Accessibility of phosphodiester bonds in the yeast ribosomal 5 S RNA protein complex

The tertiary structure of the protein-associated yeast ribosomal 5 S RNA was examined using ethylnitrosourea reactivity as a probe for phosphodiester bonds. A reduced reactivity was consistently observed in at least nine residues within four distinct regions of the RNA sequence. Seven of these were also observed in three regions of the free RNA molecule while two, A27 and G30, were only present in the ribonucleoprotein complex. The results strongly suggest that the tertiary structure of the free eukaryotic 5 S RNA is largely conserved in the 5 S RNA-protein complex although it appears to be further stabilized in interaction with the ribosomal protein.     

Letters to the editor: Accessibility of 5 S RNA in 50 S ribosomal subunits

Only two sites in 5 S RNA react with Kethoxal in 50 S ribosomal subunits. These two sites, G₁₃ and G₄₁, have previously been found to be accessible in free 5 S RNA. Nucleotide sequences which have been suggested as possible binding sites for the T-ψ-C-G loop of tRNA are not accessible.     

The involvement of 5S RNA in the binding of tRNA to ribosomes

The tRNA fragment TpψpCpGp was found to bind to 5S RNA. This binding is ten times increased when a specific 5S RNA-protein complex is used. The ability of TpψpCpGp to bind to the complex could be abolished by selective chemical modification of two adenines in 5S RNA. Such 5S RNA, when incorporated into 50S ribosomal subunits, yielded particles with greatly reduced biological activities. From the results presented we conclude that 5S RNA is most likely part of a site with which the TψC-loop of tRNA interacts on the ribosome.     

Sequence and conformation of 5 S RNA from Chlorella cytoplasmic ribosomes: comparison with other 5 S RNA molecules

The sequence of Chlorella cytoplasmic 5 S RNA has been determined by fingerprinting techniques. Partial digests were fractionated by a two-dimensional acrylamide gel electrophoretic technique, which indicates whether specific fragments are paired in the molecule. In this way, the four main base-paired regions of the molecule were located. The sequence of Chlorella cytoplasmic 5 S RNA is related to, but different from, that of other eukaryotic 5 S RNAs: it shows approximately 60% homology with vertebrate 5 S RNA and 40% homology with yeast 5 S RNA. In some respects the conformation of the molecule in solution is quite different from that of other sequenced 5 S RNAs: in particular, the highly accessible region found around position 40 in all other 5 S RNAs (prokaryotic and eukaryotic) does not exist in this molecule.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Partial melting of the segment around pseudouridine in yeast 5S RNA

Pseudouridine in yeast 5S RNA was modified with 4-bromomethyl-7-methoxy-coumarin(BMC). Temperature dependence of fluorescence intensity was measured at various concentrations of Mg2+ and K+ cations. Hyperchromicity was also measured. At 100mM KCl and 10mM Mg2+, fluorescence intensity decreased with temperature as free BMC except a plateau at 45 degrees C. Withdrawal of Mg2+ from the buffer resulted in a large quenching at 20 degrees C and showed a gradual increase of fluorescence intensity with temperature, indicating a partial melting of the segment around pseudouridine. The temperature range agrees with the low melting temperature shown by hyperchromicity. In 10 mM KCl solution, the effects are more exaggerated.     

Nuclease S1 mapping of 16S ribosomal RNA in ribosomes

Escherichia coli 16S rRNA and 16S-like rRNAs from other species have several universally conserved sequences which are believed to be single-stranded in ribosomes. The quantitative disposition of these sequences within ribosomes is not known. Here we describe experiments designed to explore the availability of universal 16S rRNA sequences for hybridization with DNA probes in 30S particles and 70S ribosomes. Unlike previous investigations, quantitative data on the accessibility of DNA probes to the conserved portions of 16S rRNA within ribosomes was acquired. Uniquely, the experimental design also permitted investigation of cooperative interactions involving portions of conserved 16S rRNA. The basic strategy employed ribosomes, 30S subunits, and 16S rRNAs, which were quantitatively analyzed for hybridization efficiency with synthetic DNA in combination with nuclease S1. In deproteinated E. coli 16S rRNA and 30S subunits, the regions 520-530, 1396-1404, 1493-1504, and 1533-1542 are all single-stranded and unrestricted for hybridization to short synthetic DNAs. However, the quantitative disposition of the sequences in 70S ribosomes varies with each position. In 30S subunits there appear to be no cooperative interactions between the 16S rRNA universal sequences investigated.     

