Spectroscopic studies on the interaction of Au(III) with nucleosides,nucleotides, and dimethyl phosphate

A series of complexes of Au(III) with nucleosides and nucleotides and their methyl derivatives in different stoichiometry have been prepared. Ultraviolet, visible, ir, and nmr studies have been performed to determine the site of binding of these ligands with the metal ion. In (1:4) Au(III): guanosine complex, N₇ is the binding site, whereas at 1:1 complex, a bidentate type of chelation through C₆O and N₇ is observed. C₆-NH₂ is favored over N₁ as coordinating site at all stoichiometry in the adenosine complex. Inosine binds through N₁ at r = 1. In cytidine, N₁ is the binding site, whereas thymidine reacts only at high pH. In the case of nucleotides a bidentate type of chelation through the phosphate and the ring nitrogen occurs. The phosphate binding ability of Au(III) was further confirmed by studying the interaction of Au(III) with dimethyl phosphate—a conformational analog of the phosphate backbone in DNA chain.     

Phosphate solubilisation and plant growth promoting potential by stress tolerant Bacillus sp. isolated from rhizosphere of apple orchards in trans Himalayan region of Himachal Pradesh

Phosphate‐solubilising ability and co‐production of plant growth promoting traits of stress tolerant Bacillus subtilis CB₈A isolated from apple rhizosphere was tested under in vitro conditions against a wide range of temperature (30–45°C), pH (7–9) and salt (0–5%) stresses. Under the extremes of temperature (45°C), pH‐9 and salt concentration (5%), production of soluble phosphate, indole acetic acid, siderophore and antifungal activity against Dematophora necatrix were reduced by 71.09%, 75.29%, 90.3% and 88.47%, respectively. Per cent decrease in P‐solubilisation at extreme temperature (45°C) and normal pH (7) without salt concentration was 36.23%; at extreme pH (9) and normal temperature (37°C) without salt concentration was 23.45% and at extreme salt concentration (5%), optimum temperature (37°C) and pH (7) was 36.7%. P‐solubilisation by CB₈A was inversely correlated with pH (r = ?0.78) and positively correlated with siderophore production (r = 0.81), indole acetic acid (r = 0.58) and antifungal activity (r = 0.63). Gluconic acid (1.43%) and citric acid (0.67%) were detected as major organic acids. P‐solubilisation and nitrogen fixing abilities of B. subtilis CB₈A were confirmed by amplification of gdh and nifH genes. The ability of CB8A showing plant growth promoting rhizobacteria (PGPR) traits at a wide range of temperature, pH and varying salt concentration can be exploited for developing multifunctional biofertiliser in apple orchards.     

Sensitivity of hydrogen bonds of DNA and RNA to hydration,as gauged by <Superscript>1</Superscript><Emphasis Type="Italic">J</Emphasis><Subscript>NH</Subscript> measurements in ethanol–water mixtures

Hydrogen-bond lengths of nucleic acids are (1) longer in DNA than in RNA, and (2) sequence dependent. The physicochemical basis for these variations in hydrogen-bond lengths is unknown, however. Here, the notion that hydration plays a significant role in nucleic acid hydrogen-bond lengths is tested. Watson–Crick N1...N3 hydrogen-bond lengths of several DNA and RNA duplexes are gauged using imino ¹ J _NH measurements, and ethanol is used as a cosolvent to lower water activity. We find that ¹ J _NH values of DNA and RNA become less negative with added ethanol, which suggests that mild dehydration reduces hydrogen-bond lengths even as the overall thermal stabilities of these duplexes decrease. The ¹ J _NH of DNA are increased in 8 mol% ethanol to those of RNA in water, which suggests that the greater hydration of DNA plays a significant role in its longer hydrogen bonds. The data also suggest that ethanol-induced dehydration is greater for the more hydrated G:C base pairs and thereby results in greater hydrogen-bond shortening than for the less hydrated A:T/U base pairs of DNA and RNA. Electronic Supplementary Material The online version of this article () contains supplementary material, which is available to authorized users.     

