Prion protein gene polymorphism in healthy and BSE-affected Slovak cattle

Variation of thePrP gene was examined in healthy and BSE-affected Slovak cattle. According to previous studies, the 23-bp indel polymorphism is supposed to be associated with higher susceptibility to BSE. We investigated 301 samples from healthy cattle of various Slovak breeds and 24 samples obtained from tissues of BSE-affected cattle in Slovakia. We examined thePrP gene for the 23-bp indel polymorphism in the putative promoter region, 12-bp indel polymorphism in the first intron of thePrP gene, variations in number of octapeptide repeat units, and presence of the silent AAC>AAT transition in codon 192 within the protein-coding region of thePrP gene. Altogether we found 23 different genotypes in the group of healthy cattle and only 6 genotypes in the group of BSE-affected cattle. Comparison of homozygotes for the 23-bp insertion and heterozygotes showed significant differences (P < 0.05) in genotype distribution between the examined groups. Thereby the homozygous insertion genotype at the 23-bp indel polymorphism site in the promoter region of the prion protein gene seems to have a protective effect against BSE.     

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method

Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.     

Allele Distributions and Frequencies of the Six Prion Protein Gene (PRNP) Polymorphisms in Asian Native Cattle, Japanese Breeds, and Mythun (Bos frontalis)

Six polymorphic sites of the bovine prion protein gene (PRNP) were genotyped in 569 animals of Asian native cattle, Japanese breeds, purebred mythun (Bos frontalis), and mythun × cattle composite animals. At the 23-bp indel site, a deletion (23?) allele was a major allele in all populations except mythun. At the 12-bp indel site, an insertion (12+) allele was a major allele in all populations. The 14-bp indel site was polymorphic in all Asian native cattle. In the octapeptide repeat region, a six-repeat allele was a major allele in all populations, and 5/5 and 4/6 genotypes were detected in Japanese Black and Mongolian cattle and in mythun, respectively. Two nonsynonymous single nucleotide polymorphisms (SNPs) (K3T and S154N) were detected in Asian native cattle and mythun. Haplotype analysis using the genotypes of the six sites estimated 33 different haplotypes. The haplotype 23? 12? K 6 S 14+ was found in all populations.     

Detection of Insertions/Deletions Within <Emphasis Type="Italic">SIRT1</Emphasis>, <Emphasis Type="Italic">SIRT2</Emphasis> and <Emphasis Type="Italic">SIRT3</Emphasis> Genes and Their Associations with Body Measurement Traits in Cattle

Growth traits are complex quantitative traits controlled by numerous candidate genes, and they can be well-evaluated using body measurement traits. As the members of the nicotinamide adenine dinucleotide-dependent family of histone deacetylases, class I sirtuin genes (including SIRT1, SIRT2 and SIRT3) play crucial roles in regulating lipid metabolism, cellular growth and metabolism, suggesting that they are potential candidate genes affecting body measurement traits in animals. Hence, the objective of this work aimed to detect novel insertions/deletions (indels) of SIRT1, SIRT2 and SIRT3 genes in 955 cattle belonging to five breeds, as well as to evaluate their effects on body measurement traits. Herein, the novel 12-bp indel of SIRT1 gene, the 7-bp indel of SIRT2 gene and the 26-bp indel of SIRT3 gene were firstly reported, respectively. The association analysis indicated that the indels within SIRT1 and SIRT2 genes were significantly associated with body measurement traits such as body weight, chest circumference, height at hip cross, hip width, body height, etc. (P?<?0.05 or P?<?0.01). Therefore, based on these findings, the two novel indel variants within bovine SIRT1 and SIRT2 genes could be considered as potential molecular markers for growth traits in cattle selection practices and breeding.     

An SNP in the MyoD1 Gene Intron 2 Associated with Growth and Carcass Traits in Three Duck Populations

Myogenic differentiation 1 (MyoD1) genes belong to the MyoD gene family and play key roles in growth and muscle development. This study was designed to investigate the effects of variants in the MyoD1 gene on duck growth and carcass traits. Three duck populations (Cherry Valley, Jingjiang, and Muscovy) were sampled, their growth and carcass traits were measured, and they were genotyped using the PCR–RFLP method. The results showed one novel polymorphism, an alteration in intron 2 of the MyoD1 gene (A to T). It was associated with the traits of weight at 8?weeks, carcass weight, breast muscle weight, leg muscle weight, eviscerated percentage, percentage of leg muscle weight, dressing percentage, and lean meat percentage. This alteration in intron 2 of MyoD1 may be linked with potential major loci or genes affecting some growth and carcass traits.     