Interaction of the 5′-ends of 28S RNA in dimerization of hamster ribosomes

Free ribosomes extracted from hamster cells and 28S RNA purified from these ribosomes are known to form dimers. We find that spleen phosphodiesterase inhibits ribosomal dimer formation, but only when a free 5′-hydroxyl end group, produced by the action of alkaline phosphatase, is present. Hence, formation of dimer ribosomes probably involves interaction at or near the phosphorylated 5′-ends of 28S RNA. Dimer RNA molecules show a modal length, when measured on electron micrographs, of 2.1μm, which is about double the length of 28S RNA. Electron micrographs of 115S dimer ribosomes often show profiles consistent with our interpretation that in dimers the 28S RNA chains are loosely linked by their 5′-ends.     

The 5-S RNA binding protein from yeast (Saccharomyces cerevisiae) ribosomes. Evolution of the eukaryotic 5-S RNA binding protein.

The ribonucleoprotein complex between 5-S RNA and its binding protein (5-S RNA . protein complex) of yeast ribosomes was released from 60-S subunits with 25 mM EDTA and the protein component was purified by chromatography on DEAE-cellulose. This protein, designated YL3 (Mr = 36000 on dodecylsulfate gels), was relatively insoluble in neutral solutions (pH 4--9) and migrated as one of four acidic 60-S subunit proteins when analyzed by the Kaltschmidt and Wittman two-dimensional gel system. Amino acid analyses indicated lower amounts of lysine and arginine than most ribosomal proteins. Sequence homology was observed in the N terminus of YL3, and two prokaryotic 5-S RNA binding proteins, EL18 from Escherichia coli and HL13 from Halobacterium cutirubrum: Ala1-Phe2-Gln3-Lys4-Asp5-Ala6-Lys7-Ser8-Ser9-Ala10-Tyr11-Ser12-Ser13-Arg14-Phe15-Gln16-Tyr17-Pro18-Phe19-Arg20-Arg21-Arg22-Arg23-Glu24-Gly25-Lys26-Thr27-Asp28-Tyr29-Tyr35; of particular interest was homology in the cluster of basic residues (18--23). Since the protein contained one methionine residue it could be split into two fragments, CN1 (Mr = 24700) and CN2 (Mr = 11300) by CNBr treatment; the larger fragment originated from the N terminus. The N-terminal amino acid sequence of CN2 shared a limited sequence homology with an internal portion of a second 5-S RNA binding protein from E. coli, EL5, and, based also on the molecular weights of the proteins and studies on the protein binding sites in 5-S RNAs, a model for the evolution of the eukaryotic 5-S RNA binding protein is suggested in which a fusion of the prokaryotic sequences may have occurred. Unlike the native 5-S RNA . protein complex, a variety of RNAs interacted with the smaller CN2 fragment to form homogeneous ribonucleoprotein complexes; the results suggest that the CN1 fragment may confer specificity on the natural 5-S RNA-protein interaction.     

Dissociation of yeast 80 S ribosomes by chaotropic salts

Exposure of yeast 80 S ribosomes to chaotropic salts such as NaClO₄ or NaSCN at concentrations as low as 0.4 M resulted in complete dissociation and subsequent aggregation of the ribosomal proteins. However, under similar conditions, both NaCl and NaBr did not cause dissociation and aggregation. The protein precipitate obtained by exposing the ribosomes to 0.5 M NaClO₄ was free of any rRNA contamination as judged by ultraviolet-absorption analysis. Comparison of the two-dimensional polyacrylamide gel electrophoretic analysis of the above ribosomal protein precipitate with that ribosomal proteins isolated by the standard acetic acid extraction procedure revealed that the protein precipitate contained all the ribosomal proteins. Based on these results, a simple method for the isolation of total ribosomal proteins and rRNA under mild, nondenaturing conditions is proposed. A possible mechanism for the dissociation of proteins from the ribosome by chaotropic salts is also discussed.     

5.3 S RNA is a discrete cleavage product from the 5′-terminus of 18 S RNA of rat liver ribosomes

A 5.3 S RNA species observed in urea-gel electrophoretic analysis of the RNA of the small ribosomal subunit of rat liver has been identified from its sequence as the 5′-terminal 133–134 base fragment of 18 S RNA. Presumably it is cleaved by an endogenous endonuclease when the ribosomal subunits are dissociated, because it usually is not observed in 18 S RNA obtained by direct extraction of cells or tissues.     

Determination of base pairing in yeast 5S and 5.8S RNA infrared spectroscopy.

Infrared Spectroscopy was used to determine the numbers of base pairs for yeast 5S RNA and 5.8S RNA. The spectra were recorded at 20 degrees C and 50 degrees C, where tertiary interactions are assumed to be of less importance. It may be concluded that the structure of both RNAs is highly ordered and that there are large contributions of tertiary interactions. The results are compared with data derived from structural models that were proposed in the literature as well as with data previously published for prokaryotic 5S RNAs.