Genomewide analysis of box C/D and box H/ACA snoRNAs in Chlamydomonas reinhardtii reveals an extensive organization into intronic gene clusters

Chlamydomonas reinhardtii is a unicellular green alga, the lineage of which diverged from that of land plants >1 billion years ago. Using the powerful small nucleolar RNA (snoRNA) mining platform to screen the C. reinhardtii genome, we identified 322 snoRNA genes grouped into 118 families. The 74 box C/D families can potentially guide methylation at 96 sites of ribosomal RNAs (rRNAs) and snRNAs, and the 44 box H/ACA families can potentially guide pseudouridylation at 62 sites. Remarkably, 242 of the snoRNA genes are arranged into 76 clusters, of which 77% consist of homologous genes produced by small local tandem duplications. At least 70 snoRNA gene clusters are found within introns of protein-coding genes. Although not exhaustive, this analysis reveals that C. reinhardtii has the highest number of intronic snoRNA gene clusters among eukaryotes. The prevalence of intronic snoRNA gene clusters in C. reinhardtii is similar to that of rice but in contrast with the one-snoRNA-per-intron organization of vertebrates and fungi and with that of Arabidopsis thaliana in which only a few intronic snoRNA gene clusters were identified. This analysis of C. reinhardtii snoRNA gene organization shows the functional importance of introns in a single-celled organism and provides evolutionary insight into the origin of intron-encoded RNAs in the plant lineage.     

Chlamydomonas reinhardtii as a new model system for studying the molecular basis of the circadian clock

The genome of the unicellular green alga Chlamydomonas reinhardtii has both plant-like and animal-like genes. It is of interest to know which types of clock genes this alga has. Recent forward and reverse genetic studies have revealed that its clock has both plant-like and algal clock components. In addition, since C. reinhardtii is a useful model organism also called "green yeast", the identification of clock genes will make C. reinhardtii a powerful model for studying the molecular basis of the eukaryotic circadian clock. In this review, we describe our forward genetic approach in C. reinhardtii and discuss some recent findings about its circadian clock.     

Green algal extracellular products regulate antialgal toxin production in a cyanobacterium

Many bacterial genes and virulence factors are regulated by interbacterial and/or host–parasite chemical signals. We demonstrate that toxin production by a free-living freshwater cyanobacterium is regulated in part by the presence of extracellular products of a eukaryotic green alga. In growth experiments, extracellular products made by the cyanobacterium Anabaena flos-aquae contained both anatoxin and microcystin, and significantly reduced the yield of Chlamydomonas reinhardtii , a green alga. Based on experiments in which we added purified toxins to C. reinhardtii cultures, we believe that microcystin was responsible for the growth reduction. A. flos-aquae produced anatoxin constitutively when grown alone, but anatoxin concentration increased in the presence of C. reinhardtii elicitors. Microcystin accumulation depended on the growth phase; however, high concentrations of C. reinhardtii extracellular products completely inhibited microcystin accumulation. Our results demonstrate that cyanobacterial toxin production may be regulated by complex growth phase-dependent and environmental chemical cues, and suggest that secreted chemicals can mediate the outcome of competition between the cyanobacterium A. flos-aquae and the green alga C. reinhardtii .     

A large scale structural analysis of cDNAs in a unicellular green alga, Chlamydomonas reinhardtii. I. Generation of 3433 non-redundant expressed sequence tags.

To understand genetic information carried in a unicellular green alga, Chlamydomonas reinhardtii, normalized and size-selected cDNA libraries were constructed from cells at photoautotrophic growth, and a total of 11,571 5'-end sequence tags were established. These sequences were grouped into 3433 independent EST species. Similarity search against the public non-redundant protein database indicated that 817 groups showed significant similarity to registered sequences, of which 140 were of previously identified C. reinhardtii genes, but the remaining 2616 species were novel sequences. The coverage of full-length protein coding regions was estimated to be over 60%. These cDNA clones and EST sequence information will provide a powerful source for the future genome-wide functional analysis of uncharacterized genes.     

Identification of target mRNAs for the clock-controlled RNA-binding protein Chlamy 1 from Chlamydomonas reinhardtii

An endogenous clock regulates the temporal expression of genes/mRNAs that are involved in the circadian output pathway. In the green alga Chlamydomonas reinhardtii, a clock-controlled RNA-binding protein (Chlamy 1) was identified recently, which represents an analog of the circadian trans-acting factor CCTR from the phylogenetically diverse alga Gonyaulax polyedra. In order to identify in C. reinhardtii target mRNAs that can be recognized by Chlamy 1, gel mobility-shift assays and UV-crosslinking experiments were carried out, and revealed that this protein interacts specifically with the 3' untranslated regions of several mRNAs and recognizes them all via a common cis-acting element, composed of at least seven UG repeats. By using competition assays, it was found that the affinity of Chlamy 1 is highest for mRNAs whose products are key components of nitrogen and CO2 metabolism. Since the activities of enzymes involved in nitrogen metabolism vary in a temporal pattern that is opposite in phase to that of Chlamy 1 binding activity, the protein may repress the translation of the cognate mRNAs.     

