Mouse steroid 15 alpha-hydroxylase gene family: identification of type II P-450(15)alpha as coumarin 7-hydroxylase

We identified type II P-450(15)alpha as mouse coumarin 7-hydroxylase (P-450coh). Unlike type I P-450(15)alpha, the other member within the mouse steroid 15 alpha-hydroxylase gene family, type II catalyzed little steroid 15 alpha-hydroxylase activity, yet structurally there were only 11 substitutions between type I and type II P-450(15)alphaS within their 494 amino acid residues (Lindberg et al., 1989), and the N-terminal sequence (21 residues) of P-450coh was identical with that of both P-450(15)alphaS. Induction by pyrazole of coumarin 7-hydroxylase activity correlated well with the increase of type II P-450(15)alpha mRNA in 129/J male and female mice. Pyrazole, on the other hand, was less in males or not effective in females in inducing the 15 alpha-hydroxylase activity and type I P-450(15)alpha mRNA. Expression of type I and II in COS-1 cells revealed that the latter catalyzed coumarin 7-hydroxylase activity at 10 to approximately 14 pmol min-1 (mg of cellular protein)-1. The former, on the other hand, had a high testosterone 15 alpha-hydroxylase but little coumarin 7-hydroxylase activity. It was concluded, therefore, that type II P-450(15)alpha is the mouse coumarin 7-hydroxylase. Identification of type II as the P-450 specific to coumarin 7-hydroxylase activity and characterization of its cDNA and gene, therefore, were significant advances toward understanding the basis of genetic regulation of this activity in mice (known as Coh locus).     

Reciprocal regulation of sex-dependent expression of testosterone 15 alpha-hydroxylase (P-450(15 alpha)) in liver and kidney of male mice by androgen. Evidence for a single gene

Testosterone 15 alpha-hydroxylase activities and its mRNA levels are higher in kidneys than in livers from male 129/J mice. Castration of 129/J male mice resulted in repression of P-450(15 alpha) in kidney, but increased it in liver. Two types of cDNA (p15 alpha-29 (Type I) and -15 (Type II)) encoding P-450(15 alpha) were previously cloned from 129/J female livers (Burkhart, B.A., Harada, N., and Negishi, M. (1985) J. Biol. Chem. 260, 15357-15361). With the use of p15 alpha-29 as a probe, Type I and II P-450(15 alpha) cDNAs were isolated from libraries of 129/J kidney poly(A)+ RNA. The nucleotide sequences of the cDNAs showed that Type I and II cDNAs from liver and kidney were identical and shared 98.3% similarity. The deduced amino acid sequence from a full-length Type I cDNA indicated that Type I P-450(15 alpha) consists of 494 amino acids with a molecular weight of 56,594. Nine amino acid substitutions were found in the Type II clone in 432 amino acids overlapping Type I. Type I cDNA clones accounted for approximately 90% P-450(15 alpha) clones isolated from a male kidney library, whereas approximately 90% of cDNA clones in a female kidney library were Type II. Liver cDNA libraries from males and females contained similar ratios of Type I and II. Effects of castration on Type I and II mRNAs were determined by Southern hybridization of a 32P-labeled ClaI-ClaI fragment from p15 alpha-29 to cDNAs synthesized from kidney and liver poly(A)+ RNAs prepared from sham-operated, castrated 129/J mice. The double-stranded cDNAs were digested with ClaI and PstI prior to gel electrophoresis to create the diagnostic restriction fragments specific for Type I or II. Castration resulted in decreased levels of Type I mRNA in male kidney. In male liver, only Type I mRNA rose significantly in response to castration. Testosterone administration returned the Type I mRNA to normal levels in castrated mice. It therefore appears that the high levels of P-450(15 alpha) in male kidney were due to androgen-dependent induction of Type I mRNA. Both Types I and II were repressed in male liver, which results in decreased levels of P-450(15 alpha). Androgen was responsible for the repression and expression of Type I in liver and kidney, but not Type II.     

Tissue-specific regulation of cytochrome P-450 dependent testosterone 15 alpha-hydroxylase

Testosterone 15 alpha-hydroxylase activity in kidney microsomes is higher in male mice than in female mice, while in the liver the activity is higher in females than in males. Cytochrome P-450 15 alpha, a specific form of cytochrome P-450 having testosterone 15 alpha-hydroxylase activity, accounts for virtually all of the testosterone 15 alpha-hydroxylase activity in female kidney microsomes, while other isozymes of testosterone 15 alpha-hydroxylase are present in male kidney microsomes. In female kidney, P-450 15 alpha expression is regulated by a single sex-dependent locus, called Rsh for "regulation of steroid hydroxylase." The higher level of P-450 15 alpha expression in male kidneys is dependent on androgens. Of all mice strains, 129/J seems to be the least dependent on androgens to maintain a high expression of P-450 15 alpha in male kidneys. Castration of male mice lowers kidney levels of P-450 15 alpha but in the liver, P-450 15 alpha levels rise after castration. This reciprocal regulation of P-450 15 alpha genes in liver and kidney was investigated by isolating cDNA clones encoding P-450 15 alpha from liver and kidney cDNA libraries. Two highly homologous cDNA clones encoding P-450 15 alpha designated type I and type II were identified, and levels of type I and type II mRNA in liver and kidney were determined by differential restriction mapping of double-stranded cDNA prepared from mRNA from these tissues.(ABSTRACT TRUNCATED AT 250 WORDS)     

