Similarity of Structural Features and Evolution of Satellite DNAs from Palorus subdepressus (Coleoptera) and Related Species

A novel highly abundant satellite DNA comprising 20% of the genome has been characterized in Palorus subdepressus (Insecta, Coleoptera). The 72-bp-long monomer sequence is composed of two copies of T₂A₅T octanucleotide alternating with 22-nucleotide-long elements of an inverted repeat. Phylogenetic analysis revealed clustering of monomer sequence variants into two clades. Two types of variants are prevalently organized in an alternating pattern, thus showing a tendency to generate a new complex repeating unit 144 bp in length. Fluorescent in situ hybridization revealed even distribution of the satellite in the region of pericentric heterochromatin of all 20 chromosomes. P. subdepressus satellite sequence is clearly species specific, lacking similarity even with the satellite from congeneric species P. ratzeburgii. However, on the basis of similarity in predicted tertiary structure induced by intrinsic DNA curvature and in repeat length, P. subdepressus satellite can be classified into the same group with satellites from related tenebrionid species P. ratzeburgii, Tenebrio molitor, and T. obscurus. It can be reasonably inferred that repetitive sequences of different origin evolve under constraints to adopt and conserve particular features. Obtained results suggest that the higher-order structure and repeat length, but not the nucleotide sequence itself, are maintained through evolution of these species. Received: 23 April 1997 / Accepted: 11 July 1997     

Mutation and Recombination in Cattle Satellite DNA: A Feedback Model for the Evolution of Satellite DNA Repeats

The cattle genome contains several distinct centromeric satellites with interrelated evolutionary histories. We compared these satellites in Bovini species that diverged 0.2 to about 5 Myr ago. Quantification of hybridization signals by phosphor imaging revealed a large variation in the relative amounts of the major satellites. In the genome of water buffalo this has led to the complete deletion of satellite III. Comparative sequencing and PCR-RFLP analysis of satellites IV, 1.711a, and 1.711b from the related Bos and Bison species revealed heterogeneities in 0.5 to 2% of the positions, again with variations in the relative amounts of sequence variants. Restriction patterns generated by double digestions suggested a recombination of sequence variants. Our results are compatible with a model of the life history of satellites during which homogeneity of interacting repeat units is both cause and consequence of the rapid turnover of satellite DNA. Initially, a positive feedback loop leads to a rapid saltatory amplification of homogeneous repeat units. In the second phase, mutations inhibit the interaction of repeat units and coexisting sequence variants amplify independently. Homogenization by the spreading of one of the variants is prevented by recombination and the satellite is eventually outcompeted by another, more homogeneous tandem repeat sequence. Received: 21 July 2000 / Accepted: 30 October 2000     

Molecular Characterization of the Principal Symbiotic Bacteria of the Weevil Sitophilus oryzae: A Peculiar G + C Content of an Endocytobiotic DNA

The principal intracellular symbiotic bacteria of the cereal weevil Sitophilus oryzae were characterized using the sequence of the 16S rDNA gene (rrs gene) and G + C content analysis. Polymerase chain reaction amplification with universal eubacterial primers of the rrs gene showed a single expected sequence of 1,501 bp. Comparison of this sequence with the available database sequences placed the intracellular bacteria of S. oryzae as members of the Enterobacteriaceae family, closely related to the free-living bacteria, Erwinia herbicola and Escherichia coli, and the endocytobiotic bacteria of the tsetse fly and aphids. Moreover, by high-performance liquid chromatography, we measured the genomic G + C content of the S. oryzae principal endocytobiotes (SOPE) as 54%, while the known genomic G + C content of most intracellular bacteria is about 39.5%. Furthermore, based on the third codon position G + C content and the rrs gene G + C content, we demonstrated that most intracellular bacteria except SOPE are A + T biased irrespective of their phylogenetic position. Finally, using the hsp60 gene sequence, the codon usage of SOPE was compared with that of two phylogenetically closely related bacteria: E. coli, a free-living bacterium, and Buchnera aphidicola, the intracellular symbiotic bacteria of aphids. Taken together, these results show a peculiar and distinctly different DNA composition of SOPE with respect to the other obligate intracellular bacteria, and, combined with biological and biochemical data, they elucidate the evolution of symbiosis in S. oryzae. Received: 8 September 1997 / Accepted: 24 October 1997     

