共查询到20条相似文献,搜索用时 31 毫秒
1.
Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4/SMAD4 gene, lying in close proximity to the DCC gene at 18q21.1, was recently identified as a candidate tumor suppressor for the genesis of pancreatic cancer as well as a predisposing gene for Juvenile Polyposis Syndrome (JPS). The gene product functions as a cytoplasmic mediator in the signaling pathway of transforming growth factor beta (TGF-beta). To investigate the potential role of DPC4/SMAD4 gene in colorectal cancers, we examined 73 tumors of clinical stages II or III from Japanese patients, for LOH at 18q21 and also for subtle mutations anywhere within the coding region of DPC4/SMAD4. LOH was identified in 50 (78%) of the 64 tumors that were informative for polymorphic markers in the region. Somatic mutations were identified in seven of those tumors: two frameshift mutations, a 1-bp deletion (326 del T) in exon 8 and a 1-bp insertion (50-51 ins A) in exon 1; two nonsense mutations, Arg445Ter in exon 10 and Glu538Ter in exon 11; and three missense mutations, Asn129Lys in exon 2, Tyr95Asn in exon 2, and Asp355Glu in exon 8. Three of the seven mutations were observed in the mad homology 1 (MH1) domain encoded by exons 1 and 2. In all of the tumors carrying intragenic mutations of one allele, LOH analysis had shown that the other allele was missing. The results demonstrated that inactivation of both alleles of the DPC4/SMAD4 gene occurs in a substantial proportion of advanced colorectal cancers, and that the DPC4/SMAD4 gene probably exerts a tumor-suppressor effect for colorectal carcinogenesis that fulfills the criterion of the two-hit concept proposed by Knudson [A.G. Knudson, Hereditary cancer, oncogenes, and anti-oncogenes, Cancer Res. 45 (1985) 1437-1443.]. 相似文献
2.
Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation 总被引:2,自引:0,他引:2
Popović Hadzija M Radosevic S Kovacević D Lukac J Hadzija M Spaventi R Pavelić K Kapitanović S 《Mutation research》2004,548(1-2):61-73
Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers. 相似文献
3.
4.
Richard Kim Michael J. Schell Jamie K. Teer Danielle M. Greenawalt Mingli Yang Timothy J. Yeatman 《PloS one》2015,10(5)
IntroductionMetastasis is thought to be a clonal event whereby a single cell initiates the development of a new tumor at a distant site. However the degree to which primary and metastatic tumors differ on a molecular level remains unclear. To further evaluate these concepts, we used next generation sequencing (NGS) to assess the molecular composition of paired primary and metastatic colorectal cancer tissue specimens.Methods468 colorectal tumor samples from a large personalized medicine initiative were assessed by targeted gene sequencing of 1,321 individual genes. Eighteen patients produced genomic profiles for 17 paired primary:metastatic (and 2 metastatic:metastatic) specimens.ResultsAn average of 33.3 mutations/tumor were concordant (shared) between matched samples, including common well-known genes (APC, KRAS, TP53). An average of 2.3 mutations/tumor were discordant (unshared) among paired sites. KRAS mutational status was always concordant. The overall concordance rate for mutations was 93.5%; however, nearly all (18/19 (94.7%)) paired tumors showed at least one mutational discordance. Mutations were seen in: TTN, the largest gene (5 discordant pairs), ADAMTS20, APC, MACF1, RASA1, TP53, and WNT2 (2 discordant pairs), SMAD2, SMAD3, SMAD4, FBXW7, and 66 others (1 discordant pair).ConclusionsWhereas primary and metastatic tumors displayed little variance overall, co-evolution produced incremental mutations in both. These results suggest that while biopsy of the primary tumor alone is likely sufficient in the chemotherapy-naïve patient, additional biopsies of primary or metastatic disease may be necessary to precisely tailor therapy following chemotherapy resistance or insensitivity in order to adequately account for tumor evolution. 相似文献
5.
6.
