Mechanism of in vitro expansion of long DNA repeats: effect of temperature, repeat length, repeat sequence, and DNA polymerases.

Studies of sequence repeat expansions from duplexes consisting of DNA repeat sequences greater than three bases are currently lacking. These studies are needed in order to gain a better understanding of DNA expansions in general and as a first step in understanding expansions of longer sequence repeats that have been implicated in human diseases. We have undertaken an in vitro study of tetranucleotide, hexanucleotide, and octanucleotide repeat expansions from short DNA duplexes using Taq DNA polymerase. Expansions of hexanucleotide repeats were also studied with the Klenow fragment of DNA polymerase I and with T4 DNA polymerase. Studies with Taq DNA polymerase show that expansions occur more readily as the length of the repeat sequence decreases but are generally more efficient at reaction temperatures closer to the melting point of the starting duplex. A mechanism for the observed expansions with Taq DNA polymerase is proposed that does not invoke strand slippage or DNA structure. Studies at 37 degrees C with Klenow pol I and T4 DNA polymerase indicate that the template-switching and/or strand-displacement activities of the polymerases used can play a major role in the apparent in vitro expansions of short repetitive DNA duplexes.     

Elongation of repetitive DNA by DNA polymerase from a hyperthermophilic bacterium Thermus thermophilus

Short repetitive DNA sequences are believed to be one of the primordial genetic elements that served as a source of complex large DNA found in the genome of modern organisms. However, the mechanism of its expansion (increase in repeat number) during the course of evolution is unclear. We demonstrate that the DNA polymerase of the hyperthermophilic bacterium Thermus thermophilus can elongate oligoDNA with several tandem repeats to very long DNA in vitro. For instance, 48mer repetitive oligoDNA (TACATGTA)₆, which has 25% GC content and a palindromic sequence, can be elongated up to ~10 000 bases by DNA polymerase at 74°C without template DNA. OligoDNA having a different GC content or a quasi-palindromic sequence can also be elongated, but less efficiently. A spectroscopic thermal melting experiment with the oligoDNA showed that its hairpin–coil transition temperature was very close to the elongation reaction temperature (74°C), but was much higher than the temperature at which duplex oligoDNA can exist stably. Taken together, we conclude that repetitive oligoDNA with a palindromic or quasi-palindromic sequence is elongated extensively by a hyperthermophilic DNA polymerase through hairpin–coil transitions. We propose that such an elongation mechanism might have been a driving force to expand primordial short DNA.     

Creation of genetic information by DNA polymerase of the thermophilic bacterium Thermus thermophilus.

Genetic information encoded in a template of a genome is replicated in a complementary way by DNA polymerase or RNA polymerase with high fidelity; no creation of information occurs in this reaction unless an error occurs. We report here that DNA polymerase of the thermophilic bacterium Thermus thermophilus can synthesize up to 200 kb linear double-stranded DNA in vitro in the complete absence of added primer and template DNAs, indicating that genetic information is actively created by protein. This ab initio DNA synthesis occurs at 74 degrees C and requires magnesium ion. There is a lag time of approximately 1 h and then the reaction proceeds linearly. The synthesized DNAs have a variety of sequences; they are mostly tandem repetitive sequences, e.g. (CATGTATA) n , (TGTATGTATACATACATA) n and (TATACGTA) n . Some degenerate sequences of these basic repeat units are also found. The similar repetitive sequences are found in many natural genes. These results, together with similar results found using DNA polymerase of archaeon Thermococcus litoralis , suggest that creative, non-replicative synthesis of DNA by protein was a driving force for diversification of genetic information at a certain stage of the evolution of life on the early earth.     

Evolutionary divergence and length of repetitive sequences in sea urchin DNA

Summary The organization of repetitive and single copy DNA sequences in sea urchin DNA has been examined with the single strand specific nuclease Sl fromAspergillus. Conditions and levels of enzyme were established so that single strand DNA was effectively digested while reassociated divergent repetitive duplexes remained enzyme resistant. About 25% of sea urchin DNA reassociates with repetitive kinetics to form Sl resistant duplexes of two distinct size classes derived from long and short repetitive sequences in the sea urchin genome. Fragments 2,000 nucleotides long were reassociated to Cot 20 and subjected to controlled digestion with Sl nuclease. About half of the resistant duplexes (13% of the DNA) are short, with a mode size of about 300 nucleotide pairs. This class exhibits significant sequence divergence, and principally consists of repetitive sequences which were interspersed with single copy sequences. About one-third of the long duplexes (4% of the DNA) are reduced in size after extensive Sl nuclease digestion to about 300 nucleotide pairs. About two-thirds of the long resistant duplexes (8% of the DNA) remains long after extensive SI nuclease digestion. These long reassociated duplexes are precisely base paired. The short duplexes are imprecisely paired with a melting temperature about 9°C below that of precisely paired duplexes of the same length. The relationship between length of repetitive duplex and precision of repetition is confirmed by an independent method and has been observed in the DNA of a number of species over a wide phylogenetic area.Also Staff Member, Carnegie Institution of Washington     

