Structure and expression of the human gene encoding major heat shock protein HSP70.

We have cloned a human gene encoding the 70,000-dalton heat shock protein (HSP70) from a human genomic library, using the Drosophila HSP70 gene as a heterologous hybridization probe. The human recombinant clone hybridized to a 2.6-kilobase polyadenylated mRNA from HeLa cells exposed to 43 degrees C for 2 h. The 2.6-kilobase mRNA was shown to direct the translation in vitro of a 70,000-dalton protein similar in electrophoretic mobility to the HSP70 synthesized in vivo. From the analysis of S1 nuclease-resistant mRNA-DNA hybrids, the HSP70 gene appears to be transcribed as an uninterrupted mRNA of 2.3 kilobases. We show that the cloned HSP70 gene contains the sequences necessary for heat shock-induced expression by two criteria. First, hamster cells transfected with a subclone containing the HSP70 gene and flanking sequences synthesized a HSP70-like protein upon heat shock. Second, human cells transfected with a chimeric gene containing the 5' flanking sequences of the HSP70 gene and the coding sequences of the bacterial chloramphenicol acetyltransferase gene transcribed the chimeric gene upon heat shock. We show that the HSP70 mRNA transcribed in an adenovirus 5 transformed human cell line (293 cells) is identical to the HSP70 mRNA induced by heat shock.     

The heat shock consensus sequence is not sufficient for hsp70 gene expression in Drosophila melanogaster.

A hybrid gene in which the expression of an Escherichia coli beta-galactosidase gene was placed under the control of a Drosophila melanogaster 70,000-dalton heat shock protein (hsp70) gene promoter was constructed. Mutant derivatives of this hybrid gene which contained promoter sequences of different lengths were prepared, and their heat-induced expression was examined in D. melanogaster and COS-1 (African green monkey kidney) cells. Mutants with 5' nontranscribed sequences of at least 90 and up to 1,140 base pairs were expressed strongly in both cell types. Mutants with shorter 5' extensions (of at least 63 base pairs) were transcribed and translated efficiently in COS-1 but not at all in D. melanogaster cells. Thus, in contrast to the situation in COS-1 cells, the previously defined heat shock consensus sequence which is located between nucleotides 62 and 48 of the hsp70 gene 5' nontranscribed DNA segment is not sufficient for the expression of the D. melanogaster gene in homologous cells. A second consensus-like element 69 to 85 nucleotides upstream from the cap site is postulated to be also involved in the heat-induced expression of the hsp70 gene in D. melanogaster cells.     

Stable transformation of Drosophila Kc cells to antibiotic resistance with the bacterial neomycin resistance gene

By transfection with a plasmid containing the APH(3') gene under control of the HSV I thymidine kinase promoter, independent series of stably transformed Drosophila cells were established and grown for more than one and a half years under highly selective pressure (2 mg G 418/ml). Analysis of transformed Drosophila cell DNAs shows that the APH(3') gene was integrated into the genome. Neomycin phosphotransferase is constitutively expressed in transformed cells. This efficient selective system by a dominant marker makes it possible to introduce, by cotransfection, any DNA sequence of interest into the genome of cultured Drosophila cells.     

Cloning and characterization of a phosphate-regulated promoter involved in phosphate control of candicidin biosynthesis

Phosphate strongly repressed the formation of p-aminobenzoic acid (PABA) synthase, an enzyme involved in candicidin biosynthesis. Expression in Streptomyces lividans of the pabS gene (encoding PABA synthase) of Streptomyces griseus is repressed by phosphate at concentrations above 0.1 mM. However, expression of the pabS gene in Escherichia coli is not regulated by phosphate. Phosphate control of the expression of the pabS gene was observed in all plasmids containing the original 4.5-kb BamHI fragment, whereas no phosphate regulation was found when an upstream 1-kb fragment that carries the pabS promoter was deleted. Using the promoter-probe plasmid pIJ424, a '114-bp' promoter was cloned. Expression of the promoterless kanamycin phosphotransferase gene when fused to the '114-bp' promoter was strongly reduced by phosphate (90% at 5 mM concentration). The '114-bp' promoter has been sequenced and the first transcribed nucleotide identified by S1 mapping. The '114-bp' fragment is A + T-rich (54%), as compared to the Streptomyces genome (70-73% GC). The presence of a phosphate control sequence (pcs) in the upstream region of the pabS gene is proposed.     

