Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').     

Differences in susceptibility to restriction by E. coli B between various heteroduplex molecules of bacteriophage FD DNA

Fragments of B-modified bacteriophage fd sB1^o sB2 RF DNA were prepared with the help of purified endonuclease R from Haemophilus parainfluenzae (Hpa II). These were hybridized with unmodified circular single stranded fd DNA. The resulting partial heteroduplex molecules were assayed for infectivity on competent cells of B-restricting and non restricting strains of E. coli. There of such heteroduplexes originating from neighbouring fragments on the physical map of fd RF DNA were shown to be more resistant to Eco B restriction than six others and the unmodified control. It is suggested that the three corresponding vicinal fragments contain essential parts of the Eco B recognition site on this phage DNA.     

Some restriction endonucleases tolerate single mismatches of the pyrimidine.purine type.

DNAs from phage mutants M13mp18 and M13mp18/MP-1 were used to construct two closed circular heteroduplexes. One of them carried the sequence 5'-CCTGGG-3' 3'-GGGCCC-5' with a T.G mismatch at the position 6248. The other carried the sequence 5'-CCCGGG-3' 3'-GGACCC-5' with a C.A mismatch at the same position. Heteroduplexes were exposed to 7 restriction endonucleases having recognition sites within the sequence 5'-CCCGGG-3' 3'-GGGCCC-5' and to 1 restriction endonuclease having a recognition site within the sequence 5'-CCTGGG-3' 3'-GGACCC-5'. All tested enzymes cleaved at least one mismatch-containing sequence although with reduced efficiency. Smal and Xmal tolerated both mismatch-containing sequences. Aval, Hpall, Mspl, Ncil and Nsplll were able to tolerate only the T.G containing sequence, while BstNl was able to tolerate only the C.A containing sequence. It is inferred that the tolerance displayed by Smal and Xmal depends on the presence of either the original purines or the original pyrimidines in mismatches of both the T.G and C.A type and that all other tested enzymes require the presence of the original purines in mismaches of both types.     

Nucleotide sequence of bacteriophage f1 DNA.

The nucleotide sequence of the DNA of the filamentous coliphage f1 has been determined. In agreement with earlier conclusions, the genome was found to comprise 6,407 nucleotides, 1 less than that of the related phage fd. Phage f1 DNA differs from that of phage M13 by 52 nucleotide changes, which lead to 5 amino acid substitutions in the corresponding proteins of the two phages, and from phage fd DNA by 186 nucleotide changes (including the single-nucleotide deletion), which lead to 12 amino acid differences between the proteins of phages f1 and fd. More than one-half of the nucleotide changes in each case are found in the sequence of 1,786 nucleotides comprising gene IV and the major intergenic region between gene IV and gene II. The sequence of this intergenic region (nucleotides 5501 to 6005) of phage f1 differs from the sequence reported by others through the inclusion of additional single nucleotides in eight positions and of a run of 13 nucleotides between positions 5885 and 5897, a point of uncertainty in the earlier published sequence. The differences between the sequence of bacteriophage f1 DNA now presented and a complete sequence for the DNA previously published by others are discussed, and the f1 DNA sequence is compared with those of bacteriophages M13 and fd.     

The nucleotide sequence recognized by the Escherichia coli K12 restriction and modification enzymes.

The sites recognized by the Escherichia coli K12 restriction endonuclease were localized to defined regions on the genomes of phage φXsK1, φXsK2, and G4 by the marker rescue technique. Methyl groups placed on the genome of plasmid pBR322 by the E. coli K12 modification methylase were mapped in HinfI fragments 1 and 3, and HaeIII fragments 1 and 3. A homology of seven nucleotides in the configuration: 5′-A-A-C .. 6N .. G-T-G-C-3′, where 6N represents six unspecified nucleotides, was found among the DNA sequences containing the five EcoK sites of φXsK1, φXsK2, G4, and pBR322. Three lines of evidence indicate that this sequence constitutes the recognition site of the E. coli K12 restriction enzyme. The C in 5′-A-A-C and the T in 5′-G-T-G-C are locations of mutations leading to loss or gain of the site and thus are positions recognized by the enzyme. This sequence does not occur on φXam3cs70, simian virus 40 (SV40), and fd DNAs which do not possess EcoK sites, and occurs only once on φXsK1, φXsK2, and G4 DNAs, and twice on pBR322 DNA. In order to prove that all seven conserved nucleotides are essential for the recognition by the E. coli K12 restriction enzyme, the nucleotide sequences of φX174, G4, SV40, fd, and pBR322 were searched for sequences differing from the sequence 5′-A-A-C .. 6N .. G-TG-C-3′ at only one of the specified positions. It was found that sequences differing at each of the specified positions occur on DNA sequences that do not contain the EcoK sites. Thus, the recognition site of the E. coli K12 restriction enzyme has the same basic structure as that of the EcoB site (Lautenberger et al., 1978). In each case there are two domains, one containing three and the other four specific nucleotides, separated by a sequence of unspecified bases. However, the unspecified sequence in the EcoK site must be precisely six bases instead of the eight found in the EcoB site. Alignment of the EcoK and EcoB sites suggests that four of the seven specified nucleotides are conserved between the sequences recognized by these two allelic restriction and modification systems.     

