Chromosomal localization and racial distribution of the polymorphic human dihydrofolate reductase pseudogene (DHFRP1).

The human dihydrofolate reductase (DHFR) gene family comprises one functional gene and at least four intronless processed pseudogenes. The functional DHFR gene is on chromosome 5, and DHFRP4 is on chromosome 3. Using in situ hybridization, we have now localized the functional DHFR gene to the region q11.1-q13.3 on chromosome 5. By genomic DNA analysis of a panel of human X rodent somatic-cell hybrids, we determined the chromosomal assignment of the DHFRP1 pseudogene to chromosome 18 and that of the DHFRP2 pseudogene to chromosome 6. The DHFRP1 pseudogene exhibits a novel form of polymorphism in humans in that it is present in the DNA of some individuals and absent in that of others. We investigated the racial distribution of this pseudogene in five racial groups. The allelic frequency as defined by analysis of 180 chromosomes was found to be 94% in Mediterraneans, 77% in Asian Indians, 67% in Chinese, 57% in Southeast Asians, and 32% in American blacks. These data suggest that the transposition of this "perfect" pseudogene occurred prior to the inception of the human racial groups.     

The human connexin gene family of gap junction proteins: distinct chromosomal locations but similar structures.

Connexins are protein subunits that constitute gap junction channels. Two members of this gene family, connexin43 (Cx43) and connexin32 (Cx32), are abundantly expressed in the heart and liver, respectively. Human genomic DNA analysis revealed the presence of two loci for Cx43: an expressed gene and a processed pseudogene. The expressed gene (GJA1) was mapped to human chromosome 6 and the pseudogene (GJA1P) to chromosome 5. To determine whether Cx32 was linked to Cx43, somatic cell hybrids were analyzed by polymerase chain reaction and hybridization, resulting in the assignment of the gene for Cx32 (GJB1) to the X chromosome at Xp11----q22. Comparison of the structures of connexin genes suggests that members of this multigene family arose from a single precursor, but evolved to distinct chromosomal locations.     

Genomic organization and mapping of the gene encoding the PP2A B56gamma regulatory subunit

Protein phosphatase 2A (PP2A) is a major serine/threonine phosphatase that regulates a wide variety of cellular processes. The enzymatic activity and intracellular localization of PP2A are determined by three distinct families of cellular regulatory subunits (B, B', and B'). The B' subunit, also known as B56, is the most diverse, consisting of five isoforms (alpha, beta, gamma, delta, and epsilon). The gene encoding B56gamma has been designated as PPP2R5C and encodes three differentially spliced variants: B56gamma1, -gamma2, and -gamma3. However, conflicting chromosomal loci have been reported in human genomic databases. The original cytogenetic mapping placed the gene on chromosome 3p21.3, whereas subsequent studies using radiation hybrid analysis localized PPP2R5C to chromosome 14q. In this study, by radiation hybrid mapping, FISH analysis, BAC clone sequencing, and RT-PCR analysis, we show that the functional gene PPP2R5C exists at 14q32.2 and gives rise to three splicing variants, B56gamma1, -gamma2, and -gamma3, whereas a nonfunctional B56gamma1 pseudogene, PPP2R5CP, is present at 3p21.3. We also report the genomic organization of both the functional gene and the pseudogene.     

Genomic Organization,Fine-Mapping,and Expression of the HumanIslet-Brain 1 (IB1)/C-Jun-Amino-Terminal Kinase Interacting Protein-1 (JIP-1)Gene

Islet-brain 1 (IB1), a regulator of the pancreatic β-cell function in the rat, is homologous to JIP-1, a murine inhibitor of c-Jun amino-terminal kinase (JNK). Whether IB1 and JIP-1 are present in humans was not known. We report the sequence of the 2133-bp human IB1 cDNA, the expression, structure, and fine-mapping of the humanIB1gene, and the characterization of anIB1pseudogene. Human IB1 is 94% identical to rat IB1. The tissue-specific expression of IB1 in human is similar to that observed in rodent. TheIB1gene contains 12 exons and maps to chromosome 11 (11p11.2–p12), a region that is deleted in DEFECT-11 syndrome. Apart from anIB1pseudogene on chromosome 17 (17q21), no additionalIB1-related gene was found in the human genome. Our data indicate that the sequence and expression pattern of IB1 are highly conserved between rodent and human and provide the necessary tools to investigate whether IB1 is involved in human diseases.     

