Functional idiosyncrasies of tRNA isoacceptors in cognate and noncognate aminoacylation systems

The specificity of transfer RNA aminoacylation by cognate aminoacyl-tRNA synthetase is a crucial step for synthesis of functional proteins. It is established that the aminoacylation identity of a single tRNA or of a family of tRNA isoacceptors is linked to the presence of positive signals (determinants) allowing recognition by cognate synthetases and negative signals (antideterminants) leading to rejection by the noncognate ones. The completion of identity sets was generally tested by transplantation of the corresponding nucleotides into one or several host tRNAs which acquire as a consequence the new aminoacylation specificities. Such transplantation experiments were also useful to detect peculiar structural refinements required for optimal expression of a given aminoacylation identity set within a host tRNA. This study explores expression of the defined yeast aspartate identity set into different tRNA scaffolds of a same specificity, namely the four yeast tRNA(Arg) isoacceptors. The goal was to investigate whether expression of the new identity is similar due to the unique specificity of the host tRNAs or whether it is differently expressed due to their peculiar sequences and structural features. In vitro transcribed native tRNA(Arg) isoacceptors and variants bearing the aspartate identity elements were prepared and their aminoacylation properties established. The four wild-type isoacceptors are active in arginylation with catalytic efficiencies in a 20-fold range and are inactive in aspartylation. While transplanted tRNA(1)(Arg) and tRNA(4)(Arg) are converted into highly efficient substrates for yeast aspartyl-tRNA synthetase, transplanted tRNA(2)(Arg) and tRNA(3)(Arg) remain poorly aspartylated. Search for antideterminants in these two tRNAs reveals idiosyncratic features. Conversion of the single base-pair C6-G67 into G6-C67, the pair present in tRNA(Asp), allows full expression of the aspartate identity in the transplanted tRNA(2)(Arg), but not in tRNA(3)(Arg). It is concluded that the different isoacceptor tRNAs protect themselves from misaminoacylation by idiosyncratic pathways of antidetermination.     

Shifted positioning of the anticodon nucleotide residues of amber suppressor tRNA species by Escherichia coli arginyl-tRNA synthetase.

Cytidine in the anticodon second position (position 35) and G or U in position 36 of tRNAArg are required for aminoacylation by arginyl-tRNA synthetase (ArgRS) from Escherichia coli. Nevertheless, an arginine-accepting amber suppressor tRNA with a CUA anticodon (FTOR1Delta26) exhibits suppression activity in vivo [McClain, W.H. & Foss, K. (1988) Science, 241, 1804-1807]. By an in vitro kinetic study with mutagenized tRNAs, we showed that the arginylation of FTOR1Delta26 involves C34 and U35, and that U35 can be replaced by G without affecting the activity. Thus, the positioning of the essential nucleotides for the arginylation is shifted to the 5' side, by one residue, in the suppressor tRNAArg. We found that the shifted positioning does not depend on the tRNA sequence outside the anticodon. Furthermore, by a genetic method, we isolated a mutant ArgRS that aminoacylates FTOR1Delta26 more efficiently than the wild-type ArgRS. The isolated mutant has mutations at two nonsurface amino-acid residues that interact with each other near the anticodon-binding site.     

The Enzymatic Paradox of Yeast Arginyl-tRNA Synthetase: Exclusive Arginine Transfer Controlled by a Flexible Mechanism of tRNA Recognition

