Structure and unusual characteristics of a new family of transposable elements in the sea urchin Strongylocentrotus purpuratus.

The transposable element family TU of the sea urchin Strongylocentrotus purpuratus, a higher eucaryote, has recently been described (D. Liebermann, B. Hoffman-Liebermann, J. Weinthal, G. Childs, R. Maxson, A. Mauron, S.N. Cohen, and L. Kedes, Nature [London] 306:342-347, 1983). A member of this family, TU4, has an insertion, called ISTU4, of non-TU DNA. ISTU4 is a member of a family of repetitive sequences, which are present in some 1,000 copies per haploid S. purpuratus genome (B. Hoffman-Liebermann, D. Liebermann, L.H. Kedes, and S.N. Cohen, Mol. Cell. Biol. 5:991-1001, 1985). We analyzed this insertion to determine whether it is itself a transposable element. The nucleotide sequence of ISTU4 was determined and showed an unusual structure. There are four, approximately 150 nucleotides long, imperfect direct repeats followed by a single truncated version of these repeats. This region is bounded at either side by approximately 100-nucleotide-long sequences that are not related to each other or to the repeats. Nucleotide sequences at the boundaries of ISTU4-homologous and flanking regions in five genomic clones show that ISTU4 represents a family of sequences with discrete ends, which we call Tsp elements. We showed that the genomic locus that carries a Tsp element in one individual was empty in other individuals and conclude that Tsp elements are a new and different type of transposable element. Tsp elements lack two features common to most other transposable elements: Tsp integration does not result in the duplication of host DNA, and there are no inverted repeats at their termini, although short inverted repeats are present at a distance from the termini.     

TU elements: a heterogeneous family of modularly structured eucaryotic transposons.

We describe here a family of foldback transposons found in the genome of the higher eucaryote, the sea urchin Strongylocentrotus purpuratus. Two major classes of TU elements have been identified by analysis of genomic DNA and TU element clones. One class consists of largely similar elements with long terminal inverted repeats (IVRs) containing outer and inner domains and sharing a common middle segment that can undergo deletions. Some of these elements contain insertions. The second class is highly heterogeneous, with many different middle segments nonhomologous to those of the first-class and variable-sized inverted repeats that contain only an outer domain. The middle and insertion segments of both classes carry sequences that also are found unassociated from the inverted repeats at many other genomic locations. We conclude that the TU elements are modular structures composed of inverted repeats plus other sequence domains that are themselves members of different families of dispersed repetitive sequences. Such modular elements may have a role in the dispersion and rearrangement of genomic DNA segments.     

Nucleotide sequence of insertion sequence IS3411, which flanks the citrate utilization determinant of transposon Tn3411.

The nucleotide sequences of insertion sequences IS3411L (left) and IS3411R (right), present as direct terminal repeats in the citrate utilization of citrate utilization transposon Tn3411, and of IS3411 (generated by intramolecular recombination between IS3411L and IS3411R) were determined. The three IS3411 elements (IS3411R, IS3411L, and IS3411) were 1,309 base pairs long and identical in DNA sequence. IS3411 had 27-base-pair terminal inverted repeats with three bases mismatched and one long open reading frame (240 amino acids) that was proposed to be a transposase. Three polypeptides of 29,000, 27,000, and about 10,000 molecular weight, determined by IS3411, were identified in minicells. Since Tn3411 generates a 3-base-pair repeat upon integration, the nucleotide sequences of IS3411 were compared with those of IS3.     