Recognition sequence of restriction endonuclease KpnI from Klebsiella pneumoniae.

We have determined the recognition sequence of the restriction endonuclease KpnI, previously isolated from Klebsiella pneumoniae. The enzyme cleaves the twofold rotationally symmetric sequence (see book for formula) at the positions indicated by the arrows, producing 3' protruding cohesive ends, four nucleotides in length. The specific cleavage site was unambiguously deduced using both 3' and 5' end analyses of KpnI generated restriction fragments of simian-virus 40 (SV40) DNA (1 site), adenovirus-2 (Ad-2) DNA (8 sites), and a plasmid (pCRI) DNA (2 sites).     

The Bos taurus casein genes. Isolation and characterization of the kappa-casein gene

A region spanning 25 kb of genomic DNA containing the kappa-casein gene, has been isolated from two genomic libraries in EMBL3 and EMBL4 phage vectors. Five phage clones containing kappa-casein gene have been found. Gene organisation has been determined using restriction mapping and a partial sequencing the 5' and 3' flanking regions. The kappa-casein gene includes 5 exons, the first of them coding for 64 nucleotides from the 5' untranslated mRNA zone. The gene is 12.5 kb long, which is almost 16 times longer than the corresponding mRNA. The first intron spans 2.5 kb, the second is the largest one and spans 5.5 kb. The 5' flanking region sequence has been analysed; it contains a TATA box from -30 to -25 bp, somewhat different from the canonic sequence, and a CAAT box at -80 bp.     

Specificity of cleavage by restriction nuclease from Bacillus subtilis.

The restriction nuclease from B. subtilis (Bsu) which cleaves in the middle of the tetra-nucleotide sequence 5'-GGCC-3' 3'-CCGG-5' has been found to decrease its substrate specificity at high nuclease concentrations. There are special conditions, high pH, low ionic strength, and high glycerol content, which strongly enhance splitting with decreased specificity and also lead to splitting of single-stranded DNA. By sequence analyses it is shown that the reduction in specificity of Bsu corresponds to cleavage predominantly at 5'-GC-3' 3'-CG-5' sequences. No comparable change in specificity has been observed in a restriction nuclease from Haemophilus aegyptius (HaeIII), and isoschizomer of Bsu.     

Determination of DNA sequences containing methylcytosine in Bacillus subtilis Marburg.

The methylcytosine-containing sequences in the DNA of Bacillus subtilis 168 Marburg (restriction-modification type BsuM) were determined by three different methods: (i) examination of in vivo-methylated DNA by restriction enzyme digestion and, whenever possible, analysis for methylcytosine at the 5' end; (ii) methylation in vitro of unmethylated DNA with B. subtilis DNA methyltransferase and determination of the methylated sites; and (iii) the methylatability of unmethylated DNA by B. subtilis methyltransferase after potential sites have been destroyed by digestion with restriction endonucleases. The results obtained by these methods, taken together, show that methylcytosine was present only within the sequence 5'-TCGA-3'. The presence of methylcytosine at the 5' end of the DNA fragments generated by restriction endonuclease AsuII digestion and the fact that in vivo-methylated DNA could not be digested by the enzyme XhoI showed that the recognition sequences of these two enzymes contained methylcytosine. As these two enzymes recognized a similar sequence containing a 5' pyrimidine (Py) and a 3' purine (Pu), 5'-PyTCGAPu-3', the possibility that methylcytosine is present in the complementary sequences 5'-TTCGAG-3' and 5'-CTCGAA-3' was postulated. This was verified by the methylation in vitro, with B. subtilis enzyme, of a 2.6-kilobase fragment of lambda DNA containing two such sites and devoid of AsuII or XhoI recognition sequences. By analyzing the methylatable sites, it was found that in one of the two PyTCGAPu sequences, cytosine was methylated in vitro in both DNA strands. It is concluded that the sequence 5'-PyTCGAPu-3' is methylated by the DNA methyltransferase (of cytosine) of B. subtilis Marburg.     