Purification and Properties of Cellulases from an Alkalophilic Streptomyces Strain

An alkalophilic Streptomyces strain, KSM-9, producing extracellular cellulases was isolated from soil. Three kinds of cellulases that preferentially hydrolyzed carboxymethylcellulose (CMC) were purified from the strain and designated as CMCase I, II and III. The optimum pH of CMCase I (M_r, 32,000) is 8.5 while those of CMCase II (M_r, 32,500) and III (M_r, 92,000) are at around pH 6.0. CMCase I hydrolyzed CMC in a more random fashion than the other two enzymes.     

Spectroscopic studies on the interaction mechanisms of safranin T with herring sperm DNA using acridine orange as a fluorescence probe

Under the condition of physiological pH environment (pH = 7.40), the interactions of safranin T (ST) with herring sperm DNA were studied by means of spectral methods using acridine orange (AO) as a fluorescence probe. The spectroscopic characteristics of DNA–AO in the case of ST (along with the increase of concentration) were observed in an aqueous medium. The binding constants for ST stranded DNA and competitive bindings of ST interacting with DNA–AO systems were examined by fluorescence spectra, and the binding mechanism of ST with DNA was researched via viscosity measurements. All the testimony manifested that bonding modes between ST and DNA were evidenced to be intercalative binding and electrostatic binding, and the combining constant of ST with DNA was obtained. The binding of ST to DNA was driven by entropy and enthalpy through the calculated thermodynamic parameters (Δ_rH_m^?, Δ_rS_m and Δ_rG_m^?). Copyright © 2014 John Wiley & Sons, Ltd.     

An amperometric uric acid biosensor based on multiwalled carbon nanotube-gold nanoparticle composite

An amperometric uric acid biosensor was fabricated by immobilizing uricase (EC 1.7.3.3) onto gold nanoparticle (AuNP)/multiwalled carbon nanotube (MWCNT) layer deposited on Au electrode via carbodiimide linkage. Determination of uric acid was performed by oxidation of enzymically generated H₂O₂ at 0.4 V. The sensor showed optimal response within 7 s at 40 °C in 50 mM Tris–HCl buffer (pH 7.5). The linear working range of the biosensor was 0.01–0.8 mM. The limit of detection (LOD) was 0.01 mM. The sensor measured uric acid levels in serum of healthy individuals and persons suffering from gout. The analytical recoveries of the added uric acid, 10 and 20 mg L^–1, were 98.0% and 96.5%, respectively. Within- and between-batch coefficients of variation were less than 5.6% and less than 4.7%, respectively. A good correlation (r = 0.998) was obtained between serum uric acid values by the standard enzymic colorimetric method and the current method. A number of serum substances had practically no interference. The sensor was used in more than 200 assays and had a storage life of 120 days at 4 °C.     

Gold complexes of purine and pyrimidine nucleosides

The reactions of chloroauric acid (HAuCl₄) with inosine=ino, guanosine=guo, triacetylinosine=trino, triacetylguanosine=trguo, and cytidine=cyd were studied. Complexes of Au(III) and Au(I) with these nucleosides have been isolated from reactions at different pH values in aqueous and in methanolic solutions. The Au(I) complexes were obtained by reducing Au(III) with 1-ascorbic acid in aqueous solutions. All the isolated complexes were characterized by elemental analyses, conductivity measurements, IR, ¹H nmr, and esr spectra. The Au(III) complexes correspond to the general formulae [Au(nucl)₂Cl₂] Cl, Au(nucl)Cl₃, and Au(nucl-H⁺)Cl₂, while the Au(I) complexes are of the Au(nucl)₂Cl type, where nucl represents the above nucleosides. In the complex with the composition [AucydCl₂]₂ that was isolated from aqueous solutions, the Au atom is believed to be in the (II) oxidation state.Possible structures for all the isolated complexes based on the experimental data are proposed and discussed.     