Identity determinants are essential for the accurate recognition of transfer RNAs by aminoacyl-tRNA synthetases. To date, arginine determinants in the yeast Saccharomyces cerevisiae have been identified exclusively in vitro and only on a limited number of tRNA Arginine isoacceptors. In the current study, we favor a full cellular approach and expand the investigation of arginine determinants to all four tRNA Arg isoacceptors. More precisely, this work scrutinizes the relevance of the tRNA nucleotides at position 20, 35 and 36 in the yeast arginylation reaction. We built 21 mutants by site-directed mutagenesis and tested their functionality in YAL5, a previously engineered yeast knockout deficient for the expression of tRNA Arg CCG. Arginylation levels were also monitored using Northern blot. Our data collected in vivo correlate with previous observations. C35 is the prominent arginine determinant followed by G36 or U36 (G/U36). In addition, although there is no major arginine determinant in the D loop, the recognition of tRNA Arg ICG relies to some extent on the nucleotide at position 20. This work refines the existing model for tRNA Arg recognition. Our observations indicate that yeast Arginyl-tRNA synthetase (yArgRS) relies on distinct mechanisms to aminoacylate the four isoacceptors. Finally, according to our refined model, yArgRS is able to accommodate tRNA Arg scaffolds presenting N34, C/G35 and G/A/U36 anticodons while maintaining specificity. We discuss the mechanistic and potential physiological implications of these findings.     

Recognition of various arginine transfer ribonucleic acids with arginyl-tRNA synthetase purified from human placenta

Arginyl-tRNA synthetase has been purified approximately 550 fold from crude extract of human placenta by the following purification steps: Ammonium sulfate fractionation, chromatographies of DEAE-cellulose and CM-Sephadex and Sephadex G-100 gel filtration. Final preparation of this enzyme has specific activity of 123 nmole of arginyl-tRNA formed per mg of protein and was free from other aminoacyl-tRNA synthetase activities. Recognition of various arginine tRNAs with this enzyme was studied using kinetic analysis of arginylation of arginine tRNA and also arginine tRNA dependent ATP-PPi exchange reaction. Affinity of this enzyme with arginine tRNA was determine from Vmas/Km values and it was in the order of rabbit, Chum salmon, B. subtilis, E. coli and yeast in both systems.     

tRNA aminoacylation by arginyl-tRNA synthetase: induced conformations during substrates binding

The 2.2 A crystal structure of a ternary complex formed by yeast arginyl-tRNA synthetase and its cognate tRNA(Arg) in the presence of the L-arginine substrate highlights new atomic features used for specific substrate recognition. This first example of an active complex formed by a class Ia aminoacyl-tRNA synthetase and its natural cognate tRNA illustrates additional strategies used for specific tRNA selection. The enzyme specifically recognizes the D-loop and the anticodon of the tRNA, and the mutually induced fit produces a conformation of the anticodon loop never seen before. Moreover, the anticodon binding triggers conformational changes in the catalytic center of the protein. The comparison with the 2.9 A structure of a binary complex formed by yeast arginyl-tRNA synthetase and tRNA(Arg) reveals that L-arginine binding controls the correct positioning of the CCA end of the tRNA(Arg). Important structural changes induced by substrate binding are observed in the enzyme. Several key residues of the active site play multiple roles in the catalytic pathway and thus highlight the structural dynamics of the aminoacylation reaction.     

Limited set of amino acid residues in a class Ia aminoacyl-tRNA synthetase is crucial for tRNA binding

The aim of this work was to characterize crucial amino acids for the aminoacylation of tRNA(Arg) by yeast arginyl-tRNA synthetase. Alanine mutagenesis was used to probe all the side chain mediated interactions that occur between tRNA(Arg2)(ICG) and ArgRS. The effects of the substitutions were analyzed in vivo in an ArgRS-knockout strain and in vitro by measuring the aminoacylation efficiencies for two distinct tRNA(Arg) isoacceptors. Nine mutants that generate lethal phenotypes were identified, suggesting that only a limited set of side chain mediated interactions is essential for tRNA recognition. The majority of the lethal mutants was mapped to the anticodon binding domain of ArgRS, a helix bundle that is characteristic for class Ia synthetases. The alanine mutations induce drastic decreases in the tRNA charging rates, which is correlated with a loss in affinity in the catalytic site for ATP. One of those lethal mutations corresponds to an Arg residue that is strictly conserved in all class Ia synthetases. In the known crystallographic structures of complexes of tRNAs and class Ia synthetases, this invariant Arg residue stabilizes the idiosyncratic conformation of the anticodon loop. This paper also highlights the crucial role of the tRNA and enzyme plasticity upon binding. Divalent ions are also shown to contribute to the induced fit process as they may stabilize the local tRNA-enzyme interface. Furthermore, one lethal phenotype can be reverted in the presence of high Mg(2+) concentrations. In contrast with the bacterial system, in yeast arginyl-tRNA synthetase, no lethal mutation has been found in the ArgRS specific domain recognizing the Dhu-loop of the tRNA(Arg). Mutations in this domain have no effects on tRNA(Arg) aminoacylation, thus confirming that Saccharomyces cerevisiae and other fungi belong to a distinct class of ArgRS.     