The gene encoding the cytosolic form of phosphoenolpyruvate carboxykinase (GTP) from the chicken

The gene for cytosolic phosphoenolpyruvate carboxykinase (GTP) (EC 4.1.1.32) from the chicken was isolated from a recombinant library containing the chicken genome in phage lambda Charon 4A. The isolated clone, lambda PCK1cc, contains the complete gene for the enzyme as well as both 5' and 3' flanking sequences. The gene is approximately 8 kilobases in length divided into 8 exons, as demonstrated by restriction endonuclease mapping and DNA-RNA heteroduplex analysis. Southern blotting of chicken chromosomal DNA digested with various restriction enzymes shows a pattern predicted from the restriction map of lambda PCK1cc. The phosphoenolpyruvate carboxykinase gene is present as a single copy in the haploid chicken genome. The 5' region of the gene was defined by S1 nuclease mapping and by sequencing. Two mRNA species with discrete 5' ends were observed using S1 nuclease mapping. The ratio between the amounts of these multiple forms of mRNA is the same in chicken kidney and liver and is not affected by induction of the enzyme mRNA by cAMP. Examination of sequence homologies with the gene for rat cytosolic phosphoenolpyruvate carboxykinase indicates a putative control region contained in flanking sequences at the 5' end of the gene.     

In vivo restriction. Sequence and structure of endonuclease II-dependent cleavage sites in bacteriophage T4 DNA.

Endonuclease II of bacteriophage T4 is required for in vivo restriction of cytosine-containing DNA from its host, Escherichia coli, (as well as from phage mutants lacking cytosine modification), normally the first step in the reutilization of host DNA nucleotides for synthesis of phage DNA in infected cells. The phage cytosine-DNA is fragmented incompletely to yield genetically defined fragments. This restriction is different from that of type I, II, or III restriction enzymes. We have located seven major endonuclease II-dependent restriction sites in the T4 genome, of which three were analyzed in detail; in addition, abundant sites were cleaved in less than or equal to 5% of all molecules. Sites I, II, and III shared the sequence 5'-CCGNNTTGGC-3' and were cleaved in about 25% (I and III) and 65% (II) of all molecules, predominantly staggered around the first or second of the central unspecified base pairs to yield fragments with one 5' base. The less frequently cleaved sites I and III deviated from site II in predicted helical structure when viewed from the consensus strand, and in sequence when viewed from the opposite strand. Thus, interaction with a particular helical structure as well as recognition of the bases in DNA appears important for efficient cleavage.     

Selective protection of 5' ... GGCC ... 3' and 5' ... GCNGC ... 3' sequences by the hypermodified oxopyrimidine in Bacillus subtilis bacteriophage SP10 DNA.

The DNA of Bacillus subtilis bacteriophage SP10 is partially resistant to cleavage and methylation in vitro by restriction enzyme R . BsuRI and its cognate methylase even though greater than 20 copies of the target sequence, 5' ... GGCC ... 3', are present on the phage genome. YThy, a hypermodified oxopyrimidine that replaces a fraction of the thymine residues in SP10 DNA, was responsible for this protection, since YThy-free DNA was no longer resistant. Sites that were normally resistant could nevertheless be cleaved or methylated in vitro if the salt concentration was reduced or dimethyl sulfoxide was added to the reaction buffer. Analysis of the termini produced by cleavage suggested that resistant sites occurred in the sequence 5' ... GGCC-YThy ... 3', whereas sensitive sites, of which there were only two per genome, occurred in the sequence 5' ... GGCCG ... 3'. These in vitro results provide an explanation for the in vivo resistance of SP10 to restriction-modification by B. subtilis R. They also suggest ways in which the presence of the atypical base YThy in regions that flank the target might upset critical DNA-enzyme interactions necessary to locate and recognize the specific site of cleavage or methylation. YThy also strongly protected 5' ... GCNGC ... 3' (R . Fnu4HI) sequences on SP10 DNA, but the biological relevance of this protection is unclear.     