Spectrophotometric,potentiometric, and density gradient ultracentrifugation studies of the binding of silver ion by DNA

The equilibrium and the stoichiometry for the reversible complexing of silver ion by DNA have been studied by potentiometric titrations, proton release pH-stat titrations, and by spectrophotometry. The complexing reactions involve primarily the purine and pyrimidine residues, not the phosphate groups. There are at least three types of binding (types I, II, and III), of which the first two have been intensively studied in this work. The sum of type I and type II binding saturates at one silver atom per two nucleotide residues. In the type I and type II reactions, zero and one proton, respectively, are displaced per silver ion bound. At pH 5.6, the reactions occur stepwise, type I being first, while at pH 8.0, they occur simultaneously. The silver ion binding curve is very sharp at pH 8, indicating a cooperative reaction. The strength of the binding increases with increasing GC content. Type I binding is more important for GC-rich DNA's than for GC-poor ones. Denatured DNA binds more strongly than does native DNA. The silver ion complexing reaction is chemically and biologically reversible. We propose that type II binding essentially involves the conversion of an \documentclass{article}\pagestyle{empty}\begin{document}$ {\rm N} - {\rm H} \cdots {\rm N} $\end{document} hydrogen bond of a complementary base pair to an N—Ag—N bond. The nature of type I binding is less clear, but it may involve a π interaction with stacked bases. The buoyant density (ρ₀) of DNA in a Cs₂SO₄ density gradient increases when the DNA reacts with silver ion. The buoyant density change is about 0.15 g./ml. for 0.5 silver bound per nucleotide. The large buoyant density changes and the selective nature of the complexing reaction make it possible to perform good separations between native and denatured DNA or between GC-rich and GC-poor native DNA's by density gradient centrifugation.     

Comparison of the helix–coil conformational changes of poly(deoxyadenylate-deoxytymidylate) and poly(deoxyadenylate-deoxythymidylate) induced by variations of hydrogen-ion concentration

Double-helical poly(dG-dC) and poly(dA-dT) are DNA analogs in which the interactions between the two strands of the helix are, respectively, either the stronger G/C type or the weaker A/T type along the entire length of macromolecules. Thus, these synthetic polynucleotides can be considered as representatives of the most stable and the least stable DNA. In the investigations presented here, potentiometric titrations and stopped-flow kinetic experiments were carried out in order to compare the pH-induced helix–coil conformations (10°C and 150mM [Na⁺]) the pH of the helix–coil transition (pH_m) is 12.81 for poly(dG-dC) and 11.76 for poly(dA-dT). The unwinding of double-helical poly(dG-dC) initiated by a sudden change in pH was found to be a simple exponential process with rate constants in the range of 200–600 sec^?1, depending on the final value of the pH jump. The intramolecular double-helix formation of poly(dG-dC) was studied by lowering the pH of the solutions from a value above pH_m to that below pH_m in dilute solutions (15.5 ug/ml [polymer]). Under these conditions, the observed rewinding reactions displayed a major and two exponential phases, all of which were independent of polymer concentration. From the comparison of the results of poly(dA-dT) and poly(dG-dT) would unwind faster than poly(dG-dC). However, if the pH jumps are such that they present the same perturbation of these polymers relative to their pH_m values, no significant differences exist between the rates of helix–coil conformation changes of poly(dA-dT) and poly(dG-dC).     

Interaction between tryptophan‐Sm(III) complex and DNA with the use of a acridine orange dye fluorophor probe

The interaction of the Trp–Sm(III) complex with herring sperm DNA (hs‐DNA) was investigated with the use of acridine orange (AO) dye as a spectral probe for UV‐vis spectrophotometry and fluorescence spectroscopy. The results showed that the both the Trp–Sm(III) complex and the AO molecule could intercalate into the double helix of the DNA. The Sm(III)–(Trp)₃ complex was stabilized by intercalation into the DNA with binding constants: K^?_25°C = 7.14 × 10⁵ L·mol^?1 and K^?_37°C = 5.28 × 10⁴ L·mol^?1, and it could displace the AO dye from the AO–DNA complex in a competitive reaction. Computation of the thermodynamic functions demonstrates that Δ_rH_m^? is the primary driving power of the interaction between the Sm(III)(Trp)₃ complex and the DNA. The results from Scatchard and viscometry methods suggested that the interaction mode between the Sm(III)(Trp)₃ complex and the hs‐DNA is groove binding and weak intercalation binding. Copyright © 2015 John Wiley & Sons, Ltd.     

Fine structure physical mapping of 4S RNA genes on mitochondrial DNA of Saccharomyces cerevisiae.