Mitochondrial tRNAs as light strand replication origins: Similarity between anticodon loops and the loop of the light strand replication origin predicts initiation of DNA replication

Stem-loop hairpins formed by mitochondrial light strand replication origins (OL) and by heavy strand DNA coding for tRNAs that form OL-like structures initiate mitochondrial replication. The loops are recognized by one of the two active sites of the vertebrate mitochondrial gamma polymerase, which are homologuous to the active sites of class II amino-acyl tRNA synthetases. Therefore, the polymerase site recognizing the OL loop could recognize tRNA anticodon loops and sequence similarity between anticodon and OL loops should predict initiation of DNA replication at tRNAs. Strengths of genome-wide deamination gradients starting at tRNA genes estimate extents by which replication starts at that tRNA. Deaminations (A→G and C→T) occur proportionally to time spent single stranded by heavy strand DNA during mitochondrial light strand replication. Results show that deamination gradients starting at tRNAs are proportional to sequence similarity between OL and tRNA loops: most for anticodon-, least D-, intermediate for TψC-loops, paralleling tRNA synthetase recognition interactions with these tRNA loops. Structural and sequence similarities with regular OLs predict OL function, loop similarity is dominant in most tRNAs. Analyses of sequence similarity and structure independently substantiate that DNA sequences coding for mitochondrial tRNAs sometimes function as alternative OLs. Pathogenic mutations in anticodon loops increase similarity with the human OL loop, non-pathogenic polymorphisms do not. Similarity/homology alignment hypotheses are experimentally testable in this system.     

The free yeast aspartyl-tRNA synthetase differs from the tRNA(Asp)-complexed enzyme by structural changes in the catalytic site, hinge region, and anticodon-binding domain

Aminoacyl-tRNA synthetases catalyze the specific charging of amino acid residues on tRNAs. Accurate recognition of a tRNA by its synthetase is achieved through sequence and structural signalling. It has been shown that tRNAs undergo large conformational changes upon binding to enzymes, but little is known about the conformational rearrangements in tRNA-bound synthetases. To address this issue the crystal structure of the dimeric class II aspartyl-tRNA synthetase (AspRS) from yeast was solved in its free form and compared to that of the protein associated to the cognate tRNA(Asp). The use of an enzyme truncated in N terminus improved the crystal quality and allowed us to solve and refine the structure of free AspRS at 2.3 A resolution. For the first time, snapshots are available for the different macromolecular states belonging to the same tRNA aminoacylation system, comprising the free forms for tRNA and enzyme, and their complex. Overall, the synthetase is less affected by the association than the tRNA, although significant local changes occur. They concern a rotation of the anticodon binding domain and a movement in the hinge region which connects the anticodon binding and active-site domains in the AspRS subunit. The most dramatic differences are observed in two evolutionary conserved loops. Both are in the neighborhood of the catalytic site and are of importance for ligand binding. The combination of this structural analysis with mutagenesis and enzymology data points to a tRNA binding process that starts by a recognition event between the tRNA anticodon loop and the synthetase anticodon binding module.     

Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp

A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70% homology with the DNA-derived putative sequences of human placenta and beef heart mitochondrial tRNA Asp, respectively, and bears little resemblance to other sequenced aspartate tRNAs of non-mitochondrial origin.     

Tertiary structure of Escherichia coli tRNA(3Thr) in solution and interaction of this tRNA with the cognate threonyl-tRNA synthetase

The solution structure of Escherichia coli tRNA(3Thr) (anticodon GGU) and the residues of this tRNA in contact with the alpha 2 dimeric threonyl-tRNA synthetase were studied by chemical and enzymatic footprinting experiments. Alkylation of phosphodiester bonds by ethylnitrosourea and of N-7 positions in guanosines and N-3 positions in cytidines by dimethyl sulphate as well as carbethoxylation of N-7 positions in adenosines by diethyl pyrocarbonate were conducted on different conformers of tRNA(3Thr). The enzymatic structural probes were nuclease S1 and the cobra venom ribonuclease. Results will be compared to those of three other tRNAs, tRNA(Asp), tRNA(Phe) and tRNA(Trp), already mapped with these probes. The reactivity of phosphates towards ethylnitrosourea of the unfolded tRNA was compared to that of the native molecule. The alkylation pattern of tRNA(3Thr) shows some similarities to that of yeast tRNA(Phe) and mammalian tRNA(Trp), especially in the D-arm (positions 19 and 24) and with tRNA(Trp), at position 50, the junction between the variable region and the T-stem. In the T-loop, tRNA(3Thr), similarly to the three other tRNAs, shows protections against alkylation at phosphates 59 and 60. However, tRNA(3Thr) is unique as far as very strong protections are also found for phosphates 55 to 58 in the T-loop. Compared with yeast tRNA(Asp), the main differences in reactivity concern phosphates 19, 24 and 50. Mapping of bases with dimethyl sulphate and diethyl pyrocarbonate reveal conformational similarities with yeast tRNA(Phe). A striking conformational feature of tRNA(3Thr) is found in the 3'-side of its anticodon stem, where G40, surrounded by two G residues, is alkylated under native conditions, in contrast to other G residues in stem regions of tRNAs which are unreactive when sandwiched between two purines. This data is indicative of a perturbed helical conformation in the anticodon stem at the level of the 30-40 base pairs. Footprinting experiments, with chemical and enzymatic probes, on the tRNA complexed with its cognate threonyl-tRNA synthetase indicate significant protections in the anticodon stem and loop region, in the extra-loop, and in the amino acid accepting region. The involvement of the anticodon of tRNA(3Thr) in the recognition process with threonyl-tRNA synthetase was demonstrated by nuclease S1 mapping and by the protection of G34 and G35 against alkylation by dimethyl sulphate. These data are discussed in the light of the tRNA/synthetase recognition problem and of the structural and functional properties of the tRNA-like structure present in the operator region of the thrS mRNA.     

Suppression of amber codons in vivo as evidence that mutants derived from Escherichia coli initiator tRNA can act at the step of elongation in protein synthesis

The absence of a Watson-Crick base pair at the end of the amino acid acceptor stem is one of the features which distinguishes prokaryotic initiator tRNAs as a class from all other tRNAs. We show that this structural feature prevents Escherichia coli initiator tRNA from acting as an elongator in protein synthesis in vivo. We generated a mutant of E. coli initiator tRNA in which the anticodon sequence is changed from CAU to CUA (the T35A36 mutant). This mutant tRNA has the potential to read the amber termination codon UAG. We then coupled this mutation to others which change the C1.A72 mismatch at the end of the acceptor stem to either a U1:A72 base pair (T1 mutant) or a C1:G72 base pair (G72 mutant). Transformation of E. coli CA274 (HfrC Su- lacZ125am trpEam) with multicopy plasmids carrying the mutant initiator tRNA genes show that mutant tRNAs carrying changes in both the anticodon sequence and the acceptor stem suppress amber codons in vivo, whereas mutant tRNA with changes in the anticodon sequence alone does not. Mutant tRNAs with the above anticodon sequence change are aminoacylated with glutamine in vitro. Measurement of kinetic parameters for aminoacylation by E. coli glutaminyl-tRNA synthetase show that both the nature of the base pair at the end of the acceptor stem and the presence or absence of a base pair at this position can affect aminoacylation kinetics. We discuss the implications of this result on recognition of tRNAs by E. coli glutaminyl-tRNA synthetase.     

