Properties of feline leukemia virus. III. Analysis of the RNA.

The kinetics of virus labeling was used to study the maturation of viral RNA in the Rickard strain of feline leukemia virus. Viral RNA labeled over differing intervals was characterized by gel electrophoresis and velocity sedimentation in sucrose gradients made up in aqueous buffer and 99% dimethyl sulfoxide. Labeled virus was found within 30 min after adding radioactive uridine to the cells and production of labeled virus reached a maximum at 4 to 5 h after pulse labeling. Native RNA from feline leukemia virus resolved into three size classes when analyzed by electrophoresis on 2.0% polyacrylamide-0.5% agarose gels: a 6.2 x 10(6) to 7.1 x 10(6) mol wt (50 to 60S) class, an 8.7 x 10(4) mol wt (approximately 8S) class, and a 2.5 x 10(4) mol wt (4 to 5S) class. From two experiments during which RNA degradation appeared minimal, these made up to 57 to 76%, 2 to 5%, and 6 to 12%, respectively, of the total RNA. The 8S RNA in feline leukemia virus has not previously been reported. The 50 to 60S RNA from virus harvested after 4 h of labeling electrophoretically migrated faster and sedimented more slowly in sucrose gradients than did the same RNA species harvested after 20 h of labeling. This argues for an intravirion modification of the high-molecular-weight RNA. The large subunits of denatured viral RNA from both 4- and 20-h labeled-viral RNA electrophoretically migrated with an estimated molecular weight of 3.2 x 10(6) but sedimented with 28S ribosomal RNA (1.8 X 10(6) mol wt) when analyzed by velocity sedimentation through 99% dimethyl sulfoxide.     

Nucleotide sequence of 5-S RNA from Bacillus licheniformis.

The complete nucleotide sequence of 5-S RNA from Bacillus licheniformis was determined by analysis of complete and partial digests obtained with either T1 or pancreatic ribonuclease. The molecule was found to have a length of 116 nucleotides and may possess a minor sequence heterogeneity. There is a large degree of homology between the sequence of B. licheniformis 5-S RNA and those published for 5-S RNA from B. megatherium and B. stearothermophilus. The difference between the three 5-S RNA species are limited mainly to the two terminal and one internal sequence. B. licheniformis 5-S RNA contains the sequence U95-G-A-G-A-G100, which in B. subtilis has been implicated in the processing of precursor 5-S RNA. Possible models for the secondary structure of prokaryotic 5-S RNA are discussed on the basis of the results of limited digestion of B. licheniformis 5-S RNA by ribonuclease T1.     

Cucumber mosaic virus-associated RNA 5. VI. Characterization and denaturation-renaturation behavior of the double-stranded form.

The double-stranded form of cucumber mosaic virus-associated RNA 5 has been purified and further characterized. Its molecular weight determined by sedimentation equilibrium is 2.15 . 10(5). The buoyant density calculated from its symmetrical distribution in Cs2SO4, following isopycnic ultracentrifugation, is 1.615 g/cm3. The sedimentation rate of double-stranded cucumber mosaic virus-associated RNA 5 is slightly greater than that of cucumber mosaic virus-associated RNA 5; its electrophoretic mobility in polyacrylamide gel (2.4%) is less than that of cucumber mosaic virus-associated RNA 5. By the above standards the double-stranded cucumber mosaic virus-associated RNA 5 preparations used were found to be nomogeneous in size as well as density. Thermal denaturation monitored by means of ultraviolet light absorption produced multitransitional denaturation profiles. The average melting temperature (Tm) was 88 degrees C in 0.1 x SSC. Monotransitional denaturation profiles and slightly higher Tm values were obtained when resistance against ribonuclease digestion was measured. These denaturation experiments and other propertied led to the conclusion that double-stranded cucumber mosaic virus-associated RNA 5 and the double-stranded form of peanut stunt virus-associated RNA 5 are small double-stranded nucleic acids with several homostable base-pair regions, characterized by distinct G + C contents and Tm values.     