Epitope structures recognised by antibodies against the major coat protein (g8p) of filamentous bacteriophage fd (Inoviridae).

To map the accessible surface of filamentous bacteriophage fd particles, the epitope structures of polyclonal rabbit serum and three mouse monoclonal antibodies raised against complete phage were analysed. Western blot analysis confirmed the major coat protein, gene VIII product (g8p or pVIII), to be the antigen. Overlapping peptides were synthesised by spot synthesis on cellulose membranes, covering the whole sequence of g8p. Each of the three tested monoclonal antibodies, B62-FE2, B62-GF3/G12 and B62-EA11, reacted with a core epitope covering ten amino acid residues at or near the amino terminus of g8p. The epitope recognised by B62-FE2 consists of the ten N-terminal amino acid residues of g8p. Extension of the amino terminus by various sequences did not inhibit binding, indicating that a terminal amino group is not essential for the interaction. Both B62-GF3/G12 and B62-EA11 recognise internal epitopes covering amino acid residues 3 to 12 of g8p. The epitopes of the polyclonal rabbit serum were also confined to the 12 N-terminal amino acid residues. The contribution of individual amino acid residues to the binding was analysed by a set of peptides containing individual amino acids exchanged by glycine. Accessible residues were Glu2, Asp4, Asp5, Pro6, Lys8, Phe11 and Asp12. The positions of the essential amino acid residues within the epitope are in accordance with a helical conformation of the amino-terminal region of g8p. Further, the results suggest new designs of phage display screening vectors to improve their performance in analysing non-linear epitopes.     

Characterization of a Soluble B7-H3 (sB7-H3) Spliced from the Intron and Analysis of sB7-H3 in the Sera of Patients with Hepatocellular Carcinoma

B7-H3 is a recently discovered member of the B7 superfamily molecules and has been found to play a negative role in T cell responses. In this study, we identified a new B7-H3 isoform that is produced by alternative splicing from the forth intron of B7-H3 and encodes the sB7-H3 protein. Protein sequence analysis showed that sB7-H3 contains an additional four amino acids, encoded by the intron sequence, at the C-terminus compared to the ectodomain of 2Ig-B7-H3. We further found that this spliced sB7-H3 plays a negative regulatory role in T cell responses and serum sB7-H3 is higher in patients with hepatocellular carcinoma (HCC) than in healthy donors. Furthermore, we found that the expression of the spliced sb7-h3 gene is higher in carcinoma and peritumor tissues than in PBMCs of both healthy controls and patients, indicating that the high level of serum sB7-H3 in patients with HCC is caused by the increased expression of this newly discovered spliced sB7-H3 isoform in carcinoma and peritumor tissues.     

Tsp49I (ACGT/), a thermostable neoschizomer of the Type II restriction endonuclease MaeII (A/CGT), discovered in isolates of the genus Thermus from the Azores, Iceland and New Zealand.

One hundred and forty eight isolates of the genus Thermus, from neutral and alkaline hot water springs on four continents, have been screened for the presence of restriction endonuclease activity. An isolate (SM49) from the island of Sao Miguel, in the Azores, showed a high level of restriction endonuclease activity when a cell-free extract was incubated with lambda phage DNA at 65 degrees C. A Type II restriction endonuclease (Tsp49I) has been partially purified from this isolate and the recognition and cleavage site determined. Tsp49I recognizes the four base sequence ACGT, which is the same as the recognition sequence of the mesophilic Type II restriction endonuclease MaeII. However, unlike MaeII, which cleaves DNA between the first and second bass of the recognition sequence (A/CGT), Tsp49I hydrolyses the phosphodiester bond in both strands of the substrate after the last base of the recognition sequence 5'-ACGT/-3', producing four base 3'-OH overhangs (sticky ends). The enzyme has a pH optimum of 9.0, requires 2 mM MgCl2 for maximum activity and retains full enzyme activity following incubation for 10 min at temperatures up to 8O degrees C. Two further examples of the same restriction endonuclease specificity as Tsp491 were detected in Thermus isolates from Iceland (TspIDSI) and New Zealand (TspWAM8AI). The three MaeII neoschizomers, Tsp49I, TspIDSI and TspWAM8AI, exhibit similar pH optima, heat stabilities and MgCl2 requirements, but differ in their requirements for NaCl and KCl.     