<Emphasis Type="Italic">Pearl</Emphasis>, a Novel Family of Putative Transposable Elements in Bivalve Mollusks

Abstract While genome sequencing projects have discovered numerous types of transposable elements in diverse eukaryotes, there are many taxa of ecological and evolutionary significance that have received little attention, such as the molluscan class Bivalvia. Examination of a 0.7-MB genomic sequence database from the cupped oyster Crassostrea virginica revealed the presence of a common interspersed element, CvA. CvA possesses subterminal inverted repeats, a tandemly repeated core element, a tetranucleotide microsatellite region, and the ability to form stable secondary structures. Three other less abundant repetitive elements with a similar structure but little sequence similarity were also found in C. virginica. Ana-1, a repetitive element with similar features, was discovered in the blood ark Anadara trapezia by probing a genomic library with a dimeric repeat element contained in intron 2 of a minor globin gene in that species. All of these elements are flanked by the dinucleotide AA, a putative target-site duplication. They exhibit structural similarity to the sea urchin Tsp family and Drosophila SGM insertion sequences; in addition, they possess regions of sequence similarity to satellite DNA from several bivalve species. We suggest that the Crassostrea repetitive elements and Ana-1 are members of a new MITE-like family of nonautonomous transposable elements, named pearl. Pearl is the first putative nonautonomous DNA transposon to be identified in the phylum Mollusca.     

Nucleotide sequence analysis of the long terminal repeat of avian myeloblastosis virus and adjacent host sequences.

The nucleotide sequence of the integrated avian myeloblastosis virus long terminal repeat has been determined. The sequence is 385 base pairs long and is present at both ends of the viral DNA. The cell-virus junctions at each end consist of a 6-base-pair direct repeat of cell DNA next to the inverted repeat of viral DNA. The long terminal repeat also contains promoter-like sequences, an mRNA capping site, and polyadenylation signals. Several features of this long terminal repeat suggest a structural and functional similarity with sequences of transposable and other genetic elements. Comparison of these sequences with long terminal repeats of other avian retroviruses indicates that there is a great variation in the 3' unique sequence (U3), whereas the 5' specific sequences (U5) and the R region are highly conserved.     

Terminal repeats of the Drosophila transposable element copia: nucleotide sequence and genomic organization

We have determined the nucleotide sequence of the terminal regions of two members of the copia sequence family of D. melanogaster. The first 276 bp at one end of a copia element are repeated in direct orientation at its other end. The direct repeats on a single copia element are identical to each other, but they differ by two nucleotide substitutions between the two elements which were examined; this suggests that during transposition only one direct repeat of the parent element is used as a template for both direct repeats of the transposed element. Each direct repeat itself contain a 17 bp imperfectly matched inveted terminal repetition. The ends of copia show significant sequence homology both to the yeast Ty1 element and to the integrated provirus of avian spleen necrosis virus, two other eucaryotic elements known to insert at many different chromosomal locations. Analysis of the genomic organization of the direct repeat sequence demonstrates that it seldom, if ever, occurs unlinked to an entire copia element.     

Defining the beginning and end of KpnI family segments.

Comparison of the sequences at the ends of several newly cloned and full length members of the monkey KpnI family with one another and with previously described monkey and human segments defines the nucleotide sequence at the two termini. No terminal repeats either direct or inverted are noted within full length family members which may or may not be immediately flanked by direct repeats. At the 3' terminus, several family members have polyadenylation signals followed by a d(A)-rich stretch. The genomic frequency of segments within the full length element increases markedly from the 5' to the 3' terminus, consistent with the cloning of various truncated family members. One such truncated version joined to a low copy number DNA segment is inserted in monkey alpha-satellite where the combination appears to have been amplified in conjunction with the satellite itself.     

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.     

Repetitive sequences of the sea urchin genome: Distribution of members of specific repetitive families

Three repetitive sequence families from the sea urchin genome were studied, each defined by homology with a specific cloned probe one to a few hundred nucleotides long. Recombinant λ-sea urchin DNA libraries were screened with these probes, and individual recombinants were selected that include genomic members of these families. Restriction mapping, gel blot, and kinetic analyses were carried out to determine the organization of each repeat family. Sequence elements belonging to the first of the three repeat families were found to be embedded in longer repeat sequences. These repeat sequences frequently occur in small clusters. Members of the second repeat family are also found in a long repetitive sequence environment, but these repeats usually occur singly in any given region of the DNA. The sequences of the third repeat are only 200 to 300 nucleotides long, and are generally terminated by single copy DNA, though a few examples were found associated with other repeats. These three repeat sequence families constitute sets of homologous sequence elements that relate distant regions of the DNA.     