Summary We have localized the genes for mitochondrial 4S RNA on the physical map of themtDNA of severalSaccharomyces cerevisiae strains by hybridization of iodinated 4S RNA to the restriction fragments obtained with endonucleasesHindII+III,EcoRI andHapII. The data indicate that 5–8 of the 4S RNA genes are dispersed over a large area of the genome whereas the rest (about 18 genes) is located within an area of about 9000 bp in length (about 12% of the genome) between the markers for chloramphenicol and paromomycin resistance (RIB 1 and PAR 1 loci). Within this region a cluster is present of 5 genes on a DNA fragment of 460 bp.Abbreviations Used mtDNA mitochondrial DNA - mtRNA mitochondrial RNA - rRNA ribosomal RNA - tRNA transfer RNA - C, E, P and O cytoplasmically-inherited resistance markers for chloramphenicol, erythromycin, paromomycin and oligomycin, respectively - SSC 150 mM sodium chloride, 15 mM sodium citrate (pH 7.0) - SDS sodium dodecylsulphate - EDTA (sodium)ethylenediaminetetraacetate; TEMED - N,N,N N-tetramethylethylenediamine; (k)bp, (kilo)base pairs - EthBr ethidium bromide     

Reactive derivatives of oligonucleotide phosphorothioate analogues: IV. Site-directed modification of nucleic acids and intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH₃)CH₂(RCl)(II-PS) and (RCl)CH₂N(CH₃)pGpsCpsAps TpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl=C₆H₄N(CH₃)(CH₂CH₂Cl) at the 3′- or 5′-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (att→∞) at 20°C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH₃)CH₂(RCl)(II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex. For Part III, see [1].     

MARINICHLORELLA KAISTIAE GEN. ET SP. NOV. (TREBOUXIOPHYCEAE,CHLOROPHYTA) BASED ON POLYPHASIC TAXONOMY1

We describe three coccoid green algal strains belonging to a new genus and species, Marinichlorella kaistiae Z. Aslam, W. Shin, M. K. Kim, W.‐T. Im et S.‐T. Lee, in seawater samples from the South Sea of Korea. These strains were maintained at 25°C–30°C under a 12:12 light:dark (L:D) photoregime in an ASN‐III medium at a pH of 7.5. These strains were tolerant of high salinity (7.5% NaCl) (w/v) and temperature (40°C). Molecular phylogenetic analyses using 18S rRNA gene sequence data resolved these organisms to a clade separate from green coccoid algae with similar morphology. The DNA–DNA hybridization results demonstrated very low relatedness of these organisms to phylogenetically related species of the genera Chlorella and Parachlorella. The molar guanine + cytosine content (G + C mol%) of the genomic DNA of these organisms ranged from 64.7 to 69.1 mol%. Based on molecular phylogeny, DNA–DNA hybridization, and other morphological studies, we propose a new taxon, Marinichlorella kaistiae, to describe these strains and classify them in the family Chlorellaceae. The type strain is KAS007^T (= KCTC AG10303^T = IAM C‐620^T).     

Atp-Dependent gold accumulation by living chlorella cells

An effect of the Au(III) energy dependent concentration has been discovered by living Chlorella cells. The process is most intensive within the alkaline interval of pH, fading away in the dark, and is suppressed in the presence of arsenate (C ≧ 1 μM), fluorides (C ≧ 0.01 mM), sodium azide (1 mM), DCCD (10 μM), 2, 4-dinitrophenol (0.1 mM). In the dark the process is stimulated by ATP (but not by ADP, or AMP). ATP also neutralizes NaN₃ effect, but not that of DNP. An energy dependent Au(III) concentration is also observed for other green, blue-green, and, red singlecell algae.     

A polynucleotide CD probe: interactions with oligomers of a polycationic amine that exhibit positive extrinsic bands at greater than 300 nm