A Family of Differentially Amplified Repetitive DNA Sequences in the Genus Beta Reveals Genetic Variation in Beta vulgaris Subspecies and Cultivars

Members of a highly abundant restriction satellite family have been isolated from the wild beet species Beta nana. The satellite DNA sequence is characterized by a conserved RsaI restriction site and is present in three of four sections of the genus Beta, namely Nanae, Corollinae, and Beta. It was not detected in species of the evolutionary old section Procumbentes, suggesting its amplification after separation of this section. Sequences of eight monomers were aligned revealing a size variation from 209 to 233 bp and an AT content ranging from 56.5% to 60.5%. The similarity between monomers in B. nana varied from 77.7% to 92.2%. Diverged subfamilies were identified by sequence analysis and Southern hybridization. A comparative study of this repetitive DNA element by fluorescent in situ hybridization and Southern analyses in three representative species was performed showing a variable genomic organization and heterogeneous localizations along metaphase chromosomes both within and between species. In B. nana the copy number of this satellite, with some 30,000 per haploid genome, is more than tenfold higher than in Beta lomatogona and up to 200 times higher than in Beta vulgaris, indicating different levels of sequence amplification during evolution in the genus Beta. In sugar beet (B. vulgaris), the large-scale organization of this tandem repeat was examined by pulsed-field gel electrophoresis. Southern hybridization to genomic DNA digested with DraI demonstrated that satellite arrays are located in AT-rich regions and the tandem repeat is a useful probe for the detection of genetic variation in closely related B. vulgaris cultivars, accessions, and subspecies. Received: 24 May 1996 / Accepted: 13 September 1996     

Sequence characteristics of a cervid DNA repeat family

The (G + C) distribution and the presence and amounts of repetitive sequence families in the white-tailed deer (Odocoileus virginianus) have been examined. The distribution ranges from 20 to 70% (G + C) and shows four distinct repeat families. A 0.7-kb family, DII, corresponds to satellite II in domestic bovids—ox, sheep, and goat—and was singled out for detailed characterization. DII has a prototypic repeat of 67% (G + C), consists of 25,000 tandem copies, and contributes 1.7% to the genomic DNA. Sequencing and electrophoretic analysis indicate a repeat length of 691 bp. These characteristics are similar to those of the bovid satellite II families as well as to those of other cervids that we have examined. The intraspecific sequence divergence within this family has a variance of only 2.5 ± 0.3%. Present address: ICRP, Room 533, Lincoln's Inn Fields, London WC2A 3PX, England. Correspondence to: R.D. Blake     

Sequence of PRAT Satellite DNA ``Frozen' in Some Coleopteran Species

The intriguing diversity of highly abundant satellite repeats found even among closely related species can result from processes leading to dramatic changes in copy number of a particular sequence in the genome and not from rapid accumulation of mutations. To test this hypothesis, we investigated the distribution of the PRAT satellite DNA family, a highly abundant major satellite in the coleopteran species Palorus ratzeburgii, in eight species belonging to the related genera (Tribolium, Tenebrio, Latheticus), the subfamily (Pimeliinae), and the family (Chrysomelidae). Dot blot analysis and PCR assay followed by Southern hybridization revealed that the PRAT satellite, in the form of low-copy number repeats, was present in all tested species. The PRAT satellite detected in the species Pimelia elevata has been sequenced, and compared with previously cloned PRAT monomers from Palorus ratzeburgii and Palorus subdepressus. Although the two Palorus species diverged at least 7 Myr ago, and the subfamily Pimeliinae separated from the genus Palorus 50–60 Myr ago, all PRAT clones exhibit high mutual homology, with average variability relative to the common consensus sequence of 1.3%. The presence of ancestral mutations found in PRAT clones from all three species as well as the absence of species diagnostic mutations illustrate extremely slow sequence evolution. This unexpectedly high conservation of PRAT satellite DNA sequence might be induced by a small bias of turnover mechanisms favoring the ancestral sequence in the process of molecular drive.     

