectivities of H1' with the basepaired imino and the aromatic H2 of all adenosine nucleotides as the first step for the determination of its tertiary structure in a cost- and time-effective manner without employing any 13C/15N labelling. These two decameric helices involve 40 nucleotides, for which all non-exchangeable H1', H6, H2, H8 and H5 protons (all 40 H1', all 40 H6 or H8 aromatics, all seven H2 of adenine nucleotide and all four non-deuterated H5 of cytosines) as well as all 16 exchangeable imino protons (with the exception of four terminal basepairs) and 16 amino protons of cytosines have been assigned. Since all aromatic-H2', H3' as well as H5'/5' crosspeaks from partially deuterated residues have been eliminated from the NMR spectra, the observation of natural nucleotide residues in the NMR window part has essentially been simplified. It has been found that the crosspeaks from the natural nucleotides located at the three-way junction in the NMR-window part show different degrees of line-broadening, thereby indicating that the various nucleotide residues have very different mobilities with respect to themselves as well as compared to other nucleotides in the helices. The assignment of H2' and H3' in the NMR-window part has been made based on NOESY and DQF-COSY crosspeaks. It is noteworthy that, even in this preliminary study, it has been possible to identify 10 H2' out of total 14 and 9 H3' out of 14. The data show that expanded AU containing a tract of 55mer RNA does not self-organise into a tight third helix, as the two decameric A-type helices, across the three-way junction which is evident from the absence of any additional imino protons, except those that already have been assigned for the two decameric helices.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

The nucleotide sequence at the 5'' end of foot and mouth disease virus RNA.

Foot and mouth disease virus RNA has been treated with RNase H in the presence of oligo (dG) specifically to digest the poly(C) tract which lies near the 5' end of the molecule (10). The short (S) fragment containing the 5' end of the RNA was separated from the remainder of the RNA (L fragment) by gel electrophoresis. RNA ligase mediated labelling of the 3' end of S fragment showed that the RNase H digestion gave rise to molecules that differed only in the number of cytidylic acid residues remaining at their 3' ends and did not leave the unique 3' end necessary for fast sequence analysis. As the 5' end of S fragment prepared form virus RNA is blocked by VPg, S fragment was prepared from virus specific messenger RNA which does not contain this protein. This RNA was labelled at the 5' end using polynucleotide kinase and the sequence of 70 nucleotides at the 5' end determined by partial enzyme digestion sequencing on polyacrylamide gels. Some of this sequence was confirmed from an analysis of the oligonucleotides derived by RNase T1 digestion of S fragment. The sequence obtained indicates that there is a stable hairpin loop at the 5' terminus of the RNA before an initiation codon 33 nucleotides from the 5' end. In addition, the RNase T1 analysis suggests that there are short repeated sequences in S fragment and that an eleven nucleotide inverted complementary repeat of a sequence near the 3' end of the RNA is present at the junction of S fragment and the poly(C) tract.     

Structure and function of the 3' terminal six nucleotides of the west nile virus genome in viral replication

Using a self-replicating reporting replicon of West Nile (WN) virus, we performed a mutagenesis analysis to define the structure and function of the 3'-terminal 6 nucleotides (nt) (5'-GGAUCU(OH)-3') of the WN virus genome in viral replication. We show that mutations of nucleotide sequence or base pair structure of any of the 3'-terminal 6 nt do not significantly affect viral translation, but exert discrete effects on RNA replication. (i). The flavivirus-conserved terminal 3' U is optimal for WN virus replication. Replacement of the wild-type 3' U with a purine A or G resulted in a substantial reduction in RNA replication, with a complete reversion to the wild-type sequence. In contrast, replacement with a pyrimidine C resulted in a replication level similar to that of the 3' A or G mutants, with only partial reversion. (ii). The flavivirus-conserved 3' penultimate C and two upstream nucleotides (positions 78 and 79), which potentially base pair with the 3'-terminal CU(OH), are absolutely essential for viral replication. (iii). The base pair structures, but not the nucleotide sequences at the 3rd (U) and the 4th (A) positions, are critical for RNA replication. (iv). The nucleotide sequences of the 5th (G) position and its base pair nucleotide (C) are essential for viral replication. (v). Neither the sequence nor the base pair structure of the 6th nucleotide (G) is critical for WN virus replication. These results provide strong functional evidence for the existence of the 3' flavivirus-conserved RNA structure, which may function as contact sites for specific assembly of the replication complex or for efficient initiation of minus-sense RNA synthesis.     

More than half of yeast U1 snRNA is dispensable for growth.

Yeast U1 snRNA (568 nucleotides) is 3.5-fold larger than its mammalian counterpart (164 nucleotides) and contains apparent sequence homology only at the 5' and 3' ends. We have used deletion analysis to determine whether the yeast-specific U1 sequences play essential roles in vivo. Yeast cells carrying a deletion of more than 60% (355 nucleotides) of the single-copy U1 gene are viable, though slow-growing, while a deletion of 316 nucleotides allows essentially wild-type growth. The boundaries of the viable deletions define a dispensable internal domain which comprises sequences unique to yeast. In contrast, the essential 5' and 3' terminal domains correspond to phylogenetically conserved sequences and/or structures previously implicated in RNA:RNA and RNA:protein interactions. The minimal essential sequences of yeast U1 can be drawn in a secondary structure which resembles metazoan U1 in four of seven structural domains.     

5' exon requirement for self-splicing of the Tetrahymena thermophila pre-ribosomal RNA and identification of a cryptic 5' splice site in the 3' exon

The intervening sequence (IVS) of the Tetrahymena thermophila ribosomal RNA precursor undergoes accurate self-splicing in vitro. The work presented here examines the requirement for Tetrahymena rRNA sequences in the 5' exon for the accuracy and efficiency of splicing. Three plasmids were constructed with nine, four and two nucleotides of the natural 5' exon sequence, followed by the IVS and 26 nucleotides of the Tetrahymena 3' exon. RNA was transcribed from these plasmids in vitro and tested for self-splicing activity. The efficiency of splicing, as measured by the production of ligated exons, is reduced as the natural 5' exon sequence is replaced with plasmid sequences. Accurate splicing persists even when only four nucleotides of the natural 5' exon sequence remain. When only two nucleotides of the natural exon remain, no ligated exons are observed. As the efficiency of the normal reaction diminishes, novel RNA species are produced in increasing amounts. The novel RNA species were examined and found to be products of aberrant reactions of the precursor RNA. Two of these aberrant reactions involve auto-addition of GTP to sites six nucleotides and 52 nucleotides downstream from the 3' splice site. The former site occurs just after the sequence GGU, and may indicate the existence of a GGU-binding site within the IVS RNA. The latter site follows the sequence CUCU, which is identical with the four nucleotides preceding the 5' splice site. This observation led to a model where where the CUCU sequence in the 3' exon acts as a cryptic 5' splice site. The model predicted the existence of a circular RNA containing the first 52 nucleotides of the 3' exon. A small circular RNA was isolated and partially sequenced and found to support the model. So, a cryptic 5' splice site can function even if it is located downstream from the 3' splice site. Precursor RNA labeled at its 5' end, presumably by a GTP exchange reaction mediated by the IVS, is also described.