Sam68 RNA binding protein is an in vivo substrate for protein arginine N-methyltransferase 1

RNA binding proteins often contain multiple arginine glycine repeats, a sequence that is frequently methylated by protein arginine methyltransferases. The role of this posttranslational modification in the life cycle of RNA binding proteins is not well understood. Herein, we report that Sam68, a heteronuclear ribonucleoprotein K homology domain containing RNA binding protein, associates with and is methylated in vivo by the protein arginine N-methyltransferase 1 (PRMT1). Sam68 contains asymmetrical dimethylarginines near its proline motif P3 as assessed by using a novel asymmetrical dimethylarginine-specific antibody and mass spectrometry. Deletion of the methylation sites and the use of methylase inhibitors resulted in Sam68 accumulation in the cytoplasm. Sam68 was also detected in the cytoplasm of PRMT1-deficient embryonic stem cells. Although the cellular function of Sam68 is unknown, it has been shown to export unspliced human immunodeficiency virus RNAs. Cells treated with methylase inhibitors prevented the ability of Sam68 to export unspliced human immunodeficiency virus RNAs. Other K homology domain RNA binding proteins, including SLM-1, SLM-2, QKI-5, GRP33, and heteronuclear ribonucleoprotein K were also methylated in vivo. These findings demonstrate that RNA binding proteins are in vivo substrates for PRMT1, and their methylation is essential for their proper localization and function.     

Ablation of the Sam68 RNA binding protein protects mice from age-related bone loss

The Src substrate associated in mitosis of 68 kDa (Sam68) is a KH-type RNA binding protein that has been shown to regulate several aspects of RNA metabolism; however, its physiologic role has remained elusive. Herein we report the generation of Sam68-null mice by homologous recombination. Aged Sam68^−/− mice preserved their bone mass, in sharp contrast with 12-month-old wild-type littermates in which bone mass was decreased up to approximately 75%. In fact, the bone volume of the 12-month-old Sam68^−/− mice was virtually indistinguishable from that of 4-month-old wild-type or Sam68^−/− mice. Sam68^−/− bone marrow stromal cells had a differentiation advantage for the osteogenic pathway. Moreover, the knockdown of Sam68 using short hairpin RNA in the embryonic mesenchymal multipotential progenitor C3H10T1/2 cells resulted in more pronounced expression of the mature osteoblast marker osteocalcin when differentiation was induced with bone morphogenetic protein-2. Cultures of mouse embryo fibroblasts generated from Sam68^+/+ and Sam68^−/− littermates were induced to differentiate into adipocytes with culture medium containing pioglitazone and the Sam68^−/− mouse embryo fibroblasts shown to have impaired adipocyte differentiation. Furthermore, in vivo it was shown that sections of bone from 12-month-old Sam68^−/− mice had few marrow adipocytes compared with their age-matched wild-type littermate controls, which exhibited fatty bone marrow. Our findings identify endogenous Sam68 as a positive regulator of adipocyte differentiation and a negative regulator of osteoblast differentiation, which is consistent with Sam68 being a modulator of bone marrow mesenchymal cell differentiation, and hence bone metabolism, in aged mice.     

Identification of a domain conferring nucleotide binding to the N-acetyl-d-glucosamine 2-epimerase (Renin binding protein)

Renin binding protein (RnBP), a cellular renin inhibitor, has been identified as the enzyme N-acetyl-D-glucosamine (GlcNAc) 2-epimerase. Our recent studies demonstrated that rat GlcNAc 2-epimerase has a ten-times higher affinity for ATP, dATP, and ddATP than the human enzyme [Takahashi, S. et al. (2001) J. Biochem. 130, 815-821]. To identify the domain conferring nucleotide binding to GlcNAc 2-epimerase, we constructed a series of chimeric enzymes successively replacing the three domains of the human enzyme (N-terminal, middle, and C-terminal domains) with the corresponding domains of the rat enzyme. Chimeras were expressed in Escherichia coli JM109 cells under the control of the Taq promoter. The purified chimeric enzymes had GlcNAc 2-epimerase activity and inhibited renin activity in a dose-dependent manner. The recombinant human and rat enzymes required catalytic amounts of ATP with apparent K(m) values of 73 and 5.5 microM, respectively. Chimeric enzymes of HHR, RHH, and RHR (H, human type domain; R, rat type domain) had nearly the same nucleotide specificity as the human GlcNAc 2-epimerase. On the other hand, HRR, HRH, and RRH chimeras had the same nucleotide specificity as the rat enzyme. These results indicate that the middle domain of the GlcNAc 2-epimerase molecule participates in the specificity for and binding of nucleotides, and that nucleotides are essential to form the catalytic domain of the enzyme.     