Genetic regulation of testosterone 15 alpha-hydroxylase (cytochrome P-450(15)alpha) in renal microsomes of female mice

P-450(15)alpha is a form of cytochrome P-450 purified from liver microsomes of female 129/J mice that is specific for oxidation of testosterone to its 15 alpha-hydroxylated product. Testosterone 15 alpha-hydroxylase activity that was inhibited by anti-P-450(15)alpha antibody was approximately 50 times higher in renal microsomes from 129/J than in BALB/cJ females. Western blots of renal microsomes using anti-P-450(15)alpha antibody showed the presence of immunoreactive protein with a molecular weight identical with that of hepatic P-450(15)alpha in 129/J but not in BALB/cJ female mice. To investigate the genetic basis for the strain differences in this activity, the distribution of P-450(15)alpha-dependent testosterone 15 alpha-hydroxylase activity in renal microsomes from individual females of 129/J and BALB/cJ, of F1 offspring of these strains, and of F1 back-crosses to the progenitor strains were determined. The results were consistent with a sex-related autosomal dominant regulation of the higher activity in 129/J females by a single locus, designated Rsh (regulation of steroid hydroxylase). The amounts of immunochemically cross-reactive P-450(15)alpha protein were linearly correlated with testosterone 15 alpha-hydroxylase activities in renal microsomes from Rsh heterozygotes and homozygotes. At least twice as much mRNA, which hybridized with the cDNA clone for hepatic P-450(15)alpha, was detected in 129/J and 129CF1/J compared to BALB/cJ female kidneys. The evidence suggests a pretranslational regulation of the P-450(15)alpha isozyme in the female mouse kidney by the Rsh locus.(ABSTRACT TRUNCATED AT 250 WORDS)     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)     

Testosterone inhibits cAMP-induced de Novo synthesis of Leydig cell cytochrome P-450(17 alpha) by an androgen receptor-mediated mechanism

The regulation of the novo synthesis of the microsomal cytochrome P-450 enzyme, P-450(17 alpha), was studied in mouse Leydig cell cultures. Chronic treatment with 0.05 mM 8-Br-cAMP (cAMP) caused a time-dependent increase in 17 alpha-hydroxylase activity and in the amount of P-450(17 alpha), quantitated by immunoblotting. This increase in both activity and amount was enhanced by inhibiting testosterone production with aminoglutethimide, an inhibitor of cholesterol side-chain cleavage or SU 10603, an inhibitor of 17 alpha-hydroxylase. To examine the mechanism by which cAMP or cAMP plus inhibitors of testosterone production increased the activity and amount of P-450(17 alpha), changes in the rate of de novo synthesis were studied by measuring [35S]methionine incorporation into newly synthesized protein. Treatment with cAMP plus aminoglutethimide or SU 10603 caused a 2-fold or greater increase in the rate of de novo synthesis of P-450(17 alpha) compared to treatment with cAMP only. The addition of exogenous testosterone reversed this increase in the rate of synthesis, indicating that testosterone modulates the extent of cAMP-stimulated induction of P-450(17 alpha). This negative effect of testosterone could be mimicked by the addition of the androgen agonist, mibolerone, and prevented by the addition of the antiandrogen, hydroxyflutamide. Neither estradiol nor dexamethasone had any effect on the synthesis of P-450(17 alpha). Studies on the degradation of newly synthesized P-450(17 alpha) demonstrated that testosterone had no effect on the decay of P-450(17 alpha) during the first 24 h but caused a significant increase in the rate of decay between 24 and 48 h. These data indicate that testosterone produced during cAMP induction of P-450(17 alpha) negatively regulates the amount of this cytochrome P-450 enzyme by two distinct mechanisms: by repressing cAMP-induced synthesis of P-450(17 alpha) by an androgen receptor-mediated mechanism and by increasing the rate of degradation of P-450(17 alpha). A model is proposed for the regulation of P-450(17 alpha) in Leydig cells.     

The interference of polychlorinated biphenyls (Aroclor 1254) with membrane regulation of the activities of cytochromes P-450C21 and P-450(17) alpha,lyase in guinea-pig adrenal microsomes.