Molecular cloning of the human methylthioadenosine phosphorylase processed pseudogene and localization to 3q28

Human methylthioadenosine phosphorylase (MTAP) is a purine and methionine metabolic enzyme present ubiquitously in all normal tissues, but often deleted in many types of cancer. The gene for this enzyme maps to chromosome 9 at band p21 where the cyclin-dependent kinase inhibitor genes for p16 and p15 also reside. During our efforts to clone this gene we also isolated a phage clone containing a processed pseudogene of MTAP. The sequence is 92% homologous to the MTAP cDNA, is flanked at its 3′ end by a repetitive element, but does not possess a poly(A) stretch. We localized this processed pseudogene to band 28 on the long arm of chromosome 3 by fluorescence in situ hybridization. All 22 malignant cell lines with deletions at 9p21 screened possessed the pseudogene.     

A maximum likelihood method for analyzing pseudogene evolution: implications for silent site evolution in humans and rodents.

We present a new likelihood method for detecting constrained evolution at synonymous sites and other forms of nonneutral evolution in putative pseudogenes. The model is applicable whenever the DNA sequence is available from a protein-coding functional gene, a pseudogene derived from the protein-coding gene, and an orthologous functional copy of the gene. Two nested likelihood ratio tests are developed to test the hypotheses that (1) the putative pseudogene has equal rates of silent and replacement substitutions; and (2) the rate of synonymous substitution in the functional gene equals the rate of substitution in the pseudogene. The method is applied to a data set containing 74 human processed-pseudogene loci, 25 mouse processed-pseudogene loci, and 22 rat processed-pseudogene loci. Using the informatics resources of the Human Genome Project, we localized 67 of the human-pseudogene pairs in the genome and estimated the GC content of a large surrounding genomic region for each. We find that, for pseudogenes deposited in GC regions similar to those of their paralogs, the assumption of equal rates of silent and replacement site evolution in the pseudogene is upheld; in these cases, the rate of silent site evolution in the functional genes is approximately 70% the rate of evolution in the pseudogene. On the other hand, for pseudogenes located in genomic regions of much lower GC than their functional gene, we see a sharp increase in the rate of silent site substitutions, leading to a large rate of rejection for the pseudogene equality likelihood ratio test.     

The human histone gene cluster at the D6S105 locus

The sequences and organization of the histone genes in the histone gene cluster at the chromosomal marker D6S105 have been determined by analyzing the Centre d’étude du Polymorphisme Humain yeast artificial chromosome (YAC) 964f1. The insert of the YAC was subcloned in cosmids. In the established contig of the histone-gene-containing cosmids, 16 histone genes and 2 pseudogenes were identified: one H1 gene (H1.5), five H2A genes, four H2B genes and one pseudogene of H2B, three H3 genes, and three H4 genes plus one H4 pseudogene. The cluster extends about 80 kb with a nonordered arrangement of the histone genes. The dinucleotide repeat polymorphic marker D6S105 was localized at the telomeric end of this histone gene cluster. Almost all human histone genes isolated until now have been localized within this histone gene cluster and within the previously described region of histone genes, about 2 Mb telomeric of the newly described cluster or in a small group of histone genes on chromosome 1. We therefore conclude that the data presented here complete the set of human histone genes. This now allows the general organization of the human histone gene complement to be outlined on the basis of a compilation of all known histone gene clusters and solitary histone genes. Received: 30 June 1997 / Accepted: 3 September 1997     

Mapping of the human casein kinase II catalytic subunit genes: two loci carrying the homologous sequences for the alpha subunit.