Nucleotide sequence studies of normal and genetically altered glycine transfer ribonucleic acids from Escherichia coli.

The total nucleotide sequence of tRNAGGA/G -Gly2 from Escherichia coli is pG-C-G-G-G-C-A-U-C-G-U-A-U-A-A-U-G-G-C-U-A-U-U-A-C-C-U-C-A-G-C-C-U-N-C-C-A-A-G-C-U-G-A-U-G-A-U-G-C-G-G-G-T-psi-C-G-A-U-U-C-C-C-G-C-U-G-C-C-C-G-C-U-C-C-AOH, where T- at position 53 is ribothymidylic acid, and psi- at position 54 is pseudouridylic acid; N- at position 36 is an unidentified derivative of uridylic acid, and is present in modified form in a portion of tRNAGGA/G -Gly 2 molecules isolated from E. coli cells. The missense suppressor mutation, glyTsuA36(HA), results in a C yields U base substitution at the 3' end of the anticodon of tRNAGGA/G -Gly 2 (nucleotide position 38). A secondary effect of this base substitution is the modification of the A residue directly adjacent to the 3' end of the anticodon of tRNAsuA36(HA), -Gly 2 suggesting that the enzymes responsible for this modification recognize the anticodon sequences of prospective tRNA substrates. The creation of a missense-suppressing tRNA, tRNAsuA36(HA), -Gly 2 by an alteration of the anticodon sequence of tRNAGGA/G -Gly 2 is analogous to mechanisms whereby other suppressor tRNAs have arisen. The high degree of nucleotide sequence homology between the amino acid acceptor stems and anticodon regions of four glycine isoaccepting tRNAs specified by E. coli and bacteriophage T4 suggests that these regions may be recognized by the glycyl-tRNA synthetase; the involvement of the anticodon region in the synthetase recognition process is supported by the greatly decreased rate of aminoacylation of tRNAsuA36(HA) -Gly 2.     

In vivo selection of lethal mutations reveals two functional domains in arginyl-tRNA synthetase

Using random mutagenesis and a genetic screening in yeast, we isolated 26 mutations that inactivate Saccharomyces cerevisiae arginyl-tRNA synthetase (ArgRS). The mutations were identified and the kinetic parameters of the corresponding proteins were tested after purification of the expression products in Escherichia coli. The effects were interpreted in the light of the crystal structure of ArgRS. Eighteen functional residues were found around the arginine-binding pocket and eight others in the carboxy-terminal domain of the enzyme. Mutations of these residues all act by strongly impairing the rates of tRNA charging and arginine activation. Thus, ArgRS and tRNA(Arg) can be considered as a kind of ribonucleoprotein, where the tRNA, before being charged, is acting as a cofactor that activates the enzyme. Furthermore, by using different tRNA(Arg) isoacceptors and heterologous tRNA(Asp), we highlighted the crucial role of several residues of the carboxy-terminal domain in tRNA recognition and discrimination.     