Unusual and Strongly Structured Sequence Variation in a Complex Satellite DNA Family from the Nematode Meloidogyne chitwoodi

An AluI satellite DNA family has been isolated in the genome of the root-knot nematode Meloidogyne chitwoodi. This repeated sequence was shown to be present at approximately 11,400 copies per haploid genome, and represents about 3.5% of the total genomic DNA. Nineteen monomers were cloned and sequenced. Their length ranged from 142 to 180 bp, and their A + T content was high (from 65.7 to 79.1%), with frequent runs of As and Ts. An unexpected heterogeneity in primary structure was observed between monomers, and multiple alignment analysis showed that the 19 repeats could be unambiguously clustered in six subfamilies. A consensus sequence has been deduced for each subfamily, within which the number of positions conserved is very high, ranging from 86.7% to 98.6%. Even though blocks of conserved regions could be observed, multiple alignment of the six consensus sequences did not enable the establishment of a general unambiguous consensus sequence. Screening of the six consensus sequences for evidence of internal repeated subunits revealed a 6-bp motif (AAATTT), present in both direct and inverted orientation. This motif was found up to nine times in the consensus sequences, also with the occurrence of degenerated subrepeats. Along with the meiotic parthenogenetic mode of reproduction of this nematode, such structural features may argue for the evolution of this satellite DNA family either (1) from a common ancestral sequence by amplification followed by mechanisms of sequence divergence, or (2) through independent mutations of the ancestral sequence in isolated amphimictic nematode populations and subsequent hybridization events. Overall, our results suggest the ancient origin of this satellite DNA family, and may reflect for M. chitwoodi a phylogenetic position close to the ancestral amphimictic forms of root-knot nematodes. Received: 23 April 1997 / Accepted: 9 July 1997     

Are Noncoding Sequences of Rickettsia prowazekii Remnants of ``Neutralized' Genes?

It has been hypothesized that a large fraction of 24% noncoding DNA in R. prowazekii consists of degraded genes. This hypothesis has been based on the relatively high G+C content of noncoding DNA. However, a comparison with other genomes also having a low overall G+C content shows that this argument would also apply to other bacteria. To test this hypothesis, we study the coding potential in sets of genes, pseudogenes, and intergenic regions. We find that the correlation function and the χ²-measure are clearly indicative of the coding function of genes and pseudogenes. However, both coding potentials make almost no indication of a preexisting reading frame in the remaining 23% of noncoding DNA. We simulate the degradation of genes due to single-nucleotide substitutions and insertions/deletions and quantify the number of mutations required to remove indications of the reading frame. We discuss a reduced selection pressure as another possible origin of this comparatively large fraction of noncoding sequences. Received: 27 December 1999 / Accepted: 5 July 2000     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

A Complex Organization of the Gene Encoding Cytochrome Oxidase Subunit 1 in the Mitochondrial Genome of the Dinoflagellate, Crypthecodinium cohnii: Homologous Recombination Generates Two Different cox1 Open Reading Frames

In the course of investigating mitochondrial genome organization in Crypthecodinium cohnii, a non-photosynthetic dinoflagellate, we identified four EcoRI fragments that hybridize to a probe specific for cox1, the gene that encodes subunit 1 of cytochrome oxidase. Cloning and sequence characterization of the four fragments (5.7, 5.1, 4.1, 3.5 kilobase pairs) revealed that cox1 exists in four distinct but related contexts in C. cohnii mtDNA, with a central repeat unit flanked by one of two possible upstream (flanking domain 1 or 2) and downstream (flanking domain 3 or 4) regions. The majority of the cox1 gene is located within the central repeat; however, the C-terminal portion of the open reading frame extends into flanking domains 3 and 4, thereby creating two distinct cox1 coding sequences. The 3′-terminal region of one of the cox1 reading frames can assume an elaborate secondary structure, which potentially could act to stabilize the mature mRNA against nucleolytic degradation. In addition, a high density of small inverted repeats (15–22 base pairs) has been identified at the 5′-end of cox1, further suggesting that hairpin structures could be important for gene regulation. The organization of cox1 in C. cohnii mtDNA appears to reflect homologous recombination events within the central repeat between different cox1 sequence contexts. Such recombining repeats are a characteristic feature of plant (angiosperm) mtDNA, but they have not previously been described in the mitochondrial genomes of protists. Received: 21 December 2000 / Accepted: 30 January 2001     