Glutamate tRNA genes are adjacent to 5S RNA genes in Drosophila and reveal a conserved upstream sequence (the ACT-TA box).

In Drosophila melanogaster at least six transfer RNA genes are located adjacent to the 3' end of the 5S RNA gene cluster. Three of these have been sequenced and identified as coding for glutamate tRNA4. In the chromosome they are arranged as tandem repeats on the same DNA strand and transcribed in the same direction as is 5S DNA, towards the centromere. We have also identified a sequence, the ACT-TA box, that is highly conserved among the polymerase III transcribed genes. Usually the sequence is located at 37 +/- 8 base pairs upstream from the first nucleotide of the structural gene. A similar sequence is also observed upstream of yeast and silkworm tRNA genes and the mitochondrial tRNA genes of mouse and humans.     

Transforming Sloan-Kettering viruses generated from the cloned v-ski oncogene by in vitro and in vivo recombinations.

The Sloan-Kettering viruses (SKVs) are replication-defective retroviruses that transform avian cells in vitro. Each of the three SKV isolates is a mixture of viruses with genomes ranging in size from 4.1 to 8.9 kilobases (kb) with a predominant genome of 5.7 kb. Using a cDNA representing a sequence, v-ski, that is SKV specific and held in common by the multiple SKV genomes, we generated a restriction map of the 5.7-kb SKV genome and molecularly cloned a ski-containing fragment from SKV proviral DNA. Southern hybridization and sequence analysis showed that the cloned DNA fragment consisted of the 1.3-kb ski sequence embedded in the p19gag sequence and followed by the remaining 5' half of the gag gene and small portions of both the pol and env genes. A large deletion encompassing the 3' half of gag and the 5' 80% of pol was mapped to a position about 1 kb downstream from the 3' ski-gag junction. To determine whether the cloned ski sequence had transforming activity, the ski-containing fragment and a cloned Rous-associated virus 1 (RAV-1) genome were used to construct an analog of the 5.7-kb SKV genome, RAV-SKV. Cotransfection of chicken embryo cells with RAV-SKV and RAV-1 yielded foci of transformed cells whose morphology was identical to that induced by the natural SKVs. The transformed transfected cells produced transforming virus with a 5.7-kb ski-containing genome and synthesized a gag-containing polyprotein of 110 kilodaltons (kDa). Several nonproducer clones of RAV-SKV-transformed cells were analyzed, and most were found to synthesize a 5.7-kb SKV RNA and a 110-kDa polyprotein. One clone was found to contain an 8.9-kb SKV RNA, and this clone synthesized a 125-kDa polyprotein. Since both the 5.7- and 8.9-kb genomes and the 110- and 125-kDa polyproteins had been identified in studies on the natural SKVs, the present results not only demonstrate the transforming activity of these individual SKVs but also suggest mechanisms for their generation.     

Bovine papilloma virus transcription: polyadenylated RNA species and assessment of the direction of transcription

The bovine papilloma virus type 1 (BPV-1)-specific RNA species were identified in virus-induced bovine warts, hamster tumors, and transformed hamster and mouse cells. In each case two major species were present (1.1 and 1.3 kilobases [kb]). Also two species of 1.6 and 1.8 kb appearing in variable amounts were found. Only in the keratinized periphery of the warts, where virus replication takes place, was it possible to reveal an additional 2-kb RNA species. In this tissue, however, the 1.6-kb species was not detected. The basal part of a bovine wart contained an additional minor, 2.9-kb, BPV-1-specific RNA sequence. By hybridization with purified defined BPV-1 DNA fragments it was shown that most of the coding sequences of the 2-kb species were transcribed from a region between 0.02 and 0.19 map units. The majority of the coding sequences of the smaller species in transformed cells were located in the region between 0.31 and 0.61 map units. The putative 5' ends mapped between 0.72 and 0.96 map units. Oligodeoxythymidylic acid-primed [(32)P]cDNA was synthesized from various RNA preparations to generate probes for the detection of 3' termini of the polyadenylated BPV-1 RNAs. By hybridization across the BPV-1 genome only one signal between the map positions 0.30 and 0.40 was obtained when RNA from transformed cells and from a tumor was used as a template. In contrast, RNA from the periphery of a wart led to the detection of an additional signal which was confined to the region between 0.96 and 1.00 map units. From the arrangement of both the 3' termini and the coding areas along the viral genome it appears that several RNA species are transcribed from one DNA strand.     

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.