Lydia Youmans Cynthia Taylor Edwin Shin Adrienne Harrell Angela E. Ellis Bernard Séguin Xinglai Ji Shaying Zhao 《PloS one》2012,7(12)
Sporadic canine colorectal cancers (CRCs) should make excellent models for studying the corresponding human cancers. To molecularly characterize canine CRC, we investigated exonic sequence mutations of adenomatous polyposis coli (APC), the best known tumor suppressor gene of human CRC, in 23 sporadic canine colorectal tumors, including 8 adenomas and 15 adenocarcinomas, via exon-resequencing analysis. As a comparison, we also performed the same sequencing analysis on 10 other genes, either located at human 5q22 (the same locus as APC) or 18q21 (also frequently altered in human CRC), or known to play a role in human carcinogenesis. We noted that APC was the most significantly mutated gene in both canine adenomas and adenocarcinomas among the 11 genes examined. Significantly, we detected large deletions of ≥10 bases, many clustered near the mutation cluster region, as well as single or two base deletions in ∼70% canine tumors of both subtypes. These observations indicate that like in the human, APC is also frequently altered in sporadic colorectal tumors in the dog and its alteration is an early event in canine colorectal tumorigenesis. Our study provides further evidence demonstrating the molecular similarity in pathogenesis between sporadic human and canine CRCs. This work, along with our previous copy number abnormality study, supports that sporadic canine CRCs are valid models of human CRCs at the molecular level. 相似文献
7.
Heather R. Shive Robert R. West Lisa J. Embree Champa D. Golden Dennis D. Hickstein 《PloS one》2014,9(1)
Germline mutations in the tumor suppressor genes BRCA2 and TP53 significantly influence human cancer risk, and cancers from humans who inherit one mutant allele for BRCA2 or TP53 often display loss of the wildtype allele. In addition, BRCA2-associated cancers often exhibit mutations in TP53. To determine the relationship between germline heterozygous mutation (haploinsufficiency) and somatic loss of heterozygosity (LOH) for BRCA2 and TP53 in carcinogenesis, we analyzed zebrafish with heritable mutations in these two genes. Tumor-bearing zebrafish were examined by histology, and normal and neoplastic tissues were collected by laser-capture microdissection for LOH analyses. Zebrafish on a heterozygous tp53M214K background had a high incidence of malignant tumors. The brca2Q658X mutation status determined both the incidence of LOH and the malignant tumor phenotype. LOH for tp53 occurred in the majority of malignant tumors from brca2 wildtype and heterozygous mutant zebrafish, and most of these were malignant peripheral nerve sheath tumors. Malignant tumors in zebrafish with heterozygous mutations in both brca2 and tp53 frequently displayed LOH for both genes. In contrast, LOH for tp53 was uncommon in malignant tumors from brca2 homozygotes, and these tumors were primarily undifferentiated sarcomas. Thus, carcinogenesis in zebrafish with combined mutations in tp53 and brca2 typically requires biallelic mutation or loss of at least one of these genes, and the specific combination of inherited mutations influences the development of LOH and the tumor phenotype. These results provide insight into cancer development associated with heritable BRCA2 and TP53 mutations. 相似文献
8.
G. N. Ranzani B. Renault N. S. Pellegata P. Fattorini E. Magni F. Bacci D. Amadori 《Human genetics》1993,92(3):244-249
In order to identify relevant genetic lesions in gastric carcinoma, we searched for tumor suppressor gene inactivation and K-ras gene mutations by analyzing tumor and control DNAs from 34 patients. These were from an epidemiologically defined area of Italy characterized by one of the world's highest incidences of stomach cancer. Allele losses were investigated by the Southern blotting procedure at 16 polymorphic loci on 11 different chromosomes. Our data demonstrate that chromosomal regions 5q, 11p, 17p and 18q are frequently deleted, and that 7q and 13q chromosome arms are also involved, although at a lower frequency. Loss of heterozygosity (LOH) at region 11p was not found during other surveys carried out on patients of different geographic origins. No specific combination of allelic losses could be recognized in the samples analyzed, the only exception being that tumors with 17p allelic loss also showed LOH on the 18q region. When matching frequent LOH events and the stage of progression of the tumors, we observed a trend of association between advanced stages and allelic losses on 17p and 18q chromosome arms. The analysis of K-ras, carried out by the polymerase chain reaction and denaturing gradient gel electrophoresis, demonstrated transforming mutations in only 3 out of 32 cases. Colorectal tumorigenesis proceeds by the accumulation of genetic alterations, including K-ras mutations and inactivation of tumor suppressor genes on the 5q, 17p and 18q regions. Our data indicate that, although gastric and colorectal neoplasias share common genetic alterations, they probably progress through different pathways. 相似文献
9.