Two Aspects of DNA Base Composition: G+C Content and Translation-Coupled Deviation from Intra-Strand Rule of A=T and G=C

The relative contribution of mutation and selection to the G+C content of DNA was analyzed in bacterial species having widely different G+C contents. The analysis used two methods that were developed previously. The first method was to plot the average G+C content of a set of nucleotides against the G+C content of the third codon position for each gene. This method was used to present the G+C distribution of the third codon position and to assess the relative neutrality of a set of nucleotides to that of the G+C content of the third codon position. The second method was to plot the intrastrand bias of the third codon position from Parity Rule 2 (PR2), where A=T and G=C. It was found that whereas intragenomic distributions of the DNA G+C content of these bacteria are narrow in the majority of species, in some species the G+C content of the minor class of genes distributes over wider ranges than the major class of genes. On the other hand, ubiquitous PR2 biases are amino acid specific and independent of the G+C content of DNA, so that when averaged over the amino acids, the biases are small and not correlated with the DNA G+C content. Therefore, translation coupled PR2-biases are unlikely to explain the wide range of G+C contents among different species. Considering all data available, it was concluded that the amino acid-specific PR2 bias has only a minor effect, if any, on the average G+C content. In addition, PR2 bias patterns of different species show phylogenetic relationships, and the pattern can be as a taxal fingerprint. Received: 5 November 1998 / Accepted: 1 March 1999     

A Concertedly Evolving Region in Chironomus, Unique Within the Telomere

Chromosome terminal, complex repeats in the dipteran Chironomus pallidivittatus show rapid concerted evolution during which there is remarkably efficient homogenization of the repeat units within and between chromosome ends. It has been shown previously that gene conversion is likely to be an important component during these changes. The sequence evolution could be a result of different processes—exchanges between repeats in the tandem array as well as information transfer between units in different chromosomes—and is therefore difficult to analyze in detail. In this study the concerted evolution of a region present only once per chromosome, at the junction between the telomeric complex repeats and the subtelomeric DNA was therefore investigated in the two sibling species C. pallidivittatus and C. tentans. Material from individual microdissected chromosome ends was used, as well as clones from bulk genomic DNA. On the telomeric side of the border pronounced species-specific sequence differences were observed, the patterns being similar for clones of different origin within each species. Mutations had been transmitted efficiently between chromosomes also when adjoining, more distally localized DNA showed great differences in sequence, suggesting that gene conversion had taken place. The evolving telomeric region bordered proximally to subtelomeric DNA with high evolutionary constancy. More proximally localized, subtelomeric DNA evolved more rapidly and showed heterogeneity between species and chromosomes. Received: 24 September 1997 / Accepted: 24 November 1997     

DNA Polymerase C of the Thermophilic Bacterium Thermus aquaticus: Classification and Phylogenetic Analysis of the Family C DNA Polymerases

Bacterial family C DNA polymerases (DNA pol IIIs), the major chromosomal replicative enzymes, have been provisionally classified based on primary sequences and domain structures into three classes: class I (Escherichia coli DNA pol C-type), class II (Bacillus subtilis DNA pol C-type), and class III (cyanobacterial DNA pol C-type), respectively. We have sequenced the structural gene encoding the DNA pol C catalytic subunit of the thermophilic bacterium Thermus aquaticus. This gene, designated the Taq DNA pol C gene, contains a 3660-bp open reading frame which specifies a polypeptide of molecular weight of 137,388 daltons. Comparative sequence analyses revealed that Taq DNA pol C is a class I family C DNA polymerase. The Taq DNA pol C is most closely related to the Deinococcus radiodurans DNA pol C. Although a phylogenetic tree based on the class I family C DNA pols is still in the provisional stage, some important conclusion can be drawn. First, the high-G+C and the low-G+C Gram-positive bacteria are not monophyletic. Second, the low-G+C Gram-positive bacteria contain multigenes of family C DNA pols (classes I and II). Third, the cyanobacterial family C DNA pol, classified as class III because it is encoded by a split gene, forms a group with the high-G+C Gram-positive bacteria. Received: 7 October 1998 / Accepted: 12 January 1999     

