Primary and secondary structure of rat 28 S ribosomal RNA.

The primary structure of rat (Rattus norvegicus) 28 S rRNA is determined inferred from the sequence of cloned rDNA fragments. The rat 28 S rRNA contains 4802 nucleotides and has an estimated relative molecular mass (Mr, Na-salt) of 1.66 X 10(6). Several regions of high sequence homology with S. cerevisiae 25 S rRNA are present. These regions can be folded in characteristic base-paired structures homologous to those proposed for Saccharomyces and E. coli. The excess of about 1400 nucleotides in the rat 28 S rRNA (as compared to Saccharomyces 25 S rRNA) is accounted for mainly by the presence of eight distinct G+C-rich segments of different length inserted within the regions of high sequence homology. The G+C content of the four insertions, containing more than 200 nucleotides, is in the range of 78 to 85 percent. All G+C-rich segments appear to form strongly base-paired structures. The two largest G+C-rich segments (about 760 and 560 nucleotides, respectively) are located near the 5'-end and in the middle of the 28 S rRNA molecule. These two segments can be folded into long base-paired structures, corresponding to the ones observed previously by electron microscopy of partly denatured 28 S rRNA molecules.     

The complete nucleotide sequence of a rice 25S.rRNA gene

The complete nucleotide (nt) sequence of a rice nuclear 25S.rRNA gene has been determined. The 25S.rRNA-coding region is 3377 bp long. The G + C content is 59.4%. The structural organization of this rRNA is very similar to that of yeast 26S rRNA.     

The structure of the yeast ribosomal RNA genes. I. The complete nucleotide sequence of the 18S ribosomal RNA gene from Saccharomyces cerevisiae.

The cloned 18 S ribosomal RNA gene from Saccharomyces cerevisiae have been sequenced, using the Maxam-Gilbert procedure. From this data the complete sequence of 1789 nucleotides of the 18 S RNA was deduced. Extensive homology with many eucaryotic as well as E. coli ribosomal small subunit rRNA (S-rRNA) has been observed in the 3'-end region of the rRNA molecule. Comparison of the yeast 18 S rRNA sequences with partial sequence data, available for rRNAs of the other eucaryotes provides strong evidence that a substantial portion of the 18 S RNA sequence has been conserved in evolution.     

Structural analyses of mammalian ribosomal ribonucleic acid and its precursors. Nucleotide sequence of ribosomal 5.8 S ribonucleic acid.

The nucleotide sequence of ribosomal 5.8 S RNA (also known as 7 S or 5.5 S rRNA) from Novikoff hepatoma ascites cells has been determined to be (see article). Estimations of the secondary structure based upon maximized base pairing and the fragments of partial ribonuclease digestion indicate that there may be five base-paired regions in the molecule, three forming a folding of the termini and two forming secondary hairpin loops. The sequence of Novikoff hepatoma 5.8 S rRNA is about 75% homologous with that of yeast 5.8 S rRNA (Rubin, G.M. (1973) J. Biol. Chem. 248, 3860-3875) and similar models for secondary structure are proposed. Both models contain a very stable G-C rich hairpin loop (residues 116 to 138), a less stable A-U-rich hairpin loop (residues 64 to 91) and two symmetrical bulges (residues 15 to 25 and 40 to 44).     

The longest 18S ribosomal RNA ever known. Nucleotide sequence and presumed secondary structure of the 18S rRNA of the pea aphid, Acyrthosiphon pisum.

An EMBL4 recombinant phage which encodes one of the full length of the aphid ribosomal DNA has been isolated from the aphid genomic library. Determination of the complete nucleotide sequence of the aphid 18S rRNA gene revealed that it is 2469 bp with a G + C content of 59%. The aphid 18S rRNA gene studied here is the longest and has the highest G + C content among the 18S rRNA genes examined so far. Evidence provided by the S1 nuclease assay suggests that the aphid 18S rRNA gene examined in this study is not a pseudogene containing an insertion sequence. Based on the nucleotide sequence of the 18S rRNA gene, we constructed a presumed secondary-structure model of the aphid 18S rRNA. In the aphid 18S rRNA, the eucaryote-specific E21 and 41 region are supposed to be longer and more complex than the counterparts of other 18S rRNA.     

Nucleotide sequence and thermal property of 5S rRNA from the elder aphid. Acyrthosiphon magnoliae.

The nucleotide sequence of 5S rRNA from the elder aphid. Acyrthosiphon magnoliae was determined by using postlabeling sequencing techniques. The aphid 5S rRNA consists of 120 nucleotides and the sequence differs from those of Bombyx and Drosophila 5S rRNAs in 14 and 16 positions, respectively. A secondary structure model based on the sequence has two distinctive features : the helix I is shorter and the total free energy lower. Judging from the thermal profile, the aphid 5S rRNA likely assumes a conformation somewhat different from those of the other two insects.     