10.
Gastrointestinal tumorigenesis in Smad4 (Dpc4) mutant mice 总被引:3,自引:0,他引:3
The SMAD4 (Dpc4) gene plays a key role in the TGF-beta signaling pathway. We recently inactivated the mouse homolog Smad4. The homozygous mutants were embryonic lethals, whereas the heterozygotes were viable and fertile. Although young heterozygotes were normal, old mice developed gastric and duodenal polyps similar to those found in human juvenile polyps characterized by abundant stroma and eosinophilic infiltrations. These data are consistent with the reports that a subset of human juvenile polyposis kindreds carry germline mutations in the SMAD4 gene. We then introduced the Smad4 mutation into the Apc delta 716 knockout mice, a model for human familial adenomatous polyposis. Because both Apc and Smad4 are located on mouse chromosome 18, we constructed by meiotic recombination, compound heterozygotes carrying both mutations on the same chromosome. In such mice, intestinal polyps developed into more malignant tumors than those in the simple Apc delta 716 heterozygotes, showing an extensive stromal cell proliferation and strong submucosal invasion. These results indicate that mutations in SMAD4 play a significant role in the malignant progression of colorectal tumors. 相似文献
11.
Xuejuan Jiang J. Esteban Castelao David Vandenberg Angel Carracedo Carmen M. Redondo David V. Conti Jesus P. Paredes Cotoré John D. Potter Polly A. Newcomb Michael N. Passarelli Mark A. Jenkins John L. Hopper Steven Gallinger Loic Le Marchand María E. Martínez Dennis J. Ahnen John A. Baron Noralane M. Lindor Robert W. Haile Manuela Gago-Dominguez 《PloS one》2013,8(4)
Background
Recent genome-wide studies identified a risk locus for colorectal cancer at 18q21, which maps to the SMAD7 gene. Our objective was to confirm the association between SMAD7 SNPs and colorectal cancer risk in the multi-center Colon Cancer Family Registry.Materials and Methods
23 tagging SNPs in the SMAD7 gene were genotyped among 1,592 population-based and 253 clinic-based families. The SNP-colorectal cancer associations were assessed in multivariable conditional logistic regression.Results
Among the population-based families, both SNPs rs12953717 (odds ratio, 1.29; 95% confidence interval, 1.12–1.49), and rs11874392 (odds ratio, 0.80; 95% confidence interval, 0.70–0.92) were associated with risk of colorectal cancer. These associations were similar among the population- and the clinic-based families, though they were significant only among the former. Marginally significant differences in the SNP-colorectal cancer associations were observed by use of nonsteroidal anti-inflammatory drugs, cigarette smoking, body mass index, and history of polyps.Conclusions
SMAD7 SNPs were associated with colorectal cancer risk in the Colon Cancer Family Registry. There was evidence suggesting that the association between rs12953717 and colorectal cancer risk may be modified by factors such as smoking and use of nonsteroidal anti-inflammatory drugs. 相似文献12.
13.
Role of Smad4 (DPC4) inactivation in human cancer 总被引:23,自引:0,他引:23
The tumor suppressor gene Smad4 (DPC4) at chromosome 18q21.1 belongs to the Smad family, which mediates the TGFbeta signaling pathway suppressing epithelial cell growth. This review summarizes the mutational events of the Smad4 gene in human cancer. The Smad4 gene is genetically responsible for familial juvenile polyposis, an autosomal dominant disease characterized by predisposition to gastrointestinal polyps and cancer. In this syndrome, polyps are formed by inactivation of the Smad4 gene through germline mutation and loss of the unaffected wild-type allele. In pancreatic and colorectal cancer, inactivation of the Smad4 gene through homozygous deletion or intragenic mutation occurs frequently in association with malignant progression. However, mutation of this gene is seen only occasionally in the rest of human cancers. The majority of Smad4 gene mutations in human cancer are missense, nonsense, and frameshift mutations at the mad homology 2 region (MH2), which interfere with the homo-oligomer formation of Smad4 protein and the hetero-oligomer formation between Smad4 and Smad2 proteins, resulting in disruption of TGFbeta signaling. Supporting evidence for the above observation was provided by genetically manipulated mice carrying either a heterozygote of the Smad4 gene or a compound heterozygote of the Smad4 and APC genes, which develop either gastrointestinal polyps/cancer mimicking familial juvenile polyposis or progressed colorectal cancer, respectively. 相似文献
14.