A large indel mutation of the bovine ADD1/SREBP1c gene and its effects on growth traits in some native cattle breeds from China

Adipocyte determination and differentiation-dependent factor 1/sterol regulatory element-binding protein-1c (ADD1/SREBP1c) is a major determinant of tissue differential lipogenic capacity in mammalian and avian species. The objectives of the present study were to focus on insertion-deletion polymorphism (indel) in the bovine ADD1/SREBP1c gene, and analyzing its effect on growth traits in a sample of 1035 cattle belonging to four Chinese cattle breeds. PCR-SSCP, DNA sequencing and agarose electrophoresis methods were used. The 778 bp PCR products of ADD1/SREBP1c gene exhibited three genotypes and two alleles were revealed: W and D. Frequencies of the W allele varied from 0.8651 to 1.000. The associations of the 84 bp indel mutation of ADD1/SREBP1c gene with growth traits of 265 Nanyang cows were analyzed. The animals with genotype WD had significantly higher birth weight, body weight, average daily gain than those with genotype WW at birth, 6-, 12-, 18-, and 24-month old (P < 0.05 or P < 0.01). These results suggest that the indel mutation of bovine ADD1/SREBP1c gene may influence the growth traits in cattle.     

Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene

The detection method based on the mathematical expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3′ untranslated region (3′ UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle.     

A novel 18-bp deletion mutation of the AMPD1 gene affects carcass traits in Qinchuan cattle

The objectives of the present study were focused on detecting deletion mutation in bovine AMPD1 gene, and analyzing its effect on body measurement and carcass traits in Qinchuan cattle by using DNA sequencing and agarose electrophoresis methods. The 198-bp PCR products of AMPD1 gene exhibited three genotypes and two alleles were revealed: A and B. The frequencies of genotype AA/AB/BB in Qinchuan populations was 0.7163, 0.2233 and 0.0605. The χ²-test analysis demonstrated that the breed was not in agreement with Hardy–Weinberg equilibrium (P < 0.05). The association of the 18-bp deletion mutation of AMPD1 gene with body measurement and carcass traits of Qinchuan cattle were analyzed. The cattle with AA genotype had slaughter weight and carcass weight than those with genotype AB (P < 0.01 or P < 0.05). These results suggest that the 18-bp deletion mutation may influence the carcass traits in Qinchuan cattle.     

Associations of <Emphasis Type="Italic">GHSR</Emphasis> gene polymorphisms with chicken growth and carcass traits

Ghrelin receptor (GHSR), or growth hormone secretagogue receptor, modulates many physiological effects by binding to its ligand and therefore is a candidate gene for chicken production performance. In this study, five polymorphisms (four SNP and a ‘GGTACA’ indel) of GHSR gene were genotyped in a F₂ full sib chicken population to investigate their associations with production traits. Results showed that c.739 + 726T > C (M2) was significantly associated with body weight (BW) at 28 days (BW28), BW90, dressed weight, eviscerated weight, eviscerated weight with giblet, breast muscle weight and leg muscle weight (P < 0.05). Meanwhile, T allele rather than C was positive for chicken body weight gain as individuals with CC had the lowest value of all traits. Otherwise, no significant association of c.264G > A (M1), c.3211-196_3211-181delGGTACA (M3), c.3211 + 75C > T (M4), and c.3211 + 150C > T (M5) with any growth and carcass traits was found. Haplotypes based on five polymorphisms were significantly associated with hatch weight, BW7, BW14, BW21 and breast angle (P < 0.05), as well as BW28 (P < 0.01). Therefore, it was concluded that M2 of the GHSR gene and the analyzed haplotypes were associated with some chicken growth and carcass traits.     

A novel single nucleotide polymorphism in exon 7 of LPL gene and its association with carcass traits and visceral fat deposition in yak (Bos grunniens) steers

Lipoprotein lipase (LPL) is considered as a key enzyme in the lipid deposition and metabolism in tissues. It is assumed to be a major candidate gene for genetic markers in lipid deposition. Therefore, the polymorphisms of the LPL gene and associations with carcass traits and viscera fat content were examined in 398 individuals from five yak (Bos grunniens) breeds using PCR–SSCP analysis and DNA sequencing. A novel nucleotide polymorphism (SNP)-C→T (nt19913) was identified located in exon 7 in the coding region of the LPL gene, which replacement was responsible for a Phe-to-Ser substitution at amino acid. Two alleles (A and B) and three genotypes designed as AA, AB and BB were detected in the PCR products. The frequencies of allele A were 0.7928, 0.7421, 0.7357, 0.6900 and 0.7083 for Tianzhu white yak (WY), Gannan yak (GY), Qinghai-Plateau yak (PY), Xinjiang yak (XY) and Datong yak (DY), respectively. The SNP loci was in Hardy–Weinberg equilibrium in five yak populations (P > 0.05). Polymorphism of LPL gene was shown to be associated with carcass traits and lipid deposition. Least squares analysis revealed that there was a significant effect on live-weight (LW) (P < 0.01), average daily weight gain (ADG) and carcass weight (P < 0.05). Individuals with genotype BB had lower mean values than those with genotype AA and AB for loin eye area and viscera fat weight (% of LW) in 25–36 months (P < 0.05). The results indicated that LPL gene is a strong candidate gene that affects carcass traits and fat deposition in yak.     

