The computer simulation of RNA folding involving pseudoknot formation.

The algorithm and the program for the prediction of RNA secondary structure with pseudoknot formation have been proposed. The algorithm simulates stepwise folding by generating random structures using Monte Carlo method, followed by the selection of helices to final structure on the basis of both their probabilities of occurrence in a random structure and free energy parameters. The program versions have been tested on ribosomal RNA structures and on RNAs with pseudoknots evidenced by experimental data. It is shown that the simulation of folding during RNA synthesis improves the results. The introduction of pseudoknot formation permits to predict the pseudoknotted structures and to improve the prediction of long-range interactions. The computer program is rather fast and allows to predict the structures for long RNAs without using large memory volumes in usual personal computer.     

Effects of the ribosomal subunit association on the chemical modification of the 16S and 23S RNAs from Escherichia coli

70S ribosomes and 30S and 50S ribosomal subunits from Escherichia coli were modified under non-denaturing conditions with the chemical reagent dimethylsulfate. The ribosomal 23S and 16S RNAs were isolated after the reaction and the last 200 nucleotides from the 3' ends were analyzed for differences in the chemical modification. A number of accessibility changes could be detected for 23S and 16S RNA when 70S ribosomes as opposed to the isolated subunits were modified. In addition to a number of sites which were protected from modification several guanosines showed enhanced reactivities, indicating conformational changes in the ribosomal RNA structures when 30S and 50S subunits associate to a 70S particle. Most of the accessibility changes can be localized in double-helical regions within the secondary structures of the two RNAs. The results confirm the importance of the ribosomal RNAs for ribosomal functions and help to define the RNA domains which constitute the subunit interface of E. coli ribosomes.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

A model for the study of ligand binding to the ribosomal RNA helix h44

Oligonucleotide models of ribosomal RNA domains are powerful tools to study the binding and molecular recognition of antibiotics that interfere with bacterial translation. Techniques such as selective chemical modification, fluorescence labeling and mutations are cumbersome for the whole ribosome but readily applicable to model RNAs, which are readily crystallized and often give rise to higher resolution crystal structures suitable for detailed analysis of ligand–RNA interactions. Here, we have investigated the HX RNA construct which contains two adjacent ligand binding regions of helix h44 in 16S ribosomal RNA. High-resolution crystal structure analysis confirmed that the HX RNA is a faithful structural model of the ribosomal target. Solution studies showed that HX RNA carrying a fluorescent 2-aminopurine modification provides a model system that can be used to monitor ligand binding to both the ribosomal decoding site and, through an indirect effect, the hygromycin B interaction region.     

Evolutionary changes in the higher order structure of the ribosomal 5S RNA.

Comparative studies have been undertaken on the higher order structure of ribosomal 5S RNAs from diverse origins. Competitive reassociation studies show that 5S RNA from either a eukaryote or archaebacterium will form a stable ribonucleoprotein complex with the yeast ribosomal 5S RNA binding protein (YL3); in contrast, eubacterial RNAs will not compete in a similar fashion. Partial S1 ribonuclease digestion and ethylnitrosourea reactivity were used to probe the structural differences suggested by the reconstitution experiments. The results indicate a more compact higher order structure in eukaryotic 5S RNAs as compared to eubacteria and suggest that the archaebacterial 5S RNA contains features which are common to either group. The potential significance of these results with respect to a generalized model for the tertiary structure of the ribosomal 5S RNA and to the heterogeneity in the protein components of 5S RNA-protein complexes are discussed.     

Conformation and dynamics of an RNA internal loop

The conformation and the dynamics of an RNA oligonucleotide (26 nucleotides) which is a model for loop E in eukaryotic 5S RNA have been investigated by one- and two-dimensional NMR. The central portion of the oligonucleotide contains two G A oppositions, a common feature of ribosomal RNAs. The exchangeable proton spectrum indicates that an internal loop separates two stems of four and five base pairs. This observation is not consistent with structures for loop E containing mismatched G.A base pairs proposed from chemical and enzymatic studies on Xenopus laevis 5S RNA. The nonexchangeable proton spectrum has been assigned by two-dimensional NMR. Scalar couplings from correlated experiments and interproton distances from NOESY experiments at short mixing times have been used to determine glycosidic angles, sugar puckers, and other conformational features. The conformation of the stems is very close to standard A-form RNA, and extensive base stacking continues into the internal loop. This result provides a structural basis for the large favorable enthalpy of duplex formation determined in thermodynamic studies. Unusual structural and dynamic features are localized in the nucleotides connecting the loop to the stems.     

Proposed secondary structure of eukaryote specific expansion segment 15 in 28S rRNA from mice, rats, and rabbits

The expansion segments in eukaryotic ribosomal RNAs are additional RNA sequences not found in the RNA core common to both prokaryotes and eukaryotes. These regions show large species-dependent variations in sequence and size. This makes it difficult to create secondary structure models for the expansion segments exclusively based on phylogenetic sequence comparison. Here we have used a combination of experimental data and computational methods to generate secondary structure models for expansion segment 15 in 28S rRNA in mice, rats, and rabbits. The experimental data were collected using the structure sensitive reagents DMS, CMCT, kethoxal, micrococcal nuclease, RNase T(1), RNase CL3, RNase V(1), and lead(II) acetate. ES15 was folded with the computer program RNAStructure 3.5 using modification data and phylogenetic similarities between different ES15 sequences. This program uses energy minimization to find the most stable secondary structure of an RNA sequence. The presented secondary structure models include several common structural motifs, but they also have characteristics unique to each organism. Overall, the secondary structure models showed indications of an energetically stable but dynamic structure, easily accessible from the solution by the modification reagents, suggesting that the expansion segment is located on the ribosomal surface.     