The SMAD4 gene plays a key role in the TGF-beta signaling pathway. We inactivated its mouse homolog Smad4. The homozygous mutants were embryonically lethal, whereas the heterozygotes were viable and fertile. Although young heterozygotes appeared normal, old mice developed gastric and duodenal polyps similar to human juvenile polyps characterized by abundant stroma and eosinophilic infiltrations. These data are consistent with the reports that a subset of human juvenile polyposis kindreds carry germline mutations in the SMAD4 gene. We then introduced the Smad4 mutation into the Apc(Delta716) knockout mice, a model for human familial adenomatous polyposis. Because both Apc and Smad4 are located on mouse chromosome 18, we constructed by meiotic recombination compound heterozygotes carrying both mutations on the same chromosome. In such mice, intestinal polyps developed into more malignant tumors than those in the simple Apc(Delta716) heterozygotes, showing an extensive stromal cell proliferation and strong submucosal invasion. These results indicate that mutations in SMAD4 play a significant role in the malignant progression of colorectal tumors. 相似文献
15.
U Lass A Nümann K von Eckardstein J Kiwit F Stockhammer JA Horaczek J Veelken C Herold-Mende J Jeuken A von Deimling W Mueller 《PloS one》2012,7(7):e41298
Background
To investigate the dynamics of inter- and intratumoral molecular alterations during tumor progression in recurrent gliomas.Methodology/Principal Findings
To address intertumoral heterogeneity we investigated non- microdissected tumor tissue of 106 gliomas representing 51 recurrent tumors. To address intratumoral heterogeneity a set of 16 gliomas representing 7 tumor pairs with at least one recurrence, and 4 single mixed gliomas were investigated by microdissection of distinct oligodendroglial and astrocytic tumor components. All tumors and tumor components were analyzed for allelic loss of 1p/19q (LOH 1p/19q), for TP53- mutations and for R132 mutations in the IDH1 gene. The investigation of non- microdissected tumor tissue revealed clonality in 75% (38/51). Aberrant molecular alterations upon recurrence were detected in 25% (13/51). 64% (9/14) of these were novel and associated with tumor progression. Loss of previously detected alterations was observed in 36% (5/14). One tumor pair (1/14; 7%) was significant for both. Intratumoral clonality was detected in 57% (4/7) of the microdissected tumor pairs and in 75% (3/4) of single microdissected tumors. 43% (3/7) of tumor pairs and one single tumor (25%) revealed intratumoral heterogeneity. While intratumoral heterogeneity affected both the TP53- mutational status and the LOH1p/19q status, all tumors with intratumoral heterogeneity shared the R132 IDH1- mutation as a common feature in both their microdissected components.Conclusions/Significance
The majority of recurrent gliomas are of monoclonal origin. However, the detection of divertive tumor cell clones in morphological distinct tumor components sharing IDH1- mutations as early event may provide insight into the tumorigenesis of true mixed gliomas. 相似文献16.
Jesús Sainz Karla Figueroa Michael E. Baser Stefan-Matthias Pulst 《Human genetics》1996,97(1):121-123
Vestibular schwannomas (VSs) are common benign tumors of Schwann cell origin and are frequently found in patients with neurofibromatosis type 2 (NF2). We analyzed 15 sporadic VSs for mutations in the NF2 gene. We detected mutations in three of the tumors, two of which contained loss of heterozygosity (LOH). One of the tumors contained a novel mutation, a 19-bp deletion in exon 4. The two other tumors contained an identical mutation, a complete exon 4 deletion. The exon 4 deletion represents the second most frequently reported mutation of the NF2 gene in VSs. 相似文献
17.