Polymorphism of the prion protein gene (<Emphasis Type="Italic">PRNP</Emphasis>) in two Chinese indigenous cattle breeds

Prion protein (PRNP) gene has been located at position q17 of chromosome 13 in cattle. The polymorphisms of PRNP gene might be associated with BSE susceptibility. In the present work, we investigated the polymorphisms of PRNP gene, including SNP in exon 3, 23-bp indel in promoter region, 12-bp indel in intron 1 in 2 Chinese indigenous cattle breeds of northeast China. Eighty-six animals from Yanbian (34) and Chinese Red Steppes (52) were genotyped at PRNP locus by analyzing genomic DNA. A total of 4 single nucleotide polymorphism (SNP) sites were revealed in the PRNP gene exon 3 of the 2 cattle breeds investigated. Three of these SNPs were non-synonymous mutations that resulted in the amino acid exchanges (K119N, S154N, and M177V), and one is silent nucleotide substitutions (A234G). The two amino acid mutations of S154N and M177V were detected only in Yanbian with a very low frequency (0.0147), and they appears to be absent in Chinese Red Steppes. The average gene heterozygosity (H _e), effective allele numbers (N _e), Shannon’s information index (I) and polymorphism information content (PIC) were 0.3088, 1.5013, 0.3814 and 0.2000 in Yanbian, respectively, being relatively higher than that of Chinese Red Steppes (0.2885, 1.4985, 0.3462 and 0.1873, respectively). In 23-bp indel and 12-bp indel loci, three different genotypes were identified in both Yanbian and Chinese Red Steppes breeds. Based 23- and 12-bp indels, four haplotypes was constructed in the 2 Chinese cattle breeds, of which the 23-bp (−)/12-bp (−) was main haplotypes accounting for more than 50% of the total in both Yanbian and Chinese Red Steppes breeds. These results might be useful in understanding the genetic characteristics of PRNP gene in Chinese indigenous cattle breeds.     

MicroRNAs-1614-3p gene seed region polymorphisms and association analysis with chicken production traits

In the present study, a total of 860 chickens from a Gushi–Anka F₂ resource population were used to evaluate the genetic effect of the gga-miR-1614-3p gene. A novel, silent, single nucleotide polymorphism (SNP, +5 C>T) was detected in the gga-miR-1614-3p gene seed region through AvaII polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) and PCR products sequencing methods. Associations between the SNP and chicken growth, meat quality and carcass traits were performed by association analysis. The results showed that the SNP was significantly associated with breast muscle shear force and leg muscle water loss rate, wing weight, liver weight and heart weight (p?<?0.05), and highly significantly associated with the weight of the abdominal fat (p?<?0.01). The secondary structure of gga-miR-1614 and the free energy were altered due to the variation predicted by the M-fold program.     

Functional analysis of chick heparan sulfate 6‐O‐sulfotransferases in limb bud development

Heparan sulfate (HS) interacts with numerous growth factors, morphogens, receptors, and extracellular matrix proteins. Disruption of HS synthetic enzymes causes perturbation of growth factor signaling and malformation in vertebrate and invertebrate development. Our previous studies show that the O‐sulfation patterns of HS are essential for the specific binding of growth factors to HS chains, and that depletion of O‐sulfotransferases results in remarkable developmental defects in Drosophila, zebrafish, chick, and mouse. Here, we show that inhibition of chick HS‐6‐O‐sulfotransferases (HS6ST‐1 and HS6ST‐2) in the prospective limb region by RNA interference (RNAi) resulted in the truncation of limb buds and reduced Fgf‐8 and Fgf‐10 expressions in the apical ectodermal ridge and in the underlying mesenchyme, respectively. HS6ST‐2 RNAi resulted in a higher frequency of limb truncation and a more marked change in both Fgf‐8 and Fgf‐10 expressions than that achieved with HS6ST‐1 RNAi. HS6ST‐1 RNAi and HS6ST‐2 RNAi caused a significant but distinct reduction in the levels of different 6‐O‐sulfation in HS, possibly as a result of their different substrate specificities. Our data support a model where proper levels and patterns of 6‐O‐sulfation of HS play essential roles in chick limb bud development.     

