Different E-box regulatory sequences are functionally distinct when placed within the context of the troponin I enhancer.

Basic helix-loop-helix (bHLH) regulatory proteins are known to bind to a single DNA consensus sequence referred to as an E-box. The E-box is present in the regulatory elements of many developmentally controlled genes, including most muscle-specific genes such as troponin I (TnI). Although the E-box consensus is minimally defined as CANNTG, the adjacent nucleotides of functional E-boxes are variable for genes regulated by the bHLH proteins. In order to examine how E-box regulatory regions containing different internal and flanking nucleotides function when placed within the context of a single regulatory element, the E-box region (14 bp) present within the TnI enhancer was substituted with the corresponding E-box sequences derived from the muscle-specific M-creatine kinase (MCK) and cardiac alpha-actin regulatory elements as well as from the immunoglobulin kappa (Ig kappa) enhancer. Within the TnI enhancer, the E-box sequence derived from cardiac alpha-actin was inactive whereas the corresponding sequence from the MCK right E-box efficiently restored wild-type enhancer activity in muscle cells. Intermediate levels of gene activity were observed for TnI enhancers containing E-boxes derived from the MCK left E-box site or from the Ig kappa E2 E-box. DNA binding studies of MyoD:E12 protein complexes with each substituted TnI enhancer confirmed that DNA binding activity in vitro mimics the relative strength of the enhancers in vivo. These studies demonstrate that the specific nucleotide composition of individual E-boxes, which are contained within the regulatory elements of most if not all muscle-specific genes, contributes to the complex regulatory mechanisms governing bHLH-mediated gene expression.     

Differential binding of quadruplex structures of muscle-specific genes regulatory sequences by MyoD, MRF4 and myogenin

Four myogenic regulatory factors (MRFs); MyoD, Myf-5, MRF4 and Myogenin direct muscle tissue differentiation. Heterodimers of MRFs with E-proteins activate muscle-specific gene expression by binding to E-box motifs d(CANNTG) in their promoters or enhancers. We showed previously that in contrast to the favored binding of E-box by MyoD-E47 heterodimers, homodimeric MyoD associated preferentially with quadruplex structures of regulatory sequences of muscle-specific genes. To inquire whether other MRFs shared the DNA binding preferences of MyoD, the DNA affinities of hetero- and homo-dimeric MyoD, MRF4 and Myogenin were compared. Similarly to MyoD, heterodimers with E47 of MRF4 or Myogenin bound E-box more tightly than quadruplex DNA. However, unlike homodimeric MyoD or MRF4, Myogenin homodimers associated weakly and nonpreferentially with quadruplex DNA. By reciprocally switching basic regions between MyoD and Myogenin we demonstrated dominance of MyoD in determining the quadruplex DNA-binding affinity. Thus, Myogenin with an implanted MyoD basic region bound quadruplex DNA nearly as tightly as MyoD. However, a grafted Myogenin basic region did not diminish the high affinity of homodimeric MyoD for quadruplex DNA. We speculate that the dissimilar interaction of MyoD and Myogenin with tetrahelical domains in muscle gene promoters may differently regulate their myogenic activities.     

Multiple regulatory elements contribute differentially to muscle creatine kinase enhancer activity in skeletal and cardiac muscle.

We have used transient transfections in MM14 skeletal muscle cells, newborn rat primary ventricular myocardiocytes, and nonmuscle cells to characterize regulatory elements of the mouse muscle creatine kinase (MCK) gene. Deletion analysis of MCK 5'-flanking sequence reveals a striated muscle-specific, positive regulatory region between -1256 and -1020. A 206-bp fragment from this region acts as a skeletal muscle enhancer and confers orientation-dependent activity in myocardiocytes. A 110-bp enhancer subfragment confers high-level expression in skeletal myocytes but is inactive in myocardiocytes, indicating that skeletal and cardiac muscle MCK regulatory sites are distinguishable. To further delineate muscle regulatory sequences, we tested six sites within the MCK enhancer for their functional importance. Mutations at five sites decrease expression in skeletal muscle, cardiac muscle, and nonmuscle cells. Mutations at two of these sites, Left E box and MEF2, cause similar decreases in all three cell types. Mutations at three sites have larger effects in muscle than nonmuscle cells; an A/T-rich site mutation has a pronounced effect in both striated muscle types, mutations at the MEF1 (Right E-box) site are relatively specific to expression in skeletal muscle, and mutations at the CArG site are relatively specific to expression in cardiac muscle. Changes at the AP2 site tend to increase expression in muscle cells but decrease it in nonmuscle cells. In contrast to reports involving cotransfection of 10T1/2 cells with plasmids expressing the myogenic determination factor MyoD, we show that the skeletal myocyte activity of multimerized MEF1 sites is 30-fold lower than that of the 206-bp enhancer. Thus, MyoD binding sites alone are not sufficient for high-level expression in skeletal myocytes containing endogenous levels of MyoD and other myogenic determination factors.     