Elongation of palindromic repetitive DNA by DNA polymerase from hyperthermophilic archaea: a mechanism of DNA elongation and diversification

DNA polymerase from hyperthermophilic bacteria can elongate tandem repetitive oligoDNA with a complete or incomplete palindromic sequence under isothermal conditions by "hairpin elongation". However, the product of the reaction has not yet been sufficiently characterized. Here, I demonstrate that when palindromic repetitive oligoDNA, e.g., (5'AGATATCT3')(6), was added as a "seed" to the DNA synthesis reaction catalyzed by DNA polymerase from the archaea Thermococcus litoralis (Vent polymerase) at 74 degrees C, the product was (5'AGATATCT3')(n). The product itself was palindromic and repetitive, and its motif (unit) sequence was exactly the same as that of the seed oligoDNA. On the other hand, when a pseudopalindrome, which contains a palindrome-breaking nucleotide (underlined), was present in seed oligoDNA, e.g., (5'GATTC3')(6), the product was (5'GATATC3')(n), which had a different motif sequence from that of the seed oligoDNA. When a pseudopalindrome (5'AGATATCA3')(6) was added to the reaction, the products were 5'TATCA . (AGATATCA)(3) . AGATATCT . (TGATATCT)(5) . TGATA3', etc. When 5'AGATATCA . (AGATATCT3')(5) was added, products were 5'TATCT . (AGATATCT)(2).TGATATCT . AGATATCT . AGATATCA . AGATATCT . AGA3', etc., demonstrating the generation of many "mutations" in the product DNA. I conclude that a tandem repetitive sequence is faithfully elongated (amplified) by hyperthermophilic DNA polymerase if it is completely palindromic, but is elongated with many errors if it is incompletely palindromic (pseudopalindromic) or mixed with a pseudopalindrome. The results suggest a protein-catalyzed elongation/diversification mechanism of short repetitive DNAs on the early earth.     

Subunit structure of chromatin and the organization of eukaryotic highly repetitive DNA: recurrent periodicities and models for the evolutionary origins of repetitive DNA.

A restriction enzyme analysis of the repeat structure of mouse satellite, sheep satellite II, human highly repetitive fractions, calf satellite I, and a repetitive fraction of the rat indicates that those DNAs share repeat periodicites in common with one another and with the highly repetitive component α DNA of the African green monkey. The basic repeat periodicity of component α is 176 ± 4 nucleotide base-pairs: the repeat periodicities of the various highly repetitive fractions described here also seem based on this fundamental unit, but it is disguised by a superimposed, higher order repeat organization in each case. The higher orders of organization are based on integral multiples of the basic unit which may reflect the nucleosome spacing of constitutive heterochromatin. With the exception of component α DNA, which shows a repeat structure based on a monomer of 176 ± 4 nucleotide base-pairs, all of the highly repetitive DNAs examined showed a preference for even-numbered or geometric multiples of the basic unit in their higher order sequence organization. It is suggested that such organization is a relatively recent development in the hierarchical evolution of the sequences.Several models are discussed which may account for the higher order organization and expansion of these highly repetitive DNAs. Either a modified unequal crossover model (Smith, 1973) or a modified replicative loop model (Keyl, 1965a) seems consistent with many of the properties of highly repetitive DNAs. The models may have implications for the number, distribution and intranuclear rearrangements of transcribed sequences associated with such DNAs.     