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.     

Selective translational repression of HIV-1 RNA by Sam68DeltaC occurs by altering PABP1 binding to unspliced viral RNA

Background

The formation of new infectious human immunodeficiency type 1 virus (HIV-1) mainly relies on the homo-multimerization of the viral structural polyprotein Pr55^Gag and on the recruitment of host factors. We have previously shown that the double-stranded RNA-binding protein Staufen 1 (Stau1), likely through an interaction between its third double-stranded RNA-binding domain (dsRBD3) and the nucleocapsid (NC) domain of Pr55^Gag, participates in HIV-1 assembly by influencing Pr55^Gag multimerization.

Results

We now report the fine mapping of Stau1/Pr55^Gag association using co-immunoprecipitation and live cell bioluminescence resonance energy transfer (BRET) assays. On the one hand, our results show that the Stau1-Pr55^Gag interaction requires the integrity of at least one of the two zinc fingers in the NC domain of Pr55^Gag but not that of the NC N-terminal basic region. Disruption of both zinc fingers dramatically impeded Pr55^Gag multimerization and virus particle release. In parallel, we tested several Stau1 deletion mutants for their capacity to influence Pr55^Gag multimerization using the Pr55^Gag/Pr55^Gag BRET assay in live cells. Our results revealed that a molecular determinant of 12 amino acids at the N-terminal end of Stau1 is necessary to increase Pr55^Gag multimerization and particle release. However, this region is not required for Stau1 interaction with the viral polyprotein Pr55^Gag.

Conclusion

These data highlight that Stau1 is a modular protein and that Stau1 influences Pr55^Gag multimerization via 1) an interaction between its dsRBD3 and Pr55^Gag zinc fingers and 2) a regulatory domain within the N-terminus that could recruit host machineries that are critical for the completion of new HIV-1 capsids.     

Phosphorylation of p68 RNA helicase regulates RNA binding by the C-terminal domain of the protein

We previously reported ATPase, RNA unwinding, and RNA-binding activities of recombinant p68 RNA helicase that was expressed in Escherichia coli. Huang et al. The recombinant protein bound both single-stranded (ss) and double-stranded (ds) RNAs. To further characterize the substrate RNA binding by p68 RNA helicase, we expressed and purified the recombinant N-terminal and C-terminal domains of the protein. RNA-binding property and protein phosphorylation of the recombinant domains of p68 were analyzed. Our data demonstrated that the C-terminal domain of p68 RNA helicase bound ssRNA. More interestingly, the C-terminal domain was a target of protein kinase C (PKC). Phosphorylation of the C-terminal domain of p68 abolished its RNA binding. Based on our observations, we propose that the C-terminal domain is an RNA substrate binding site for p68. The protein phosphorylation by PKC regulates the RNA binding of p68 RNA helicase, which consequently controls the enzymatic activities of the protein.     

