Genetic Analysis, Using P22 Challenge Phage, of the Nitrogen Activator Protein DNA-Binding Site in the Klebsiella aerogenes put Operon

The nac gene product is a LysR regulatory protein required for nitrogen regulation of several operons from Klebsiella aerogenes and Escherichia coli. We used P22 challenge phage carrying the put control region from K. aerogenes to identify the nucleotide residues important for nitrogen assimilation control protein (NAC) binding in vivo. Mutations in an asymmetric 30-bp region prevented DNA binding by NAC. Gel retardation experiments confirmed that NAC specifically binds to this sequence in vitro, but NAC does not bind to the corresponding region from the put operon of Salmonella typhimurium, which is not regulated by NAC.     

Nitrogen regulation system of Klebsiella aerogenes: the nac gene.

In Klebsiella aerogenes, the product of a his-linked gene, nac, appears to play a crucial role in tying the synthesis of enzymes activated or repressed by ammonia deprivation, such as histidase and glutamate dehydrogenase, to the known regulators of nitrogen assimilation, the products of glnG and glnF.     

Conservation and DNA sequence arrangement of the DNA polymerase I gene region from Klebsiella aerogenes, Klebsiella pneumoniae and Escherichia coli

Linked multiple mutation is observed after treatment of Escherichia coli with methyl methanesulfonate, N-methyl-N′-nitro-N-nitrosoguanidine, ethyl methanesulfonate, and N-ethyl-N-nitro-N-nitrosoguanidine but not ultraviolet light. Induction of linked multiple mutations requires the uvrE⁺ gene product indicating the involvement of the mismatch repair system. The observation of linked multiple mutations is not due to mutagenesis occurring in a subpopulation of cells. Growing point mutagenesis also occurs after treatment with these mutagens but not with ultraviolet light. It is likely that the excess of mutations observed with these mutagens at growing points is at least partly a relative effect, rather than one due to an absolute increase of reactivity at the DNA growing point region. This relative effect may result from the operation of an inducible repair mechanism which removes O⁶-alkylguanine residues from the DNA distal to the bacterial growing point. The adaptive response, first described by Robins &; Cairns (1979) prefers O⁶-methylguanine over O⁶-ethylguanine.     

Isolation of Klebsiella aerogenes mutants cis-dominant for glutamine synthetase expression

We have isolated three strains of Klebsiella aerogenes that failed to show repression of glutamine synthetase even when grown under the most repressing conditions for the wild-type strain. These mutant strains were selected as glutamine-independent derivatives of a strain that is merodiploid for the glnA region and contains a mutated glnF allele. The mutation responsible for the Gln+ phenotype in each strain was tightly linked to glnA, the structural gene for glutamine synthetase, and was dominant to the wild-type allele. These mutations are probably lesions in the control region of the glnA gene, since each mutation was cis-dominant for constitutive expression of the enzyme in hybrid merodiploid strains. Strains harboring this class of mutations were unable to produce a high level of glutamine synthetase unless they also contained an intact glnF gene, and unless cells were grown in derepressing medium. This study supports the idea that the glnA gene is regulated both positively and negatively, and that the deoxyribonucleic acid sites critical for positive control and negative control are functionally distinct.     

Labelling of the cyclitol permease in Klebsiella aerogenes.

The protein component(s) of the cyclitol-transport system in Klebsiella aerogenes has been labelled by using three different procedures. One method is based on differential alkylation with N-ethylmaleimide, and another on incorporation of amino acids during the induction process. A protein of mol.wt. 34 000 was labelled by both procedures; by alkylation with N-ethylmaleimide two other proteins of mol.wts. 55 000 and 67 000 were also labelled. The third uses diazotized [35S]sulphanilic acid after protection by substrate and the comparison of labelling of induced cells with non-induced cells; the label was also concentrated in a mol.wt.-33 000 peak. The labelled protein is, from the evidence, the cyclitol carrier.     

Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.     

Identification of the structural gene for glutamine synthetase in Klebsiella aerogenes.

Mutations at two sites of the Klebsiella aerogenes chromosome, unlinked by transduction with phages PW52 and P1, result in the lack of enzymatically active glutamine synthetase. A mutation in the glnB site leads to a marked decrease in the formation of an apparently normal enzyme. Some of the mutations in the glnA site lead to the production of enzymatically inactive material capable of reacting with anti-glutamine synthetase serum. The revertant of a glnA mutant was found to produce a glutamine synthetase with less activity and less stability to heat than the enzyme of the wild type. These results locate the structural gene to the production of enzymatically inactive glutamine synthetase antigen, not subject to repression by exogenously added ammonia. This observation suggests that glutamine synthetase is itself involved in the regulation of the synthesis of glutamine synthetase.