Characterization of long and short repetitive sequences in the sea urchin genome

Long and short repetitive sequences were purified from the DNA of Paracentrotus lividus under conditions designed to optimize the yield of complete, end to end sequences. Double-stranded long repeat DNA prepared in this manner ranged in length from approximately 3000 to 15 000 nucleotide pairs with average sizes of approximately 6000 base pairs. In the electron microscope, long repeat DNA was observed to possess continuous sequences that often appeared to be terminated by one or more loops and/or fold backs. Long repeat DNA sequences, resheared to 300 base pairs, were found to have an average melting point identical to that for sheared native DNA. Thus, the reassociated duplexes of long repetitive DNA seem to possess very few mismatched base pairs. Reassociation kinetic analyses indicate that the majority of the long repeat sequences are reiterated only 4--7 times per haploid amount of DNA. Melt-reassociation analyses of short repetitive DNA, at several criteria, support the previously held concept that these sequences belong the sets or families of sequences which are inexact copies of one another. Our studies also support hypotheses suggesting that short repetitive sequences belong to families which may have arisen via distinct salttatory events. The relationships between long and short repetitive DNA sequences are considered with respect to widely held concepts of their sequence organization, evolution, and possible functions within eucaryotic genomes. A model for the possible organization of short repeats within long repetitive DNA sequences is also presented.     

DNA sequence organization in the genomes of three related millet plant species

Summary A major portion of the genomes of three millet species, namely, barn yard millet, fox tail millet and little millet has been shown to consist of interspersed repeat and single copy DNA sequences. The interspersed repetitive DNA sequences are both short (0.15–1.0 kilo base pairs, 62–64% and long (>1.5 kilo base pairs, 36–38%) in barn yard millet and little millet while in fox tail millet, only long interspersed repeats (>1.5 kilo base pairs) are present. The length of the interspersed single copy DNA sequences varies in the range of 1.6–2.6 kilo base pairs in all the three species. The repetitive duplexes isolated after renaturation of 1.5 kilo base pairs and 20 kilo base pairs long DNA fragments exhibit a high thermal stability with Tms either equal to or greater than the corresponding native DNAs. The S1 nuclease resistant repetitive DNA duplexes also are thermally stable and reveal the presence of only 1–2% sequence divergence.The present data on the modes of sequence arrangement in millets substantiates the proposed trend in plants, namely, plants with 1C nuclear DNA content of less than 5 picograms have diverse patterns of sequence organization while those with 1C nuclear DNA content greater than 5 picograms have predominantly a short period interspersion pattern.Abbreviations kbp kilobase pairs NCL Communication No. 3606.     

A new repetitive DNA sequence family in the olive (Olea europaea L.)

Two families of repeated DNA sequences were cloned from Olea europaea ssp sativa cv. "Picual". The first repetitive DNA is organized in a tandem repeat of monomers of 178 bp. Sequencing of several clones showed that it is relatively A-T rich (54.49%) and possesses short direct and inverted subrepeats as well as some palindromic sequences. Comparison between the monomers revealed heterogeneity of the sequence primary structure. This repetitive DNA is present in several cultivars of olive cultivates. Comparison of sequences with other repetitive DNAs described in Olea europaea has been carried out. No significant similarity was found. All the obtained results suggest that this repetitive DNA described here is a new family of repetitive DNA. The second repetitive DNA is organized in a tandem repeat of monomers of 78 bp. This second family of repetitive DNA showed significant similarity with other repetitive DNAs previously described in Olea europaea. Their existence in new cultivars of olive is shown.     

An alternative view of mammalian DNA sequence organization: II. Short repetitive sequences are organized into scrambled tandem clusters in Syrian hamster DNA

Hyperchromicity, S₁ nuclease digestion, and reassociation studies of Syrian hamster repetitive DNA have led to novel conclusions about repetitive sequence organization. Re-evaluation of the hyperchromicity techniques commonly used to determine the average length of genomic repetitive DNA regions indicates that both the extent of reassociation, and the possibility of non-random elution of hyperpolymers from hydroxyapatite can radically affect the observed hyperchromicity. An alternative interpretation of hyperchromicity experiments, presented here, suggests that the average length of repetitive regions in Syrian hamster DNA must be greater than 4000 nucleotides.S₁ nuclease digestion of reassociated 3200 nucleotide Syrian hamster repetitive DNA, on the other hand, yields both long (>2000 nucleotides) and short (300 nucleotides) resistant DNA duplexes. Calculations indicate that the observed mass of short nuclease-resistant duplexes (>60%) is too large to have arisen only from independent short repetitive DNA sequences alternating with non-repetitive regions. Reassociation experiments using long and short S₁ nuclease-resistant duplexes as driver DNA indicate that all repetitive sequences are present in both fractions at approximately the same concentration. Isolated long S₁ nuclease-resistant duplexes, after denaturation, renaturation, and a second S₁ nuclease digestion, again produce both long and short DNA duplexes. Reassociation experiments indicate that all repetitive DNA sequences are still present in the “recycled” long S₁ nuclease-resistant duplexes. These experiments imply that many of the short S₁ nuclease-resistant repetitive DNA duplex regions present in reassociated Syrian hamster DNA were initially present in the genome as part of longer repetitive sequence blocks. This conclusion suggests that the majority of “short” repetitive regions in Syrian hamster DNA are organized into scrambled tandem clusters rather than being individually interspersed with non-repetitive regions.     