A set of large positive extrinsic CD bands ([θ]₃₃₃ = 2.6 X 10⁴ deg-cm²/decimole phosphate) in the > 300 nm region as well as diminution of the intrinsic signals (θ₂₇₅) have been observed in the CD spectra of various nucleic acids complexed with the achiral compound, N-poly{α-[N-(4-pyridylethylene-4-pyridyl-N′-)α′-p-xylyl]dibromide}-4-pyridylethylene-4-pyridinium bromide, (polymer X).^1,2,5 The signal changes are attributed to the binding of polymer X chromophores isogeometrically to the DNA helix in an ordered chiral arrangement. Fractionation of polymer X gives 10 well-separated oligomers. The oligomers were characterized by nmr. Their interactions with DNA have been investigated with respect to r(r = ratio of equivalents of polymer X charge/g-atoms DNA phosphorus) and n (oligomer chain length). In all cases where n ≥ 1, [θ]₃₃₃ increases linearly with increasing r between 0 and 0.32, and is accompanied by a corresponding decrease in [θ]₂₇₅, which becomes negative as r approaches .32. Extrinsic band intensities reveal a dependence on n up to n = 5, above which increases in nonspecific binding result in a reduction in normalized band intensities. Polymer X shows a strong preference for B-form nucleic acids and induces maximum extrinsic CD signal intensities with A-T homopolymers. Alterations in helix hydration are believed to accompany complex formation. Inversions in [θ]₂₇₅ of the octamer X-poly(dA-dT) complex have been attributed to the “alternating B” conformation of poly(dA-dT).³ Similar inversions are not observed in other nucleic acid-octamer X complexes. Visible and CD spectrometry data from competition studies in the presence of the antibiotics actinomycin D (AMD), daunomycin (DM), and distamycin A (DST) are consistent with “nonclassical” intercalation as the mode of binding, and these data place the potential binding site in or near the hydrophobic region of the minor groove. Reductions in [θ]₃₃₃ with increasing urea further implicate the involvement of hydrophobic interactions in the formation of an asymmetric complex. Stabilization of the helix results in all cases as evidenced by alterations in T_m; corresponding changes, however, in cooperativity are not clearly discernable. Viscosity and light-scattering data indicate no changes in molecular weight due to aggregation, and as such are not consistent with a transition to the ψ-DNA upon complex formation.     

DNA-Carbohydrate Interaction. The Effects of Mono- and Disaccharides on the Solution Structure of Calf-Thymus DNA

Abstract

We report the interaction of calf-thymus DNA with D-glucose, D-fructose, D-galactose and sucrose in aqueous solution at physiological pH with sugar/DNA(P)(P=phosphate) molar ratios (r) of 1/10,1/5,1,5 and 10. FTIR difference spectroscopy was used to characterize the nature of sugar-DNA interaction and correlations between spectral changes and structural variations for both sugar and DNA complexes have been established.

FTIR difference spectroscopic results showed major sugar interaction (H-bonding) with the P0₂ groups of the backbone at low sugar concentrations (r= 1/10 and 1/5). Such interaction was characterized by the shift and the intensity variations of the backbone P0₂ antisymmetric stretch at 1222 cm^?1, which resulted in a major helical stability of DNA duplex. As sugar concentration increased, carbohydrate binding to DNA bases occurred. Evidence for this comes from major shiftings of the sugar O-H stretching vibrations at 3500–3200 cm^?1, and sugar C-O stretches and OH bending modes at 1450–1000 cm”. Similarly, shifting and intensity variations of several DNA in-plane vibrations at 1717 (G,T), 1663 (T,G,A,C) and 1492 cm^?1 (C,G) were observed, that are characterized by the presence of sugar-base interaction (via H₂0). The shiftings and the intensity changes of the sugar OH stretching modes at 35003200 cm^?1 are also indicative of the rearrangements of the sugar intermolecular H-bonding network, on DNA complex formation. A partial B to A conformational transition was observed for DNA molecule on sugar complexation, whereas carbohydrate binding occurred via both a- and β-anomeric structures.     

Nitrogen use efficiency of sugarcane in relation to its BNF potential and population of endophytic diazotrophs at different N levels