A promoter polymorphism of <Emphasis Type="Italic">MSTN</Emphasis> g.−371T>A and its associations with carcass traits in Korean cattle

A promoter polymorphism of bovine Myostatin (MSTN) gene g.−371T>A was screened in Holstein and two Korean indigenous cattle breeds, Hanwoo and Jeju Black cattle (JBC). The MSTN g.−371T>A polymorphism was found in all three cattle breeds tested. An allele MSTN g.−371A was the most frequent in the JBC breed among breeds tested. The association of MSTN genotypes for carcass traits was also tested in the Hanwoo population. Significant differences were found between the genotypes and level of meat quality grade index which converted the marbling score levels (P < 0.05), reflecting the metabolic role of MSTN for inhibition of preadipocyte differentiation in intramuscular fat deposition. In addition, significant differences were found for fat color index of backfat according to MSTN genotypes (P < 0.05), suggesting that MSTN may play a role in deposition of white-yellow adipocytes in backfat. However, there was no detection of significant association of genotypes with the live weight, carcass weight, backfat thickness, eye muscle area, marbling score, or meat color index (P > 0.05). Despite the lack of statistical association, wild type g.−371T/-showed association patterns similar to those of A/A homozygotes, such as heavier weights, thinner backfat, larger eye muscle area, and lower marbling score. The results of the present study suggest that MSTN promoter polymorphism g.−371T>A may affect carcass traits, which could be a useful molecular marker for planning improvements in the economic traits of Korean cattle breeds.     

Associations between single nucleotide polymorphisms in 33 candidate genes and meat quality traits in commercial pigs

This study aimed to evaluate the effects of single nucleotide polymorphisms (SNPs) in candidate genes for meat quality using a custom 96‐SNP panel (Illumina Vera Code GoldenGate Assay) on 15 traits collected from 400 commercial pigs. Meat quality measurements included muscle pH, color (L*, a* and b*), drip loss, cooking loss, peak shear force and six sensory traits including appearance (outside and inside), tenderness, juiciness, flavor and overall liking as well as carcass weight and probe yield. Thirty‐five SNPs with minor allele frequencies > 0.10 remained for the multimarker association using the GLM procedure of sas 9.2. Results showed that 20 SNPs were significantly associated with at least one of the traits with either additive or dominance or both effects (P < 0.05). Among these significant SNPs, five of them in ADIPOQ, FTO, TNF, LEPR and AMPD1 had an effect on more than three traits simultaneously; those in MC4R, CAST, DGAT1 and MYF6 had an effect on two traits, while the others were associated with one trait. The results suggest that these markers could be incorporated into commercial pigs for marker‐assisted selection and breeding programs for carcass and meat quality trait improvement.     

Association of HLA-G 3' UTR 14-bp insertion/deletion polymorphism with hepatocellular carcinoma susceptibility in a Chinese population

The 14-bp insertion/deletion (indel) polymorphism located in the 3' UTR of the human leukocyte antigen-G (HLA-G) gene plays a role in several autoimmune and chronic inflammatory diseases. HLA-G expression is associated with hepatocellular carcinoma (HCC) prognosis, especially in early stage, with high expression independently associated with shortened overall survival and increased tumor recurrence. In the present study, we carried out a case-control study in a Chinese population (318 cases and 599 controls) to estimate the susceptibility to HCC associated with the 14-bp indel polymorphism. Logistic regression analysis showed that the heterozygote and the homozygote 14-bp ins/ins confer a lower risk of HCC (adjusted OR?=?0.75, 95% CI: 0.57-1.01, p?=?0.061; OR?=?0.54, 95% CI: 0.30-0.98, p?=?0.031, respectively). Hepatitis B virus (HBV) stratification analysis showed that the associations were stronger in the HBV-positive population. Immunohistochemical analysis further showed that HLA-G expression in HCC tissues with 14-bp del/del genotype was more prominent than for heterozygous and 14-bp ins/ins genotype (p?相似文献   

Association between leptin gene polymorphisms and growth traits in Limousin cattle

A total of 129 Limousin calves were used to investigate how leptin gene polymorphisms affect growth traits, such as body weight, average daily gain, wither height, sacrum height and chest girth in beef cattle. Two single nucleotide polymorphisms (SNPs) were genotyped, including the Sau3AI polymorphism in intron 2 and the A59V polymorphism in exon 3. The genotype and allele frequencies for each SNP and the haplotype frequencies for both SNPs were estimated in the studied herd. Statistical analysis revealed that the A59V polymorphism significantly affected the body weight at 210 days of age (P ≤ 0.01) and the average daily gain between 3 and 210 days of age (P ≤ 0.05) with T as a desirable allele. No associations were observed between the Sau3AI polymorphism and the growth traits mentioned above. However, the average daily gain between 3 and 210 days of age was significantly higher in the CT/CT haplotype animals compared with the CC/CC and CC/CT individuals. These results indicated that selection for the A59V TT animals might contribute to an improved body weight in Limousin cattle. The article is published in the original.