Sik (BRK) phosphorylates Sam68 in the nucleus and negatively regulates its RNA binding ability

Sik (mouse Src-related intestinal kinase) and its orthologue BRK (human breast tumor kinase) are intracellular tyrosine kinases that are distantly related to the Src family and have a similar structure, but they lack the myristoylation signal. Here we demonstrate that Sik and BRK associate with the RNA binding protein Sam68 (Src associated during mitosis, 68 kDa). We found that Sik interacts with Sam68 through its SH3 and SH2 domains and that the proline-rich P3 region of Sam68 is required for Sik and BRK SH3 binding. In the transformed HT29 adenocarcinoma cell cell line, endogenous BRK and Sam68 colocalize in Sam68-SLM nuclear bodies (SNBs), while transfected Sik and Sam68 are localized diffusely in the nucleoplasm of nontransformed NMuMG mammary epithelial cells. Transfected Sik phosphorylates Sam68 in SNBs in HT29 cells and in the nucleoplasm of NMuMG cells. In functional studies, expression of Sik abolished the ability of Sam68 to bind RNA and act as a cellular Rev homologue. While Sam68 is a substrate for Src family kinases during mitosis, Sik/BRK is the first identified tyrosine kinase that can phosphorylate Sam68 and regulate its activity within the nucleus, where it resides during most of the cell cycle.     

Functional redundancy in the nonspecific RNA binding domain of a class I tRNA synthetase

The sequence of a 228-amino acid nonspecific RNA binding domain appended to the N terminus of a eukaryote tRNA synthetase is shown here to have two lysine-rich clusters (LRCs) that are functionally significant in vivo and in vitro. These two LRCs have unrelated sequences and are separated by a spacer of over 100 amino acids. By using a sensitive test for function in vivo, each LRC is shown to be sufficient in the absence of the other. This sufficiency requires fusion of the spacer to either of the LRCs. Experiments in vitro confirmed that the LRCs are each important for RNA binding. Thus, this nonspecific RNA binding domain has two dissimilar lysine-rich sequence elements that are functionally redundant. Further experiments suggest that this redundancy is not used to dock two molecules of RNA but rather to enhance the overall affinity for a single RNA molecule.     

Arginine methylation of Sam68 and SLM proteins negatively regulates their poly(U) RNA binding activity

Sam68 (Src substrate associated during mitosis) and its homologues, SLM-1 and SLM-2 (Sam68-like mammalian proteins), are RNA binding proteins and contain the arg-gly (RG) repeats, in which arginine residues are methylated by the protein arginine methyltransferase 1 (PRMT1). However, it remains unclear whether the arginine methylation affects an RNA binding. Here, we report that methylation of Sam68 and SLM proteins markedly reduced their poly(U) binding ability in vitro. The RG repeats of Sam68 bound poly(U), but arginine methylation of the RG repeats abrogated its poly(U) binding ability in vitro. Overexpression of PRMT1 increased arginine methylation of Sam68 and SLM proteins in cells, which resulted in a decrease of their poly(U) binding ability. The results suggest that the RG repeats conserved in Sam68 and SLM proteins may function as an auxiliary RNA binding domain and arginine methylation may eliminate or reduce an RNA binding ability of the proteins.     

Species barrier to RNA recognition overcome with nonspecific RNA binding domains.

We show here that nonspecific RNA-protein interactions can significantly enhance the biological activity of an essential RNA. protein complex. Bacterial glutaminyl-tRNA synthetase poorly aminoacylates yeast tRNA and, as a consequence, cannot rescue a knockout allele of the gene for the yeast homologue. In contrast to the bacterial protein, the yeast enzyme has an extra appended domain at the N terminus. Previously, we showed that fusion of this yeast-specific domain to the bacterial protein enabled it to function as a yeast enzyme in vivo and in vitro. We suggested that the novel yeast-specific domain contributed to RNA interactions in a way that compensated for the poor fit between the yeast tRNA and bacterial enzyme. Here we establish that the novel appended domain by itself binds nonspecifically to different RNA structures. In addition, we show that fusion of an unrelated yeast protein, Arc1p, to the bacterial enzyme also converts it into a functional yeast enzyme in vivo and in vitro. A small C-terminal segment of Arc1p is necessary and sufficient for this conversion. This segment was shown by others to have nonspecific tRNA binding properties. Thus, nonspecific RNA binding interactions in general can compensate for barriers to formation of a specific and essential RNA.protein complex.     