Tetrahelical forms of the fragile X syndrome expanded sequence d(CGG)(n) are destabilized by two heterogeneous nuclear ribonucleoprotein-related telomeric DNA-binding proteins

Formations of hairpin and tetrahelical structures by the trinucleotide repeat sequence d(CGG)(n) might contribute to its expansion in fragile X syndrome. Here we show that tetraplex structures of d(CGG)(n) are destabilized by two mammalian heterogeneous nuclear ribonucleoprotein-related tetraplex telomeric DNA-binding and -stabilizing proteins, quadruplex telomeric DNA-binding protein 42 (qTBP42) (Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474-4482) and unimolecular quadruplex telomeric DNA-binding protein 25 (uqTBP25) (Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 15881-15890). Blunt-ended and 3'-tailed or 3'- and 5'-tailed bimolecular tetraplex structures of d(CGG)(n) and guanine-sparse 20-/46-mer partial DNA duplex were progressively destabilized by increasing amounts of qTBP42 or uqTBP25 in time-dependent and ATP- or Mg(2+)-independent reactions. By contrast, tetraplex structures of telomeric and IgG sequences or guanine-rich double-stranded DNA resisted destabilization by qTBP42 or uqTBP25. Increased stability of tetraplex d(CGG)(n) in the presence of K(+) or Na(+) ions or at lowered reaction temperature diminished the destabilizing activity of uqTBP25. The contrasting stabilization of tetraplex telomeric DNA and destabilization of tetraplex d(CGG)(n) by qTBP42 and uqTBP25 suggested that sequence or structural differences between these tetraplexes might serve as cues for the differential stabilizing/destabilizing activities.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

Tetraplex folding of telomere sequences and the inclusion of adenine bases.

Telomeres are required for eukaryotic chromosome stability. They consist of regularly repeating guanine-rich sequences, with a single-stranded 3' terminus. Such sequences have been demonstrated to have the propensity to adopt four-stranded structures based on a tetrad of guanine bases. The formation of an intramolecular foldback tetraplex is associated with markedly increased mobility in polyacrylamide. Most telomeric sequences are based either on a repeat of d(TnGGGG) or d(TnAGGG) sequences. We have used a combination 7-deazaguanine or 7-deaza-adenine substitution, chemical modification and gel electrophoresis to address the following aspects of intramolecular tetraplex formation. (i) Intramolecular tetraplex formation by d(TTTTGGGG)4 sequences is prevented by very low levels of 7-deazaguanine substitution. This confirms the important role of guanine N7 in the formation of the tetraplex. (ii) The sequences d(TTAGGG)4 and d(TTTTAGGG)4 fold into tetraplexes. By contrast, the electrophoretic behaviour of d(TTTTGGGA)4, d(TTTTAGAG)4 and d(TTTTGAGA)4 does not indicate formation of stable intramolecular tetraplexes under available conditions. (iii) Selective 7-deazaguanine and 7-deaza-adenine substitutions in d(TTTTAGGG)4 give results consistent with tetraplex folding by the formation of three G4 tetrads, with the adenine bases formally part of the single-stranded loops, where they probably interact with thymine bases. These results demonstrate that eukaryotic cells appear to have selected just those sequences that can adopt the tetraplex conformation for their telomeres, while those that cannot have been avoided. This suggests that the conformation may be significant in the function of the telomere, such as attachment to nuclear structures.     

Formation and structural determinants of multi-stranded guanine-rich DNA complexes

We have investigated the complexes formed by oligonucleotides with the general sequence d(T15,Gn), where n = 4-15. Two distinct classes of structures are formed, namely, the four-stranded tetraplex and frayed wires. Frayed wires differ from four-stranded tetraplexes in both strand association stoichiometry and the ability of dimethyl sulfate to methylate the N7 position of guanine. Thus, it appears that these two guanine-rich multistranded assemblies are stabilised by different guanine-guanine interactions. The number of contiguous guanine residues determines which of the complexes is favoured. Based on the stoichiometry of the associated species and the accessibility of the N7 position of guanine to methylation we have found that oligonucleotides with smaller number of contiguous guanines; n = 5-8, form primarily four-stranded tetraplex. Oligonucleotides with larger numbers of contiguous guanines adapt primarily the frayed wire structure. The stability of the complexes formed by this series of oligonucleotides is determined by the number and arrangement of the guanines within the sequences. We propose that the formation of the two types of complex proceed by a parallel reaction pathways that may share common intermediates.