Nucleotide sequence of a Euglena gracilis chloroplast gene coding for the 16S rRNA: homologies to E. coli and Zea mays chloroplast 16S rRNA

The nucleotide sequence of 16S rDNA from Euglena gracilis chloroplasts has been determined representing the first complete sequence of an algal chloroplast rRNA gene. The structural part of the 16S rRNA gene has 1491 nucleotides according to a comparative analysis of our sequencing results with the published 5'- and 3'-terminal "T1-oligonucleotides" from 16S rRNA from E. gracilis. Alignment with 16S rDNA from Zea mays chloroplasts and E. coli reveals 80 to 72% sequence homology, respectively. Two deletions of 9 and 23 nucleotides are found which are identical in size and position with deletions observed in 16S rDNA of maize and tobacco chloroplasts and which seem to be characteristic for all chloroplast rRNA species. We also find insertions and deletions in E. gracilis not seen in 16S rDNA of higher plant chloroplasts. The 16S rRNA sequence of E. gracilis chloroplasts can be folded by base pairing according to the general 16S rRNA secondary structure model.     

The solution structure of the loop E region of the 5S rRNA from spinach chloroplasts

A structure has been obtained for the loop E region of the 5S rRNA from Spinacia oleracia chloroplast ribosomes using residual dipolar coupling data as well as NOE, J coupling and chemical shift information. Even though the loop E sequence of this chloroplast 5S rRNA differs from that of Escherichia coli loop E at approximately 40% of its positions, its conformation is remarkably similar to that of E.coli loop E. Consistent with this conclusion, ribosomal protein L25 from E.coli, which binds to the loop E region of both intact E.coli 5S rRNA and to oligonucleotides containing that sequence, also binds to the chloroplast-derived oligonucleotide discussed here.     

The structure of rat 28S ribosomal ribonucleic acid inferred from the sequence of nucleotides in a gene.

The nucleotide sequence of a rat 28S rRNA gene was determined. The 28S rRNA encoded in the gene contains 4718 nucleotides and the molecular weight estimated from the sequence is 1.53 x 10(6). The guanine and cytosine content is 67%. The sequence of rat 28S rRNA diverges appreciably from that of Saccharomyces carlsbergensis 26S rRNA (about 50% identity), but more closely approximates that of Xenopus laevis 28S rRNA (about 75% identity). Rat 28S rRNA is larger than the analogous nucleic acids from yeast (3393 nucleotides) and X, laevis (4110 nucleotides) ribosomes. The additional bases are inserted in specific regions and tend to be rich in guanine and cytosine. 5.8S rRNA can interact with 28S rRNA by extensive hydrogen bonding at two sites near the 5' end of the latter.     

Sequence and secondary structure of mouse 28S rRNA 5''terminal domain. Organisation of the 5.8S-28S rRNA complex.

We present the sequence of the 5' terminal 585 nucleotides of mouse 28S rRNA as inferred from the DNA sequence of a cloned gene fragment. The comparison of mouse 28S rRNA sequence with its yeast homolog, the only known complete sequence of eukaryotic nucleus-encoded large rRNA (see ref. 1, 2) reveals the strong conservation of two large stretches which are interspersed with completely divergent sequences. These two blocks of homology span the two segments which have been recently proposed to participate directly in the 5.8S-large rRNA complex in yeast (see ref. 1) through base-pairing with both termini of 5.8S rRNA. The validity of the proposed structural model for 5.8S-28S rRNA complex in eukaryotes is strongly supported by comparative analysis of mouse and yeast sequences: despite a number of mutations in 28S and 5.8S rRNA sequences in interacting regions, the secondary structure that can be proposed for mouse complex is perfectly identical with yeast's, with all the 41 base-pairings between the two molecules maintained through 11 pairs of compensatory base changes. The other regions of the mouse 28S rRNA 5'terminal domain, which have extensively diverged in primary sequence, can nevertheless be folded in a secondary structure pattern highly reminiscent of their yeast' homolog. A minor revision is proposed for mouse 5.8S rRNA sequence.     

Sequence of the 3''-terminal 21 nucleotides of yeast 17S ribosomal RNA.

The sequence of the 3'-terminal 21 nucleotides of 17S ribosomal RNA from the yeast Saccharomyces carlsbergensis has been determined to be (Y)G-m62A-m62A-C-U-C-G-C-G-G-A-A-G-G-A-U-C-A-U-U-AOH. This sequence shows extensive homology with the 3'-terminal sequence of 16S rRNA from Escherichia coli including the presence of the two adjacent N6-,N6-dimethyladenosines observed in the small subunit rRNA of eukaryotes as well as of many prokaryotes.     

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.     

Tandemly arranged variant 5S ribosomal RNA genes in the yeast Saccharomyces cerevisiae.

Most of the ribosomal RNA genes of the yeast Saccharomyces cerevisiae are about 9 kilobases (kb) in size and encode both the 35S rRNA (processed to produce the 25S, 18S, and 5.8S species) and 5S rRNA. These genes are arranged in a single tandem array of 100 repeats. Below, we present evidence that at the centromere-distal end of this array is a tandem arrangement of a different type of rRNA gene. Each of these repeats is 3.6 kb in length and encodes a single 5S rRNA. The coding sequence of this gene is different from that of the "normal" 5S gene in three positions located at the 3' end of the gene.     

Sequence and variability of the 5.8S and 26S rRNA genes of Pneumocystis carinii.

The sequence of the coding region of the rRNA operon of rat-derived Pneumocystis carinii has been completed, including the genes for 5.8S and 26S rRNA. These genes show homology to the rRNA genes of yeast, and an apparent group I self-splicing intron is present in the 26S rRNA gene. Like a similar intron in the 16S rRNA gene, this intron is in a phylogenetically conserved region. Variation in the 26S rRNA sequence was noted between P. carinii organisms isolated from two different sources.     

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data.