Phylogenetic Position of the Mitochondrion-Lacking Protozoan Trichomonas tenax,Based on Amino Acid Sequences of Elongation Factors 1α and 2

Major parts of amino-acid-coding regions of elongation factor (EF)-1α and EF-2 in Trichomonas tenax were amplified by PCR from total genomic DNA and the products were cloned into a plasmid vector, pGEM-T. The three clones from each of the products of the EF-1α and EF-2 were isolated and sequenced. The insert DNAs of the clones containing EF-1α coding regions were each 1,185 bp long with the same nucleotide sequence and contained 53.1% of G + C nucleotides. Those of the clones containing EF-2 coding regions had two different sequences; one was 2,283 bp long and the other was 2,286 bp long, and their G + C contents were 52.5 and 52.9%, respectively. The copy numbers of the EF-1α and EF-2 gene per chromosome were estimated as four and two, respectively. The deduced amino acid sequences obtained by the conceptual translation were 395 residues from EF-1α and 761 and 762 residues from the EF-2s. The sequences were aligned with the other eukaryotic and archaebacterial EF-1αs and EF-2s, respectively. The phylogenetic position of T. tenax was inferred by the maximum likelihood (ML) method using the EF-1α and EF-2 data sets. The EF-1α analysis suggested that three mitochondrion-lacking protozoa, Glugea plecoglossi, Giardia lamblia, and T. tenax, respectively, diverge in this order in the very early phase of eukaryotic evolution. The EF-2 analysis also supported the divergence of T. tenax to be immediately next to G. lamblia. Received: 15 February 1996 / Accepted: 28 June 1996     

Complex and Tandem Repeat Structure of Subtelomeric Regions in the Taiwan Cricket, <Emphasis Type="BoldItalic">Teleogryllus taiwanemma</Emphasis>

Telomeres of most insects are composed of simple (TTAGG) _n repeats that are synthesized by telomerase. However, in some dipteran insects such as Drosophila melanogaster, (TTAGG) _n repeats or telomerase activity has not been detected. Although telomere structure is well documented in Diptera and Lepidoptera, very limited information is available on lower insect groups. To understand general aspects of telomere function and evolution in insects, we endeavored to characterize structures of the telomeric and subtelomeric regions in a lower insect, the Taiwan cricket, Teleogryllus taiwanemma. FISH analysis of this insect's chromosomes demonstrated (TTAGG) _n repeat elements in all distal ends. Just proximal to the telomeric repeats, the highly conserved 9-kb long terminal unit (LTU) sequences are tandemly repeated. These were observed in four of six chromosomes, three autosomal ends, and one X-chromosomal end. LTU sequences represent about 0.2% of the T. taiwanemma genome. Each LTU contains a core (TTAGG)₈-like sequence (TRLS) and five types of conserved sequences—ST (short telomere associated), J (joint), X, SR (satellite sequence rich), and Y—which vary in length from about 150 bp to 2.7 kb. The LTU sequence is defined as ST–J–TRLS–SR–X–Y–X–Y–X. Most LTU regions may be derived from the ancestral common sequence, which is observed in ST regions six times and at many other LTU sites. We could not find the LTU-like sequence in three other crickets including the closest species, T. emma, suggesting that the LTU in T. taiwanemma has been rapidly amplified in subtelomeric regions through recent evolutional events. It is also suggested that the highly conserved structure of the LTU is maintained by recombination and may contribute to telomere elongation, as seen in dipteran insects. Received: 6 August 2001/Accepted: 10 October 2001     

Unbiased estimation of symmetrical directional mutation pressure from protein-coding DNA