Functional genomics of plant photosynthesis in the fast lane using Chlamydomonas reinhardtii

Oxygenic photosynthesis by algae and plants supports much of life on Earth. Several model organisms are used to study this vital process, but the unicellular green alga Chlamydomonas reinhardtii offers significant advantages for the genetic dissection of photosynthesis. Recent experiments with Chlamydomonas have substantially advanced our understanding of several aspects of photosynthesis, including chloroplast biogenesis, structure-function relationships in photosynthetic complexes, and environmental regulation. Chlamydomonas is therefore the organism of choice for elucidating detailed functions of the hundreds of genes involved in plant photosynthesis.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

The 5'' leader of a chloroplast mRNA mediates the translational requirements for two nucleus-encoded functions in Chlamydomonas reinhardtii.

In the green alga Chlamydomonas reinhardtii, the nuclear mutations F34 and F64 have been previously shown to abolish the synthesis of the photosystem II core polypeptide subunit P6, which is encoded by the chloroplast psbC gene. In this report the functions encoded by F34 and F64 are shown to be required for translation of the psbC mRNA, on the basis of the finding that the expression of a heterologous reporter gene fused to the psbC 5' nontranslated leader sequence requires wild-type F34 and F64 alleles in vivo. Moreover, a point mutation in the psbC 5' nontranslated leader sequence suppresses this requirement for wild-type F34 function. In vitro RNA-protein cross-linking studies reveal that chloroplast protein extracts from strains carrying the F64 mutation contain an approximately 46-kDa RNA-binding protein. The absence of the RNA-binding activity of this protein in chloroplast extracts of wild-type strains suggests that it is related to the role of the F64-encoded function for psbC mRNA translation. The binding specificity of this protein appears to be for an AU-rich RNA sequence motif.     

Identification of Lhcb gene family encoding the light-harvesting chlorophyll-a/b proteins of photosystem II in Chlamydomonas reinhardtii

The Lhcb gene family in green plants encodes several light-harvesting Chl a/b-binding (LHC) proteins that collect and transfer light energy to the reaction centers of PSII. We comprehensively characterized the Lhcb gene family in the unicellular green alga, Chlamydomonas reinhardtii, using the expressed sequence tag (EST) databases. A total of 699 among over 15,000 ESTs related to the Lhcb genes were assigned to eight, including four new, genes that we isolated and sequenced here. A sequence comparison revealed that six of the Lhcb genes from C. reinhardtii correspond to the major LHC (LHCII) proteins from higher plants, and that the other two genes (Lhcb4 and Lhcb5) correspond to the minor LHC proteins (CP29 and CP26). No ESTs corresponding to another minor LHC protein (CP24) were found. The six LHCII proteins in C. reinhardtii cannot be assigned to any of the three types proposed for higher plants (Lhcb1-Lhcb3), but were classified as follows: Type I is encoded by LhcII-1.1, LhcII-1.2 and LhcII-1.3, and Types II, III and IV are encoded by LhcII-2, LhcII-3 and LhcII-4, respectively. These findings suggest that the ancestral LHC protein diverged into LHCII, CP29 and CP26 before, and that LHCII diverged into multiple types after the phylogenetic separation of green algae and higher plants.     

The microalga Chlamydomonas reinhardtii as a platform for the production of human protein therapeutics

Microalgae are a diverse group of eukaryotic photosynthetic microorganisms. While microalgae play a crucial role in global carbon fixation and oxygen evolution, these organisms have recently gained much attention for their potential role in biotechnological and industrial applications, such as the production of biofuels. We investigated the potential of the microalga Chlamydomonas reinhardtii to be a platform for the production of human therapeutic proteins. C. reinhardtii is a unicellular freshwater green alga that has served as a popular model alga for physiological, molecular, biochemical and genetic studies. As such, the molecular toolkit for this microorganism is highly developed, including well-established methods for genetic transformation and recombinant gene expression. We transformed the chloroplast genome of C. reinhardtii with seven unrelated genes encoding for current or potential human therapeutic proteins and found that four of these genes supported protein accumulation to levels that are sufficient for commercial production. Furthermore, the algal-produced proteins were bioactive. Thus, the microalga C. reinhardtii has the potential to be a robust platform for human therapeutic protein production.     

Fragmented and scrambled mitochondrial ribosomal RNA coding regions among green algae: a model for their origin and evolution

Mitochondrial ribosomal RNA coding regions in the only three green algal taxa investigated to date are fundamentally different in that they are continuous in Prototheca wickerhamii, but highly fragmented and scrambled in Chlamydomonas reinhardtii and Chlamydomonas eugametos. To gain more insight into the mode of evolution of fragmented and scrambled mitochondrial ribosomal RNA (rRNA) genes within the green algal group, this work (1) provides additional information on fragmentation patterns of mitochondrial small- and large-subunit (SSU and LSU) rRNAs that strongly supports the concept of a gradual increase in the extent of discontinuity of mitochondrial rRNAs among chlorophycean green algae and (2) reports the first example of fragmented and scrambled mitochondrial LSU rRNA coding regions in a green algal taxon outside the Chlamydomonas group. The present study (1) suggests that the scrambling of the mitochondrial rRNA coding regions may have occurred early in the evolution of fragmented and scrambled mitochondrial rRNA genes within the chlorophycean green algal group, most likely in parallel with the fragmentation events, (2) proposes recombination as a possible mechanism involved in the evolution of these mitochondrial rRNA genes, and (3) presents a hypothetical pathway for converting continuous mitochondrial rRNA genes into the highly fragmented and scrambled rRNA coding regions of Chlamydomonas through a series of recombinatorial events between short repeated sequences.