The human serine/threonine protein casein kinase II (CK II) contains two distinct catalytic subunits, alpha and alpha 1, which are encoded by different genes. A combination of segregation analysis of rodent-human hybrid cells and chromosomal in situ hybridization have localized the human CK II-alpha DNA sequence to two loci: 11p15.5-p15.4 and 20p13. In contrast, the CK II-alpha' gene has been mapped to chromosome 16 by somatic cell hybrid analysis. Taken together with our previous assignment of the CK II regulatory beta-subunit gene to 6p12-p21, these results indicate that although the products of these genes form a single biological complex, they are encoded on different human chromosomes. Further analysis should determine whether both loci of CK II-alpha are functional, or perhaps one of the two constitutes a pseudogene.     

Low-Molecular-Weight, Calcium-Dependent Phospholipase A2Genes Are Linked and Map to Homologous Chromosome Regions in Mouse and Human

The Group IIA phospholipase gene (PLA2G2A) protein coding regions exhibit significant homology with recently described Group IIC (PLA2G2C) and Group V (PLA2GV) genes. All three genes are present in many mammalian species and are expressed in a tissue-specific pattern. Here, we demonstrate in human that they are tightly linked and map to chromosome 1p34–p36.1. We also show that the homologous mouse loci are tightly linked (no observed recombination) on the distal part of chromosome 4, a region exhibiting synteny with human 1p34–p36. Unlike its rodent counterpart, humanPLA2G2Cappears to be a nonfunctional pseudogene.     

Assignment of casein kinase 2 alpha sequences to two different human chromosomes

Summary Human casein kinase 2 alpha gene (CK-2-alpha) sequences have been localized within the human genome by in situ hybridization and somatic cell hybrid analysis using a CK-2 alpha cDNA as a probe. By in situ hybridization, the CK-2 alpha cDNA could be assigned to two different loci, one on 11p15.1-ter and one on 20p13. The existence of two separate chromosomal loci suggests that CK-2 alpha is a member of a gene family. Only the locus on chromosome 11 was confirmed by somatic cell hybrid analysis. The analysis was based on the presence of a CK-2-alpha-specific 20-kb fragment. However, the CK-2 alpha cDNA hybridizes to several additional fragments in total human DNA.     

Assignment of a human autoimmune antigen,p80-coilin gene to chromosome 17q21-q23 and of its possible pseudogene to chromosome 14

In order to determine the chromosomal locations of an autoimmune antigen, the coilin gene and its pseudogene, we amplified the segments of the two genes by the polymerase chain reaction (PCR) and screened a panel of somatic cell hybrids for the presence of the gene products. The results indicate that the human coilin gene and its pseudogene can be assigned to chromosome 17 and chromosome 14, respectively. Further analysis of cell hybrids bearing chromosome 17 with various deletions localized the coilin gene to the region q21–q23.     

Human homologs of two testes-expressed loci on mouse chromosome 17 map to opposite arms of chromosome 6

Our laboratory has recently cloned and characterized two testes-expressed loci--the Tcp-10 gene family cluster and the D17Si11 gene--that map to the proximal portion of mouse chromosome 17. Human homologs of both loci have been identified and cloned. Somatic cell hybrid lines have been used to map the human homolog of D17Si11 to the short arm of chromosome 6 (p11-p21.1) along with homologs of other genes from the (Pim-1)-(Pgk-2) region of the mouse chromosome. The human TCP 10 locus maps to the long arm of chromosome 6 (q21-qter) along with homologs of other genes from the mouse chromosome 17 region between the centromere and Pim-1. The mapping of large portions of the mouse t haplotype to unlinked regions on human chromosome 6 rules out the possibility that a t-haplotype-like chromosome could exist in humans.     

Evolutionary implications of the human aldolase-A, -B, -C, and -pseudogene chromosome locations.