The most generally applicable procedure for obtaining estimates of the symmetrical, or strand-nonspecific, directional mutation pressure (μ_D) on protein-coding DNA sequences is to determine the G+C content at synonymous codon sites (P _syn), and to divide P _syn by twice the arithmetic mean of the G+C content at synonymous codon sites of a large number of randomly generated, synonymously coding DNA sequences (P _syn). Unfortunately, the original procedure yields biased estimates of P _syn and μ_D and is computationally expensive. We here present a fast procedure for estimating unbiased μ_D values. The procedure employs direct calculation of P _syn (≈P _syn) and two normalization procedures, one for P _syn≤P _syn and another for P _syn≥P _syn. The normalization removes a bias sometimes caused by codons specifying arginine, asparagine, isoleucine, and leucine. Consequently, comparison of protein-coding genes that are translated using different genetic codes is facilitated. Received: 5 May 1995 / Accepted: 30 November 1995     

Biased Usages of Arginines and Lysines in Proteins Are Correlated with Local-Scale Fluctuations of the G + C Content of DNA Sequences

Amino acid residues arginine (R) and lysine (K) have similar physicochemical characteristics and are often mutually substituted during evolution without affecting protein function. Statistical examinations on human proteins show that more R than K residues are used in the proximity of R residues, whereas more K than R are used near K residues. This biased use occurs on both a global and a local scale (shorter than ∼100 residues). Even within a given exon, G + C-rich and A + T-rich short DNA segments preferentially encode R and K, respectively. The biased use of R and K on a local scale is also seen in Saccharomyces cerevisiae and Caenorhabdidtis elegans, which lack global-scale mosaic structures with varying GC%, or isochores. Besides R and K, several amino acids are also used with a positive or negative correlation with the local GC% of third codon bases. The local-, or ``within-gene'-, scale heterogeneity of the DNA sequence may influence the sequence of the encoded protein segment. Received: 2 March 1998 / Accepted: 23 April 1998     

Higher-Order Organization of Subrepeats and the Evolution of Cervid Satellite I DNA

Based on sequence analyses of 17 complete centromeric DNA monomers from ten different deer species, a model is proposed for the genesis, evolution, and genomic organization of cervid satellite I DNA. All cervid satellite I DNA arose from the initial amplification of a 31-bp DNA sequence. These 31-bp subrepeats were organized in a hierarchical fashion as 0.8-kb monomers in plesiometacarpalia deer and 1-kb monomers in telemetacarpalia deer. The higher-order repeat nature of cervid centromeric satellite DNA monomers accounts for their high intragenomic and intraspecific sequence conservation. Such high intraspecific sequence conservation validates the use of a single cervid satellite I DNA monomer from each deer species for interspecific sequence comparisons to elucidate phylogenetic relationships. Also, a specific 0.18-kb tandem duplication was observed in all 1-kb monomers, implying that 1-kb cervid satellite I DNA monomers arose from an unequal crossover event between two similar 0.8-kb ancestral DNA sequences. Received: 28 May 1996 / Accepted: 24 October 1996     

Relationships Between Genomic G+C Content,RNA Secondary Structures,and Optimal Growth Temperature in Prokaryotes

G:C pairs are more stable than A:T pairs because they have an additional hydrogen bond. This has led to many studies on the correlation between the guanine+cytosine (G+C) content of nucleic acids and temperature over the last 20 years. We collected the optimal growth temperatures (T_opt) and the G+C contents of genomic DNA; 23S, 16S, and 5S ribosomal RNAs; and transfer RNAs for 764 prokaryotic species. No correlation was found between genomic G+C content and T_opt, but there were striking correlations between the G+C content of ribosomal and transfer RNA stems and T_opt. Two explanations have been proposed—neutral evolution and selection pressure—for the approximate equalities of G and C (respectively, A and T) contents within each strand of DNA molecules. Our results do not support the notion that selection pressure induces complementary oligonucleotides in close proximity and therefore numerous secondary structures in prokaryotic DNA, as the genomic G+C content does not behave in the same way as that of folded RNA with respect to optimal growth temperature. Received: 25 September 1996 / Accepted: 21 January 1997