Regulation of cytochromes P-450 21-hydroxylase (P-450C21) and P-450 17 alpha-hydroxylase/C17,20-lyase (P-450(17) alpha,lyase) activities and impairment of this regulation by Aroclor 1254 was studied in guinea-pig adrenal microsomes. In a membrane depleted system, a decrease in the normally predominant, P-450C21 activity and an increase in P-450(17) alpha,lyase activities was observed. The same deviations were observed in intact microsomes with increase in the reaction temperature (0-40 degrees C). Breaks in Arrhenius plots for activities of P-450C21 and P-450(17) alpha,lyase correlate with transition temperatures reported for the microsomal membrane. These results point to: (1) preference of a gel state membrane for catalytic expression of P-450C21 suggesting a clustered organization of this P-450 species with reductase; (2) preference of a fluid membrane for lyase activity suggesting a random collision mechanism for reduction of P-450(17) alpha,lyase. Aroclor 1254 introduced to reaction mixtures containing intact microsomes elicited basically the same changes as caused by depletion of the microsomal membrane or by increase in the incubation temperature. Lack of effect of Aroclor 1254 on P-450C21 and P-450(17) alpha,lyase activities in the membrane depleted system demonstrates that its interference with monooxygenase activities is mediated by the microsomal membrane. The similarities between altered cytochrome P-450 mediated activities in the presence of Aroclor 1254 and the deviations observed in the membrane depleted system or upon increase in the incubation temperature may suggest that this chemical exerts its impacts by influencing membrane fluidity.     

Functional characterization of two cytochrome P-450s within the mouse, male-specific steroid 16 alpha-hydroxylase gene family: expression in mammalian cells and chimeric proteins

Two cDNAs, pc16 alpha-2 and pc16 alpha-25, which encode P-450s from within the mouse, male-specific steroid 16 alpha-hydroxylase (C-P-450(16 alpha)) gene family, were transfected into COS-1 cells in order to study catalytic activities of the expressed P-450s. pc16 alpha-2 was shown previously to encode the growth hormone dependent and androgen-dependent C-P-450(16 alpha) in adult male mice (Wong et al., 1987). The sequence of pc16 alpha-25-encoded P-450 (P-450cb) was identical with gene cb within the C-P-450(16 alpha) family. There was 94% and 87% nucleotide and amino acid sequence identity, respectively, between P-450cb and C-P-450(16 alpha). We expressed both P-450s by transfecting their cDNAs into COS-1 cells and found that steroid 16 alpha-hydroxylase activity was catalyzed by C-P-450(16 alpha) but not by P-450cb. In addition to testosterone, progesterone and estradiol were hydroxylated specifically at the 16 alpha-position by the expressed C-P-450(16 alpha). The results indicated that a broad steroid substrate specificity with high regio- and stereoselectivity at that position was a characteristic of C-P-450(16 alpha). We constructed and expressed chimeras between the two P-450s and found that the presence of about two-thirds of the C-P-450(16 alpha) molecule from its C-terminus was necessary for the chimeric cytochrome to maintain steroid 16 alpha-hydroxylase activity.     

Deletion of a phenylalanine in the N-terminal region of human cytochrome P-450(17 alpha) results in partial combined 17 alpha-hydroxylase/17,20-lyase deficiency

Steroid 17 alpha-hydroxylase and 17,20-lyase activities reside within the same polypeptide chain (cytochrome P-450(17 alpha)), and consequently human 17 alpha-hydroxylase deficiencies are characterized by defects in either or both of these activities. Human mutants having these deficiencies represent an excellent source of material for investigation of P-450(17 alpha) structure-function relationships. The CYP17 gene from an individual having partial combined 17 alpha-hydroxylase/17,20-lyase deficiency has been characterized structurally and the homozygous mutation found to be the deletion of the phenylalanine codon (TTC) at either amino acid position 53 or 54 in exon 1. Reconstruction of this mutation into a human P-450(17 alpha) cDNA followed by expression in COS 1 cells led to production of the same amount of immunodetectable P-450(17 alpha) protein as found with expression of the normal human P-450(17 alpha) cDNA. However, 17 alpha-hydroxylase activity of this mutant protein measured in intact cells was less than 37% of that observed upon expression of the wild-type enzyme, whereas 17,20-lyase activity of the mutant was less than 8% of that observed with the normal enzyme. When estimated in intact cells, the Km for 17 alpha-hydroxylation of progesterone was increased by a factor of 2 in the mutant enzyme, whereas the Vmax was reduced by a factor of 3. In order to estimate the kinetic parameters for the 17,20-lyase reaction, microsomes were isolated from transfected COS 1 cells to enrich for this activity. Surprisingly, the specific activity of the mutant 17 alpha-hydroxylase in microsomes was 3-fold less than that observed in intact cells, indicating that the structure of mutant P-450(17 alpha) was dramatically altered upon disruption of COS 1 cells. Apparently the deletion of a single phenylalanine in the N-terminal region of P-450(17 alpha) alters its folding in such a way that both enzymatic activities are dramatically decreased, leading to the partial combined deficiency observed in this individual.     