Molecular recognition between oligopeptides and nucleic acids. Specificity of binding of a monocationic bis-furan lexitropsin to DNA deduced from footprinting and 1H NMR studies

MPE-Fe(EDTA) footprinting of a novel monocationic bis-furan lexitropsin 6 on a HindIII/EcoRI restriction fragment of pBR322 DNA revealed a series of four-base binding sites (all 5'----3') of (primary) TGTA, TGAA, AAAT, ACAA, TTAT, and (secondary) CTAA, TCGT, TGTA, GTCA, and GGTT. Thus 6 can accept a GC pair at positions 1, 2 or 3 of the binding site with a strict 3' (4 position) AT requirement. Marked enhancement of cleavage, particularly at GC rich sequences, is observed at regions flanking or even up to 18 base pairs remote from a given binding site. The non-exchangeable and imino 1H NMR resonances of the 1:1 complex and d-[CATGGCCATG]2 were assigned using a combination of NOE differences, NOESY and COSY techniques. 1H NMR studies (ligand induced chemical shifts and NOE differences) of Lexitropsin 6 with d-[CATGGCCATG]2 show unambiguously the location and orientation of the N to C termini of 6 on the sequence 5'-G5C6C7A8-3', with the C terminus oriented to A8. This orientation of 6 in the minor groove of 5'-GCCA is confirmed by an NOE observed between H1 2a of 6 and AH8(8). This preference for binding of 6 to the sequence 5'-GCCA when challenged with d-[CATGGCCATG]2 is in accord with the conclusions of the footprinting experiments wherein GC base pairs can be accepted in the first three positions and with a strict 3' terminus AT reading requirement. Collectively the data support the inference of a GC recognizing capacity for a 2,5-substituted furan moiety within a lexitropsin. The 1H NMR data indicate that the decadeoxyribonucleotide duplex exists in the B conformation in both the 1:1 complex and the free form. The apparent binding constant of 6 to calf thymus DNA is 1.68 X 10(5) M-1 whereas netropsin under similar conditions gives a value of 1.85 X 10(7) M-1. This suggests that if advantage is to be taken of the GC recognizing property of a 2,5-substituted furan in longer lexitropsins it should be flanked by more strongly bound moieties.     

Characterization of a novel type II restriction-modification system, Sth368I, encoded by the integrative element ICESt1 of Streptococcus thermophilus CNRZ368

A novel type II restriction and modification (R-M) system, Sth368I, which confers resistance to phiST84, was found in Streptococcus thermophilus CNRZ368 but not in the very closely related strain A054. Partial sequencing of the integrative conjugative element ICESt1, carried by S. thermophilus CNRZ368 but not by A054, revealed a divergent cluster of two genes, sth368IR and sth368IM. The protein sequence encoded by sth368IR is related to the type II endonucleases R.LlaKR2I and R.Sau3AI, which recognize and cleave the sequence 5'-GATC-3'. The protein sequence encoded by sth368IM is very similar to numerous type II 5-methylcytosine methyltransferases, including M.LlaKR2I and M.Sau3AI. Cell extracts of CNRZ368 but not A054 were found to cleave at the GATC site. Furthermore, the C residue of the sequence 5'-GATC-3' was found to be methylated in CNRZ368 but not in A054. Cloning and integration of a copy of sth368IR and sth368IM in the A054 chromosome confers on this strain phenotypes similar to those of CNRZ368, i.e., phage resistance, endonuclease activity of cell extracts, and methylation of the sequence 5'-GATC-3'. Disruption of sth368IR removes resistance and restriction activity. We conclude that ICESt1 encodes an R-M system, Sth368I, which recognizes the sequence 5'-GATC-3' and is related to the Sau3AI and LlaKR2I restriction systems.     

DNA packaging initiation of Salmonella bacteriophage P22: determination of cut sites within the DNA sequence coding for gene 3.

DNA packaging of Salmonella phage P22 starts at a defined site on a concatemer of P22 genomes. The molecular ends formed at the packaging initiation site (pac) map within a region of ca. 120 base pairs and may contain any of the four nucleotides at their 5' end. The determination of the positions of the cuts within the sequence demonstrates a characteristic distribution of cut sites which apparently cannot be attributed to the sequence organization of the involved regions. Symmetric elements of the sequence might serve as signals for a recognition event(s) at pac in a separate process preceding the cutting reaction. The region of packaging initiation is located within the sequence coding for gene 3. The 3 protein is responsible for the site specificity of this process. We find no significant homology to Nu1 protein, which appears to have an analogous or similar function in the DNA maturation of Escherichia coli phage lambda.