Exploration of long and short repetitive sequence relationships in the sea urchin genome.

Long and short repetitive sequences of sea urchin DNA were prepared by reassociation of 2000 nucleotide long fragments to Cot 4 and digestion with the single strand specific nuclease S1. The S1 resistant duplexes were separated into long repetitive and short repetitive fractions on Agarose A50. The extent of shared sequences was studied by reassociating a labeled preparation of short repetitive DNA with an excess of unlabeled long repetitive DNA. Less than 10% of the long repetitive DNA preparation was able to reassociate with the short repetitive DNA. Thus the long and short repetitive elements appear to be principally independent sequence classes in sea urchin DNA. Precisely reassociating repetitive DNA was prepared by four successive steps of reassociation and thermal chromatography on hydroxyapatite. This fraction (3% of the genome) was reassociated by itself or with a great excess of total sea urchin DNA. The thermal stability of the products was identical in both cases (Tm=81 degrees C), indicating that precisely repeated sequences do not have many imprecise copies in sea urchin DNA.     

Analysis of rat repetitive DNA sequences.

Parameters of repetitive sequence organization have been measured in the rat genome. Experiments using melting, hydroxylapatite binding, and single strand specific nuclease digestion have been used to measure the number, length, and arrangement of repeated DNA sequences. Renaturation and melting or S1 nuclease digestion of 1.0 kbp DNA fragment show about 20% of rat DNA sequences are 3000-fold repeated. Renatured duplexes from 4.0 kbp DNA fragments display two repetitive size fractions after nuclease digestion. About 60% of the repeated sequences are 0.2-0.4 kbp long while the remainder are longer than 1.5 kbp. The arrangement of the repeated sequences has been measured by hydroxylapatite fractionation of DNA fragments of varying lengths bearing a repeated sequence. Repeated DNA sequences are interspersed among 2.5 kbp long nonrepeated sequences throughout more than 70% of the rat genome. There are approximately 350 different 3000-fold short repeated sequences in the rat interspersed among 600,000 nonrepeated DNA sequences.     

The evolution of the long and short repetitive DNA sequences in sea urchins.

The rates of evolution of purified long and short repetitive DNA sequences were examined by hybridisation analysis between the DNAs from several species of sea urchins. We find that the rates of nucleotide substitution are very comparable within mutually retained sequences for the two classes of repetitive DNA. The loss of hybridisable sequences between species also occurs at similar rates among both the short and long repetitive DNA sequences. Between species that separated less than 50 million years ago, hybridisable short repetitive sequences are lost all through the spectrum of reiteration frequencies. The long repeats contain a few sequences which are highly conserved within all of the species examined, and which amount to approximately 1% of the total genome. The short repetitive class, on the other hand, does not seem to contain any such highly conserved elements. The long repetitive sequences internally appear to contain short 'units' of reiteration, which may comprise families within the long repetitive class. We find no evidence to indicate that the majority of long and short repetitive sequences evolve by different mechanisms or at different rates.     

Replication fork regression in repetitive DNAs

Among several different types of repetitive sequences found in the human genome, this study has examined the telomeric repeat, necessary for the protection of chromosome termini, and the disease-associated triplet repeat (CTG)·(CAG)_n. Evidence suggests that replication of both types of repeats is problematic and that a contributing factor is the repetitive nature of the DNA itself. Here we have used electron microscopy to investigate DNA structures formed at replication forks on large model DNAs containing these repeat sequences, in an attempt to elucidate the contributory effect that these repetitive DNAs may have on their replication. Visualization of the DNA revealed that there is a high propensity for a paused replication fork to spontaneously regress when moving through repetitive DNAs, and that this results in a four-way chickenfoot intermediate that could present a significant block to replication in vivo, possibly leading to unwanted recombination events, amplifications or deletions.     