Functional guanine-arginine interaction between tRNAPro and prolyl-tRNA synthetase that couples binding and catalysis

Aminoacyl-tRNA synthetases catalyze the attachment of specific amino acids to their cognate tRNAs. Specific aminoacylation is dictated by a set of recognition elements that mark tRNA molecules as substrates for particular synthetases. Escherichia coli prolyl-tRNA synthetase (ProRS) has previously been shown to recognize specific bases of tRNA(Pro) in both the anticodon domain, which mediate initial complex formation, and in the acceptor stem, which is proximal to the site of catalysis. In this work, we unambiguously define the molecular interaction between E. coli ProRS and the acceptor stem of cognate tRNA(Pro). Oxidative cross-linking studies using 2'-deoxy-8-oxo-7,8-dihydroguanosine-containing proline tRNAs identify a direct interaction between a critical arginine residue (R144) in the active site of E. coli ProRS and the G72 residue in the acceptor stem of tRNA(Pro). Assays conducted with motif 2 loop variants and tRNA mutants wherein specific atomic groups of G72 were deleted, are consistent with a functionally important hydrogen-bonding network between R144 and the major groove of G72. These results taken together with previous studies suggest that breaking this key contact uncouples the allosteric interaction between the anticodon domain and the aminoacylation active site, providing new insights into the communication network that governs the synthetase-tRNA interaction.     

Functional compensation by particular nucleotide substitutions of a critical G*U wobble base-pair during aminoacylation of transfer RNA

Expression of the genetic code depends on precise tRNA aminoacylation by cognate aminoacyl-tRNA synthetase enzymes. The G.U wobble base-pair in the acceptor helix of Escherichia coli alanine tRNA is the primary aminoacylation determinant of this molecule. Previous work on the process of synthetase recognition of the G.U pair showed that replacing G.U by a G.C Watson-Crick base-pair inactivates alanine acceptance by the tRNA, but that C.A and G.A wobble pair replacements preserve acceptance. Work by another group reported that the effects of a G.C replacement were reversed by a distal wobble base-pair in the anticodon helix. This result is potentially interesting because it suggests that distant regions in alanine tRNA are functionally coupled during synthetase recognition and more generally because recognition determinants of many other tRNAs lie in both the acceptor helix and anticodon helix region. Here, we have conducted an extensive in vivo analysis of the distal wobble pair in alanine tRNA and report that it does not behave like a compensating mutation. Restoration of alanine acceptance was not detected even when the synthetase enzyme was overproduced. We discuss the previous experimental evidence and suggest how the distal wobble pair was incorrectly analyzed. The available data indicate that all principal recognition determinants of alanine tRNA lie in the molecule's acceptor helix.     

Yeast aspartyl-tRNA synthetase residues interacting with tRNA(Asp) identity bases connectively contribute to tRNA(Asp) binding in the ground and transition-state complex and discriminate against non-cognate tRNAs.

Crystallographic studies of the aspartyl-tRNA synthetase-tRNA(Asp)complex from yeast identified on the enzyme a number of residues potentially able to interact with tRNA(Asp). Alanine replacement of these residues (thought to disrupt the interactions) was used in the present study to evaluate their importance in tRNA(Asp)recognition and acylation. The results showed that contacts with the acceptor A of tRNA(Asp)by amino acid residues interacting through their side-chain occur only in the acylation transition state, whereas those located near the G73 discriminator base occur also during initial binding of tRNA(Asp). Interactions with the anticodon bases provide the largest free energy contribution to stability of the enzyme-tRNA complex in its ground state. These contacts also favour catalysis, by acting connectively with each other and with those of G73, as shown by multiple mutant analysis. This implies structural communication transmitting the anticodon recognition signal to the distally located acylation site. This signal might be conveyed via tRNA(Asp)as suggested by the observed conformational change of this molecule upon interaction with AspRS. From binding free energy values corresponding to the different AspRS-tRNA(Asp)interaction domains, it might be concluded that upon complex formation, the anticodon interacts first. Finally, acylation efficiencies of AspRS mutants in the presence of pure tRNA(Asp)and non-fractionated tRNAs indicate that residues involved in the binding of identity bases also discriminate against non-cognate tRNAs.