VLJ Whitehall TD Dumenil DM McKeone CE Bond ML Bettington RL Buttenshaw L Bowdler GW Montgomery LF Wockner BA Leggett 《Epigenetics》2014,9(11):1454-1460
The CpG Island Methylator Phenotype (CIMP) is fundamental to an important subset of colorectal cancer; however, its cause is unknown. CIMP is associated with microsatellite instability but is also found in BRAF mutant microsatellite stable cancers that are associated with poor prognosis. The isocitrate dehydrogenase 1 (IDH1) gene causes CIMP in glioma due to an activating mutation that produces the 2-hydroxyglutarate oncometabolite. We therefore examined IDH1 alteration as a potential cause of CIMP in colorectal cancer. The IDH1 mutational hotspot was screened in 86 CIMP-positive and 80 CIMP-negative cancers. The entire coding sequence was examined in 81 CIMP-positive colorectal cancers. Forty-seven cancers varying by CIMP-status and IDH1 mutation status were examined using Illumina 450K DNA methylation microarrays. The R132C IDH1 mutation was detected in 4/166 cancers. All IDH1 mutations were in CIMP cancers that were BRAF mutant and microsatellite stable (4/45, 8.9%). Unsupervised hierarchical cluster analysis identified an IDH1 mutation-like methylation signature in approximately half of the CIMP-positive cancers. IDH1 mutation appears to cause CIMP in a small proportion of BRAF mutant, microsatellite stable colorectal cancers. This study provides a precedent that a single gene mutation may cause CIMP in colorectal cancer, and that this will be associated with a specific epigenetic signature and clinicopathological features. 相似文献
18.
Le Anh Tuan Pham Trong Tue Nguyen Hoang Bich Nga Le Dat Quoc Tran Cam Tu Ho Thinh Huy Tran Van Thanh Ta The Hung Bui Van Khanh Tran 《Journal of genetics》2017,96(6):933-939
Wilson disease (WD) is an autosomal recessive disorder of copper metabolism. The gene responsible for WD was discovered in 1993 and is located on chromosome 13 at 13q14.3. It encodes a copper-specific transporting P-type ATPase. Early diagnosis can improve treatment outcome and decrease the rate of disability or even mortality. We used Sanger sequencing to identify mutation hot spots in 55 northern Vietnamese with a clinical diagnosis of WD. Mutations were screened and detected by direct DNA sequencing. A total of 26 different ATP7B gene mutations were identified, including seven novel mutations (five nonsense and two missense mutations). The most frequent mutations were p.Ser105Ter (24.55%), p.Arg778Leu (5.45%) and p.Thr850Ile (4.55%). Mutation detection rate in exon 2 was 34.55% and ranked first, followed by exon 8 with 16.36%, and exon 18 with 10.91% each, thus, exons 2, 8 and 18 are the mutation hot spots for northern Vietnamese WD patients. These findings were different from previous studies in Asia. Our research established a suitable strategy for ATP7B gene testing in northern Vietnamese WD patients. 相似文献
19.
Barbara K. Fortini Stephanie Tring Sarah J. Plummer Christopher K. Edlund Victor Moreno Robert S. Bresalier Elizabeth L. Barry Timothy R. Church Jane C. Figueiredo Graham Casey 《PloS one》2014,9(11)
Genome-wide association studies (GWAS) of colorectal cancer (CRC) have led to the identification of a number of common variants associated with modest risk. Several risk variants map within the vicinity of TGFβ/BMP signaling pathway genes, including rs4939827 within an intron of SMAD7 at 18q21.1. A previous study implicated a novel SNP (novel 1 or rs58920878) as a functional variant within an enhancer element in SMAD7 intron 4. In this study, we show that four SNPs including novel 1 (rs6507874, rs6507875, rs8085824, and rs58920878) in linkage disequilibrium (LD) with the index SNP rs4939827 demonstrate allele-specific enhancer effects in a large, multi-component enhancer of SMAD7. All four SNPs demonstrate allele-specific protein binding to nuclear extracts of CRC cell lines. Furthermore, some of the risk-associated alleles correlate with increased expression of SMAD7 in normal colon tissues. Finally, we show that the enhancer is responsive to BMP4 stimulation. Taken together, we propose that the associated CRC risk at 18q21.1 is due to four functional variants that regulate SMAD7 expression and potentially perturb a BMP negative feedback loop in TGFβ/BMP signaling pathways. 相似文献
20.
Barbara Jung Jessica Gomez Eddy Chau Jennifer Cabral Jeffrey K. Lee Aimee Anselm Przemyslaw Slowik Deena Ream-Robinson Karen Messer Judith Sporn Sung K. Shin C. Richard Boland Ajay Goel John M. Carethers 《PloS one》2009,4(12)