Purification of wheat germ RNA ligase. I. Characterization of a ligase-associated 5'-hydroxyl polynucleotide kinase activity

An RNA ligase that catalyzes the formation of a 2'-phosphomonoester-3',5'-phosphodiester bond in the presence of ATP and Mg2+ was purified approximately 6000-fold from raw wheat germ. A 5'-hydroxyl polynucleotide kinase activity copurified with RNA ligase through all chromatographic steps. Both activities cosedimented upon glycerol gradient centrifugation even in the presence of high salt and urea. RNA ligase and kinase activities sedimented as a single peak on glycerol gradients with a sedimentation coefficient of 6.2 S. The purified polynucleotide kinase activity required dithiothreitol and a divalent cation for activity and was inhibited by pyrophosphate and by ADP. The kinase phosphorylated a variety of 5'-hydroxyl-terminated polynucleotide chains including some that were substrates for the RNA ligase (e.g. 2',3'-cyclic phosphate-terminated poly(A)) and others that were not ligase substrates (e.g. DNA or RNA containing 3'-hydroxyl termini). RNA molecules containing either 5'-hydroxyl or 5'-phosphate and 2',3'-cyclic or 2'-phosphate termini were substrates for the purified RNA ligase activity. The rate of ligation of 5'-hydroxyl-terminated RNA chains was greater than that of 5'-phosphate-terminated molecules, suggesting that an interaction between the wheat germ kinase and ligase activities occurs during the course of ligation.     

Oligonucleotide sequences of pancreatic and T1 ribonuclease digests of 5S ribosomal RNA from mouse cells.

Oligonucleotides produced by complete pancreatic and T1 RNase digestion of 5S ribosomal RNA from a mouse hepatoma, MH 134, have been separated with two-dimensional electrophoresis and their nucleotide sequences determined. Except for the presence of a 5'-terminal diphosphate, these nucleotide sequences were identical with those of KB cells, confirming the identity of the primary structure of 5S RNA between these animals. Both oligonucleotide patterns produced with these enzymes from 5S RNA of the liver were also identical with those of the hepatoma. All these agree with the strong conservation of 5S RNA genes in animal species. However, when 5S ribosomal RNA was extracted from ribosomes which were prepared from microsomal pellet, pancreatic RNase digest contained two trinucleotides (A-G-Cp and G-A-Cp) that were not found in 5S RNA prepared with a one-step procedure. It was concluded that different isolation procedure might indeed cause artifactual fragments on enzymatic digestion due to internal nicks produced during isolation. The significance of 5'-terminal diphosphate in relation to the biosynthesis of 5S ribosomal RNA is also discussed.     

Fragment of protein L18 from the Escherichia coli ribosome that contains the 5S RNA binding site.

A fragment of ribosomal protein L18 was prepared by limited trypsin digestion of a specific complex of L18 and 5S RNA. It was characterised for sequence and the very basic N-terminal region of the protein was found to be absent. No smaller resistant fragments were produced. 5S RNA binding experiments indicated that the basic N-terminal region, from amino acid residues 1 to 17, was not important for the L18-5S RNA association. Under milder trypsin digestion conditions three resistant fragments were produced from the free protein. The largest corresponded to that isolated from the complex. The smaller ones were trimmed slightly further at both N- and C-terminal ends. These smaller fragments did not reassociate with 5S RNA. It was concluded on the basis of the trypsin protection observations and the 5S RNA binding results that the region extending from residues 18 to 117 approximates to the minimum amount of protein required for a specific and stable protein-RNA interaction. The accessibility of the very basic N-terminal region of L18, in the L18-5S RNA complex, suggests that it may be involved, in some way, in the interaction of 5S RNA with 23S RNA.     

Chemical reactivity of E. coli 5S RNA in situ in the 50S ribosomal subunit.

E. coli 50S ribosomal subunits were reacted with monoperphthalic acid under conditions in which non-base paired adenines are modified to their 1-N-oxides. 5S RNA was isolated from such chemically reacted subunits and the two modified adenines were identified as A73 and A99. The modified 5S RNA, when used in reconstitution of 50S subunits, yielded particles with reduced biological activity (50%). The results are discussed with respect to a recently proposed three-dimensional structure for 5S RNA, the interaction of the RNA with proteins E-L5, E-L18 and E-L25 and previously proposed interactions of 5S RNA with tRNA, 16S and 23S ribosomal RNAs.     

Cleavage of RNA in hybrid duplexes by ribonuclease H from E. coli. I. Substrate properties of complexes formed by RNA and tandem of short oligodeoxyribonucleotides