The nitrogen fixing bacterial endophytes Gluconacetobacter diazotrophicus and Herbaspirillum spp. have been proposed to benefit sugarcane (Saccaharum spp. hybrids) growth. Variable populations of these endophytes exist depending upon ontogenic and climatic variations as well. This study investigates the effect of variable chemical nitrogen application in soil on the population of endophytic diazotrophs, acetylene reduction ability of excised roots, plant N-nutrient use efficiency and probable interactions among different parameters in eight commercial sugarcane varieties of subtropical India. Recovery efficiency (RE), agronomic efficiency (AE), partial factor productivity (PFP) and physiologic efficiency (PE) indicators were used for accounting N-nutrient use efficiency. The population of G. diazotrophicus was more at N₇₅ compared to N₀ and N₁₅₀, whereas Herbaspirillum population increased from N₀ to N₁₅₀. ARA was positively correlated with Gluconacetobacter population in rhizosphere and root, whereas it had poor correlation with Herbaspirillum population. Positive correlation of RE and AE with ARA of roots, Gluconacetobacter and Herbaspirillum populations in roots and stems indicate their positive contribution in total nitrogen uptake by the plant per kg of N applied. Average PFP was 808.9 at N₇₅ compared to 408.7 at N₁₅₀ indicating that N was utilized efficiently at low N input status in sugarcane. Strong positive correlations of AE₇₅ (agronomic efficiency from 75 kg N ha⁻¹ to 150 kg N ha⁻¹) with N-uptake (r ² = 0.615), cane yield (r ² = 0.758) and PFP (r ² = 0.758) and other parameters compared to AE (agronomic efficiency from 0 kg N ha⁻¹ to 75 kg N ha⁻¹ or 150 kg N ha⁻¹) correlations with N-uptake (r ² = 0.111), cane yield (r ² = 0.368) and PFP (r ² = 0.190) indicated that the AE of sugarcane was strongly directed towards producing more cane yield per unit of N fertilizer once the sugarcane plant has established using initial dose of nitrogen and thus AE₇₅ seems to be a more appropriate indicator for accounting N-nutrient use efficiency in sugarcane.     

A Theoretical Model for the Binding of Cis-Pt(NH3)2 +2 to DNA

Abstract

The binding of cis-Pt(NH₃)₂B₁B2 to the bases B₁ and B₂, i.e., guanine (G), cytosine (C), adenine (A), and thymine (T), of DNA is studied theoretically. The components of the binding are analyzed and a model structure is proposed for the intrastrand binding to the dB,pdB₂ sequence of a kinked double helical DNA. Quantum mechanical calculations of the ligand binding energy indicates that cw-Pt(NH₃)₂ ⁺² (cis-PDA) binds to N7(G), N3(C), 02(C), 06(G), N3(A), N7(A), 04(T) and 02(T) in order of decreasing binding energy. Conformational analysis provides structures of kinked DNA in which adjacent bases chelate to cis-PDA. Only bending toward the major groove allows the construction of acceptable square planar complexes. Examples are presented for kinks of ?70° and ?40° at the receptor site to orient the base pairs for ligand binding to B, and B₂ to form a nearly square planar complex. The energies for complex formation of cis-PDA to the various intra-strand base sites in double stranded DNA are estimated. At least 32 kcal/mole separates the energetically favorable dGpdG·cis-PDA chelate from the dCpdG·cis-PDA chelate. All other possible chelate structures are much higher in energy which correlates with their lack of observation in competition with the preferred dGpdG chelate.

The second most favorable ligand energy occurs with N3(C). A novel binding site involving dC(N3)pdG(N7) is examined. Denaturation can result in an anti ? syn rotation of C about its glycosidic bond to place N3(C) in the major groove for intrastrand binding in duplex DNA. This novel intrastrand dCpdG complex and the most favored dGpdG structure are illustrated with stereographic projections.     

Formation of Au(III)-DNA Coordinate Complex by Laser Ablation of Au Nanoparticles in Solution

We discovered that an Au(III)-DNA coordinate complex, Au(III)(DNA-base)₂(amine)l, are formed by laser ablation of Au nanoparticles in an aqueous solution containing DNA molecules in the presence of amines and multi-valent cations, where l represents an unknown ligand (either amine or water). Optical absorption spectrum of the solution after laser ablation exhibited a 360 nm absorption peak assigned to ligand→Au(III) charge transfer (LMCT) band of the coordinate complex. The complex is considered to be formed as follows: 1) the DNA molecules are neutralized by binding the multi-valent cations to their negatively charged phosphate groups, and adsorbed on the surface of the Au nanoparticles by a hydrophobic interaction, 2) Au(III) ions are liberated from the Au nanoparticles by laser ablation, and 3) an Au(III) ion reacts with amine and two DNA bases of a DNA molecule into an Au(III)(DNA-base)₂(amine)l.