The aldolase genes represent an ancient gene family with tissue-specific isozymic forms expressed only in vertebrates. The chromosomal locations of the aldolase genes provide insight into their tissue-specific and developmentally regulated expression and evolution. DNA probes for the human aldolase-A and -C genes and for an aldolase pseudogene were used to quantify and map the aldolase loci in the haploid human genome. Genomic hybridization of restriction fragments determined that all the aldolase genes exist in single copy in the haploid human genome. Spot-blot analysis of sorted chromosomes mapped human aldolase A to chromosome 16, aldolase C to chromosome 17, the pseudogene to chromosome 10; it previously had mapped the aldolase-B gene to chromosome 9. All loci are unlinked and located on to two pairs of morphologically similar chromosomes, a situation consistent with tetraploidization during isozymic and vertebrate evolution. Sequence comparisons of expressed and flanking regions support this conclusion. These locations on similar chromosome pairs correctly predicted that the aldolase pseudogene arose when sequences from the aldolase-A gene were inserted into the homologous aldolase location on chromosome 10.     

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.     

Assignment of the fucosidase pseudogene FUCA1P to chromosome region 2q31----q32

FUCA1P is a pseudogene of the structural fucosidase gene FUCA1. The former has been mapped to human chromosome 2, whereas the latter has been localized to chromosome 1p34----p36. We have further localized FUCA1P to chromosomal band 2q31----q32 by fluorescent in situ hybridization and digital imaging microscopy. This localization was confirmed by linkage analysis between FUCA1P and the COL3A1 gene in 2q24----q32 which gave maximal lod scores of 4.03 at 3% recombination.     

Regional assignment of the human acid sphingomyelinase gene (SMPD1) by PCR analysis of somatic cell hybrids and in situ hybridization to 11p15.1----p15.4

Human acid sphingomyelinase (SMPD1) is the lysosomal phosphodiesterase that cleaves sphingomyelin to ceramide and phosphocholine. The deficient activity of SMPD1 is the enzymatic defect in Types A and B Niemann-Pick disease. Previously, the gene encoding human SMPD1 was assigned to chromosome 17 by the differential thermostability of human and hamster SMPD1 in somatic cell hybrids. The recent isolation of the human SMPD1 cDNA (L. E. Quintern, E. H. Schuchman, O. Levran, M. Suchi, K. Ferlinz, H. Reinke, K. Sandhoff, and R. J. Desnick, 1989, EMBO J. 8: 2469-2473) permitted the mapping of this gene by molecular techniques. Oligonucleotide primers were synthesized to PCR amplify the human, but not murine, SMPD1 sequences in man-mouse somatic cell hybrids. In a panel of 15 hybrid cell lines, amplification of the human SMPD1 sequence was 100% concordant with the presence of human chromosome 11. For each of the other human chromosomes there were at least 6 discordant hybrid lines. Further analysis of somatic cell hybrids containing only chromosome 11 or chromosome 11 rearrangements localized the human SMPD1 gene to the region 11p15.1----p15.4. To provide an independent regional gene assignment, in situ hybridization was performed using the radiolabeled human SMPD1 cDNA. In the 58 metaphase cells examined, 34% of the 122 hybridization sites scored were located in the distal end of chromosome 11 with the major peak of hybridization at band 11p15. The absence of any other in situ hybridization site indicated the absence of pseudogenes or homologous sequences elsewhere in the genome. In contrast to the previous provisional localization to chromosome 17, these results assign a single locus for human SMPD1 to 11p15.1----p15.4.     

Cloning of cDNAs for human phosphoribosylpyrophosphate synthetases 1 and 2 and X chromosome localization of PRPS1 and PRPS2 genes

Cloned cDNAs representing the entire, homologous (80%) translated sequences of human phosphoribosylpyrophosphate synthetase (PRS) 1 and PRS 2 cDNAs were utilized as probes to localize the corresponding human PRPS1 and PRPS2 genes, previously reported to be X chromosome linked. PRPS1 and PRPS2 loci mapped to the intervals Xq22-q24 and Xp22.2-p22.3, respectively, using a combination of in situ chromosomal hybridization and human x rodent somatic cell panel genomic DNA hybridization analyses. A PRPS1-related gene or pseudogene (PRPS1L2) was also identified using in situ chromosomal hybridization at 9q33-q34. Human HPRT and PRPS1 loci are not closely linked. Despite marked cDNA and deduced amino acid sequence homology, human PRS 1 and PRS 2 isoforms are encoded by genes widely separated on the X chromosome.