Adult male-specific and neonatally programmed rat hepatic P-450 forms RLM2 and 2a are not dependent on pulsatile plasma growth hormone for expression

Rat hepatic cytochrome P-450 form RLM2 is a testosterone 15 alpha-hydroxylase reported to be male-specific on the basis of purification studies (Jansson, I., Mole, J., and Schenkman, J. B. (1985) J. Biol. Chem. 260, 7084-7093). The sex dependence, developmental regulation, xenobiotic induction, and hormonal control of P-450 RLM2 expression were studied using P-450 form-specific immunochemical and catalytic assays. Polyclonal antibodies raised to rat hepatic P-450 3 (P-450 gene IIA1) were found to cross-react strongly with P-450 RLM2, but not with 10 other rat P-450 forms, suggesting that P-450 3 and P-450 RLM2 are highly conserved in primary structure. Western blotting of liver microsomes under conditions where P-450s 3 and RLM2 are resolved electrophoretically revealed that P-450 RLM2 is markedly induced at puberty in male rats, with no protein detected (less than or equal to 5% of adult male levels) in adult females or immature animals of either sex. A similar developmental dependence was observed for hepatic microsomal testosterone 15 alpha-hydroxylase activity, which was found to be catalyzed primarily by P-450 RLM2. P-450 RLM2 was resistant to induction by several xenobiotics and in the case of phenobarbital and beta-naphthoflavone, was suppressed by 50-60%. Studies on the steroid hormonal regulation of P-450 RLM2 revealed that its adult male-specific expression is imprinted (programmed) in response to neonatal testosterone exposure. Ovariectomy studies demonstrated that suppression by estrogen does not contribute significantly to the absence of P-450 RLM2 in adult female rats. Although the male-specific developmental induction of P-450 RLM2 in response to neonatal testosterone is strikingly similar to that of P-450 2c (testosterone 2 alpha/16 alpha-hydroxylase; gene IIC11), P-450 RLM2 expression is not dependent on the pulsatile pituitary growth hormone secretion required for P-450 2c synthesis. Rather, hypophysectomy of adult male rats increased P-450 RLM2 and its associated testosterone 15 alpha-hydroxylase activity by 50-100%.(ABSTRACT TRUNCATED AT 400 WORDS)     

A prostaglandin omega-hydroxylase cytochrome P-450 (P-450PG-omega) purified from lungs of pregnant rabbits

Cytochrome P-450-dependent prostaglandin omega-hydroxylation is induced over 100-fold during late gestation in rabbit pulmonary microsomes (Powell, W.S. (1978) J. Biol. Chem. 253, 6711-6716). Purification of cytochromes P-450 from lung microsomes of pregnant rabbits yielded three fractions. Two of these fractions correspond to rabbit lung P-450I (LM2) and P-450II (LM5), which together constitute 70-97% of total cytochrome P-450 in lung microsomes from nonpregnant rabbits. The third form, which we designate rabbit cytochrome P-450PG-omega, regioselectively hydroxylates prostaglandins at the omega-position in reconstituted systems with a turnover of 1-5 min-1. Titration with purified pig liver cytochrome b5, demonstrated a 4-fold maximum stimulation at a cytochrome b5 to a P-450 molar ratio of 1-2. Rabbit lung P-450PG-omega formed a typical type I binding spectrum upon the addition of prostaglandin E1 with a calculated K8 of 1 microM, which agreed reasonably well with the kinetically calculated Km of 3 microM. Cytochrome P-450PG-omega was isolated as a low-spin isozyme with a lambda max (450 nm) in the CO-difference spectrum distinguishable from P-450I (451 nm) and P-450II (449 nm). Sodium dodecyl sulfate-polyacrylamide slab gel electrophoresis demonstrated that although purified P-450PG-omega had a relatively low specific content (12.1 nmol mg-1), it appeared homogeneous with a calculated minimum Mr of 56,000, intermediate between rabbit LM4 and LM6. When lung microsomes from pregnant and nonpregnant rabbit were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, a protein band, with a Mr identical to P-450PG-omega, was observed in the pregnant rabbit, whereas this band appeared to be very faint or absent in microsomes from the nonpregnant rabbit. Purification of cytochromes P-450 from nonpregnant rabbit lung yielded only P-450I and P-450II. P-450PG-omega appears to be a novel rabbit P-450, possessing high activity towards omega-hydroxylation of prostaglandins, and is greatly induced during pregnancy in rabbit lung.