Identification of RNA binding sequences of Drosophila SR protein DX16

Dxl6 is a member of the Drosophila melanogaster SR protein family, a group of nuclear proteins that are both essential splicing factors and specific splicing regulators. To get more insight of Dx16 function, we generated the monoclonal antibody against Dx16 and determined its expression pattern and subcellular location. It is mainly expressed in the nucleus of CNS in Drosophila embryos. In order to investigate the RNA-binding specificity of Dxl6, Dxl6-binding RNAs were identified by SELEX screen by using recombinant Dxl6 N-terminus protein as the target. These RNAs contained a consensus motif. Some pre-mRNAs from the corresponding genes showed splicing defects in the Dxl6-P-element insertional mutant fly. These results indicate that Dxl6 has unique functions in the removal of some introns during development.     

Identification of a Sam68 Ribonucleoprotein Complex Regulated by Epidermal Growth Factor

Sam68, Src associated in mitosis of 68 kDa, is a known RNA-binding protein and a signaling adaptor protein for tyrosine kinases. However, the proteins associated with Sam68 and the existence of a Sam68 complex, its mass, and regulation are, however, unknown. Herein we identify a large Sam68 complex with a mass >1 MDa in HeLa cells that is composed of ∼40 proteins using an immunoprecipitation followed by a mass spectrometry approach. Many of the proteins identified are RNA-binding proteins and are known components of a previously identified structure termed the spreading initiation center. The large Sam68 complex is a ribonucleoprotein complex, as treatment with RNases caused a shift in the molecular mass of the complex to 200–450 kDa. Moreover, treatment of HeLa cells with phorbol 12-myristate 13-acetate or epidermal growth factor induced the disassociation of Sam68 from the large complex and the appearance of Sam68 within the smaller complex. Actually, in certain cell lines such as breast cancer cell lines MCF-7 and BT-20, Sam68 exists in equilibrium between a large and a small complex. The appearance of the small Sam68 complex in cells correlates with the ability of Sam68 to promote the alternative splicing of CD44 and cell migration. Our findings show that Sam68 exists in equilibrium in transformed cells between two complexes and that extracellular signals, such as epidermal growth factor stimulation, promote alternative splicing by modulating the composition of the Sam68 complex.     

Retardation of the G2-M phase progression on gene disruption of RNA binding protein Sam68 in the DT40 cell line

Genes encoding the NarG and NarH subunits of the molybdo-iron-sulfur enzyme, a nitrate reductase from a denitrifying halophilic euryarchaeota Haloarcula marismortui, were cloned and sequenced. An incomplete cysteine motif reminiscent of that for a [4Fe-4S] cluster binding was found in the NarG subunit, and complete cysteine arrangements for binding one [3Fe-4S] cluster and three [4Fe-4S] clusters were found in the NarH subunit. In conjunction with chemical, electron paramagnetic resonance, and subcellular localization analyses, we firmly establish that the H. marismortui enzyme is a new archaeal member of the known membrane-bound nitrate reductases whose homologs are found in the bacterial domain.     

Crystal structures of the armadillo repeat domain of adenomatous polyposis coli and its complex with the tyrosine-rich domain of Sam68

Adenomatous polyposis coli (APC) is a tumor suppressor protein commonly mutated in colorectal tumors. APC plays important roles in Wnt signaling and other cellular processes. Here, we present the crystal structure of the armadillo repeat (Arm) domain of APC, which facilitates the binding of APC to various proteins. APC-Arm forms a superhelix with a positively charged groove. We also determined the structure of the complex of APC-Arm with the tyrosine-rich (YY) domain of the Src-associated in mitosis, 68?kDa protein (Sam68), which regulates TCF-1 alternative splicing. Sam68-YY forms numerous interactions with the residues on the groove and is thereby fixed in a bent conformation. We assessed the effects of mutations and phosphorylation on complex formation between APC-Arm and?Sam68-YY. Structural comparisons revealed different modes of ligand recognition between the Arm domains of APC and other Arm-containing proteins.