We studied the E. coli RNase H cleavage of a 5'-labeled RNA fragment within two hybrid duplexes with identical sequences, one of which is formed by RNA and a 20-mer oligodeoxyribonucleotide (RNA/p20), whereas the second, by RNA and a tandem of short oligodeoxyribonucleotides (octanucleotide: (RNA/tandem). It was shown that RNA in the RNA/p20 complex is hydrolyzed from the 3'-end to yield consecutively the 17-, 14-, 11-, 8-, and 5-mer 5'-labeled fragments. On hydrolysis of RNA in complex RNA/tandem, the same products were registered, but their accumulation rates in this case differed. Thus, the initial rates of accumulation of the 17- and 8-mer were close. Moreover, the accumulation of the final 5-mer differed considerably: in the RNA/tandem complex it appeared within first minutes of the reaction, but only after a considerable lag period in complex RNA/p20. These data testify that the tandem is involved not only in the consecutive accumulation of the shortened products (which is characteristic of complexes including extended oligonucleotides) but also in the parallel accumulation. This results from hydrolysis of each duplex segment formed by RNA and the short oligonucleotide of the tandem. Although the order of recognition and cleavage of RNA target by ribonuclease H depends on the type of the hybrid duplex, the destruction of RNA target within complex RNA/tandem and in complex with the full-size oligonucleotide occurs with a close effectiveness.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Gene encoding human Ro-associated autoantigen Y5 RNA.

Ro ribonucleoproteins are composed of Y RNAs and the Ro 60 kDa protein. While the Ro 60 kDa protein is implicated in an RNA discard pathway that recognizes 3'-extended 5S rRNAs, the function of Y RNAs remains unknown [O'Brien,C.A. and Wolin,S.L. (1995) Genes Dev. 8,2891-2903]. Y5 RNA occupies a large fraction of Ro 60 kDa protein in human Ro RNPs, contains an atypical 3'-extension not found on other Y RNAs, and constitutes an RNA antigen in certain autoimmune patients [Boulanger et al. (1995) Clin. Exp. Immunol. 99, 29-36]. An overabundance of Y RNA retroposed pseudogenes has previously complicated the isolation of mammalian Y RNA genes. The source gene for Y5 RNA was isolated from human DNA as well as from Galago senegalis DNA. Authenticity of the hY5 RNA gene was demonstrated in vivo and its activity was compared with the hY4 RNA gene that also uses a type 3 promoter for RNA polymerase III. The hY5 RNA gene was subsequently found to reside within a few hundred thousand base pairs of other Y RNA genes and the linear order of the four human Y RNA genes on chromosome 7q36 was determined. Phylogenetic comparative analyses of promoter and RNA structure indicate that the Y5 RNA gene has been subjected to positive selection during primate evolution. Consistent with the proposal of O'Brien and Harley [O'Brian,C.A. and Wolin,S.L. (1992) Gene 116, 285-289], analysis of flanking sequences suggest that the hY5 RNA gene may have originated as a retroposon.     

Interaction of RNA with transformed glucocorticoid receptor. I. Isolation and purification of the RNA

The glucocorticoid receptor (GR) from mouse AtT-20 pituitary tumor cells, when transformed using a variety of in vitro protocols, yields a DNA-binding RNA-containing 6 S form. In order to better understand the physiological role of RNA interaction with the transformed GR, we have isolated and purified the putative RNA from AtT-20 cells. [3H]Triamcinolone acetonide-labeled cytosolic GR was transformed, using Sephadex G-25 filtration, to yield the RNA-containing 6 S GR. The transformed 6 S GR was separated on DEAE-cellulose into the 4 S GR (eluting at about 100 mM KCl) while its associated RNA eluted at 0.30-0.45 M KCl. The addition of only these RNA fractions to the 4 S GR can reconstitute 6 S GR as shown on 5-20% sucrose gradients. RNA (0.3-0.45 M KCl fractions) was further purified by hydroxylapatite chromatography, and the bound RNA (eluted at approximately 70 mM PO4(-2)) was then loaded onto preparative 5-20% sucrose gradients to separate RNA on the basis of size (sedimentation rate). A uniform class of RNA sedimenting at 4 S was obtained and then adsorbed to oligo(dT)-cellulose columns. The unbound fraction (poly(A-)) was capable of shifting 4 S GR to 6 S. Using these chromatographic procedures about 90% of the cellular RNA, incapable of reconstituting the 6 S GR from the 4 S form, was eliminated. The 4 S GR was covalently cross-linked with the purified RNA (termed PIVB RNA) using formaldehyde. The resulting cross-linked GR X RNA complexes were shown to sediment at the density of ribonucleoprotein (1.38 g/cm3) in CsCl gradients and at the 6 S position in high salt sucrose gradients. The hydrolysis of PIVB RNA with ribonuclease A prevented the formation of high salt-resistant ribonucleoprotein complexes, indicating that the GR may be in close contact with PIVB RNA. Electrophoresis of the PIVB RNA on 5% agarose-formaldehyde-denaturing gels yielded one major band with a molecular size of approximately 75 bases. It thus appears that an endogenous 4 S RNA (PIVB RNA) of about 25 kDa specifically interacts with the monomeric 4 S GR to yield the 6 S GR.