The use of repetitive DNA in cytogenetic studies of plant sex chromosomes

The structure of sex chromosomes in plants was analyzed by fluorescent in situ hybridization (FISH) with repetitive DNAs. FISH probes were successfully obtained from DNA libraries that were amplified from microdissected sex chromosomes. Some probes hybridized to the subtelomeric regions, where many kinds of repetitive DNAs are located with intrachromosomal similarity of their repeat units rather than interchromosomal similarity. For example, FISH with the subtelomeric repetitive sequence can easily show the location of the pseudoautosomal region (PAR) on the X chromosome of Silene latifolia. The other probes were localized on the interstitial region of the sex chromosomes. The interstitial region contains chloroplast DNAs or neighboring sequences of the internal telomeres, suggesting insertion or translocation occurred during differentiation of the sex chromosome. These data are very informative for understanding the structure of the plant sex chromosomes and their evolutionary process.     

Elongation of tandem repetitive DNA by the DNA polymerase of the hyperthermophilic archaeon Thermococcus litoralis at a hairpin-coil transitional state: a model of amplification of a primordial simple DNA sequence

DNA is replicated by DNA polymerase semiconservatively in many organisms. Accordingly, the replicated DNA does not become larger than the original DNA (template DNA), implying that replicative synthesis by DNA polymerase alone cannot explain the diversification of primordial simple DNA. We demonstrate that a single-stranded tandem repetitive oligodeoxyribonucleic acid (oligoDNA) composed of a palindromic or quasi-palindromic motif sequence and 25-50% GC content is elongated in vitro to more than 20,000 bases at 70-74 degrees C by the DNA polymerase of the hyperthermophilic archaeon Thermococcus litoralis without a bimolecular primer-template complex. The efficiency of elongation decreased when the palindromic structure of the oligoDNA was destroyed or when the GC content of the oligoDNA was outside the range of 25-50%. The thermal melting transition profile of the oligoDNA, as observed by ultraviolet spectroscopy, exhibited a biphasic curve, reflecting a duplex-hairpin transition at 31-40 degrees C and a hairpin-coil transition at 70-77 degrees C. The optimal reaction temperature for the elongation, for instance, of oligoDNA (AGATATCT)(6) (72 degrees C) was very close to its hairpin-coil transition melting temperature (70.4 degrees C), but was markedly higher than the temperature at which duplex oligoDNA can exist stably (<35.9 degrees C). These results suggest that a hairpin-based "intramolecular primer-template structure" is formed transiently in the oligoDNA, and it is elongated by the DNA polymerase to long DNA through repeated cycles of folding and melting of the hairpin structure. We discuss the implication of this phenomenon, "hairpin elongation", from the standpoint of potential amplification of simple DNA sequences during the evolution of the genome.     

The evolution of repetitive DNA sequences in sea urchins.

Molecular hybridization of nuclear DNAs has been employed to study the evolution of the repetitive DNA sequences in four species of sea urchin. The data show that relative to S. purpuratus there has been approximately 0.1% sequence divergence per million years in the repetitive DNA sequences of S. droebachiensis, S. franciscanus, and L. pictus. These results confirm that repetitive DNA sequences are strongly conserved during evolution. However, comparison of the extent of base pair mismatch in the repetitive DNA heteroduplexes formed at Cot 20 with those formed at Cot 200 during the hybridization of S. purpuratus and L. pictus DNAs reveals that highly repetitive sequences of sea urchins may diverge more rapidly than do the more moderately repetitive sequences.     

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.     

Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch.

Oligodeoxyribonucleotides complementary to the DNA of the wild type (wt) bacteriophage phi chi 174 have been synthesized by the phosphotriester method. The oligomers, 11, 14, and 17 bases long, are complementary to the region of the DNA which accounts for the am-3 point mutation. When hybridized to am-3 DNA, the oligonucleotides form duplexes with a single base pair mismatch. The thermal stability of the duplexes formed between wt and am-3 DNAs has been measured. The am-3 DNA:oligomer duplexes dissociate at a temperature about 10 degrees C lower than the corresponding wt DNA:oligomer duplexes. This dramatic decrease in thermal stability due to a single mismatch makes it possible to eliminate the formation of the mismatched duplexes by the appropriate choice of hybridization temperature. These results are discussed with respect to the use of oligonucleotides as probes for the isolation of specific cloned DNA sequences.