Synthesis of a 3-methyluridine phosphoramidite to investigate the role of methylation in a ribosomal RNA hairpin.

The synthesis of a 5'-O-BzH-2'-O-ACE-protected-3-methyluridine phosphoramidite is reported [BzH, benzhydryloxy-bis(trimethylsilyloxy)silyl; ACE, bis(2-acetoxyethoxy)methyl]. The phosphoramidite was employed in solid-phase RNA synthesis to generate a series of RNA hairpins containing single or multiple modifications, including the common nucleoside pseudouridine. Three 19-nucleotide hairpin RNAs that represent the 1920-loop region (G(1906)-C(1924)) of Escherichia coli 23S ribosomal RNA were generated. Modifications were present at positions 1911, 1915, and 1917. The stabilities and structures of the three RNAs were examined by using thermal melting, circular dichroism, and NMR spectroscopy     

Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

Summary The complete nucleotide sequences of 5S ribosomal RNAs fromRhodocyclus gelatinosa, Rhodobacter sphaeroides, andPseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains.Rhodobacter sphaeroides is specifically related toParacoccus denitrificans andRc. gelatinosa is related toPs. cepacia.These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found inP. denitrificans are present also in the 5S RNA ofRb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of our obtaining these new sequences is that we are able to clarify the phylogenetic origins of the plant mitochondrion. In particular, we find a close phylogenetic relationship between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely,Rb. sphaeroides, P. denitrificans, andRhodospirillum rubrum.     

Recent developments in methods for RNA sequencing using in vitro 32P-labeling

A variety of approaches that utilize in vitro 32P-labeling of RNA and of oligonucleotides in the sequence analysis of RNAs are described. These include 1) methods for 5'- and 3'- end labeling of RNAs; 2) end labeling and sequencing of oligonucleotides present in complete T1 RNase or pancreatic RNase digests of RNA; 3) use of random endonucleases, such as nuclease P1, for terminal sequence analysis of end labeled RNAs; and 4) use of base specific enzymes or chemical reagents in the sequence analysis of end-labeled RNAs. Also described is an approach to RNA sequencing, applied so far to tRNAs, which is based on partial and random alkaline cleavage of an RNA to generate a series of overlapping oligonucleotide fragments, all containing the original 3'-end of the RNA. Analysis of the 5'- end group of each of these oligonucleotides (following 5'-end labeling with 32P) provides the sequence of most of the tRNA. The above methods have been used to derive the sequences of several tRNAs, the ribosomal 5S and 5 x 8S RNAs, a viroid RNA, and large segments of both prokaryotic and eukaryotic ribosomal and messenger RNAs.     

A new distance for high level RNA secondary structure comparison

We describe an algorithm for comparing two RNA secondary structures coded in the form of trees that introduces two new operations, called node fusion and edge fusion, besides the tree edit operations of deletion, insertion, and relabeling classically used in the literature. This allows us to address some serious limitations of the more traditional tree edit operations when the trees represent RNAs and what is searched for is a common structural core of two RNAs. Although the algorithm complexity has an exponential term, this term depends only on the number of successive fusions that may be applied to a same node, not on the total number of fusions. The algorithm remains therefore efficient in practice and is used for illustrative purposes on ribosomal as well as on other types of RNAs.     

Structural organization of the 16S ribosomal RNA from E. coli. Topography and secondary structure.

Extensive studies in our laboratory using different ribonucleases resulted in valuable data on the topography of the E.coli 16S ribosomal RNA within the native 30S subunit, within partially unfolded 30S subunits, in the free state, and in association with individual ribosomal proteins. Such studies have precise details on the accessibility of certain residues and delineated highly accessible RNA regions. Furthermore, they provided evidence that the 16S rRNA is organized in its subunit into four distinct domains. A secondary structure model of the E.coli 16S rRNA has been derived from these topographical data. Additional information from comparative sequence analyses of the small ribosomal subunit RNAs from other species sequenced so far has been used.     

Precise identification of cleavage sites involved in the unusual processing of trypanosome ribosomal RNA

The large subunit ribosomal RNA (LSRNA) of Trypanosoma brucei is unusual in being cleaved at multiple sites to yield six stable fragments of RNA. We report here the complete nucleotide sequence of two regions of the ribosomal DNA repeat unit. The first sequence includes all of the processing sites involved in the generation of one of the small LSRNA fragments. The second region encodes the trypanosome 5.8 S RNA. By RNA sequencing and S1 nuclease mapping, we have identified the processing sites involved in the generation of both of these small RNAs. On the basis of predicted secondary structure models, we infer that all the cleavages apparently occur near the junction of single- and double-stranded regions. The sites involved in the novel LSRNA processing show a clear symmetry with respect to a conserved region of ten base-pairs. No such signals are evident for the processing sites that generate the 5.8 S RNA.