Structure and evolution of the Cinful retrotransposon family of maize.

A maize cDNA clone was isolated by virtue of its intense hybridization to total maize genomic DNA, indicating homology to highly repetitive sequences. Genomic homologues were identified and subcloned from an adh1-bearing maize yeast artificial chromosome (YAC). Sequencing revealed that the expressed sequence was part of a Ty3-gypsy-type retrotransposon. We discovered and sequenced two complete retrotransposons of this family, and named them Cinful elements because they are members of a family of maize retrotransposons including Zeon-1 and the first plant transposable element sequenced, the solo long terminal repeat (LTR) called Cin1. All are defective, as Cinful-1 and Cinful-2 elements lack gag and Zeon-1 lacks pol homology. Despite the apparent lack of an intact "autonomous" element, the Cinful family has expanded to a copy number of about 18 000, representing just under 9% of the maize genome. Both point mutations and major rearrangements, including possible gene acquisition, differentiate members of the Cinful family. Cinful family members were found to have an unusual feature that we also observed in two other Ty3-class retrotransposons of teosinte and tobacco: related tandem repeats that separate their internal domains with a gag- or pol-containing homology from a 3' segment of unknown function. The conserved and variable features identified provide insights into the origin, mutational history, and functional components of this major constituent of the maize genome.     

Human transposon-like elements insert at a preferred target site: evidence for a retrovirally mediated process.

Members of the human transposon-like family of repetitive sequences (called THE 1 repeats) like many other repetitive DNA sequences are flanked by short direct repeats. Comparison of the base sequences of twelve examples of these flanking direct repeats indicates that THE 1 repeats insert into a preferred genomic target site. In one case, we have identified the sequence of an empty site into which a THE 1 element inserted. The sequence of this empty site and sequences of truncated THE 1 LTRs are consistent with a retroviral mechanism for the insertion of THE 1 elements. Truncated transposon structures illustrate for the first time that intermediate structures of retrotransposition may also be integrated into the genome.     

Fosmid library construction and end sequences analysis of the Pacific oyster,Crassostrea gigas

The Pacific oyster (Crassostrea gigas) is globally distributed and is one of the most commercially and ecologically important marine organisms. However, little is known about the genome of this species. In this study, a C. gigas fosmid library was constructed that contains 459,936 clones with an average insert size of approximately 40 kb, representing 22.34-fold haploid genome equivalents. End sequencing generated 90,240 fosmid end sequences (FESs) with an average length of 384.27 base pairs (bp), covering approximately 2.58% of the Pacific oyster genome. The FESs were subsequently assembled and annotated, resulting in 6332 sequences with predicted open reading frames≥300 and 1,189,100 bp repeats. Furthermore, a total of 3200 microsatellite repeats were identified, and dinucleotide repeats were found to occur most abundantly, with AG and AAT being the most abundant repeat class of dinucleotides and trinucleotides. We also found that the repeat number was generally negatively proportional to the repeat element length. Microsatellites composition between the transcribed sequences and genomic sequences was shown to be different. Point mutations of microsatellite were non-random and underwent strong selection stress. Overall, a comprehensive sequence resource for the Pacific oyster was created, including annotated transposable elements, tandem repeats, protein coding sequences and microsatellites. These initial findings will serve as resources for further in-depth studies of physical mapping, gene discovery, microsatellite marker developing and evolution studies.     

Repeated DNA sequences found in the large spacer of Vicia faba rDNA

In the large spacer of the rDNA of Vicia faba, multiples of a 0.32 kilobasepair (kb) sequence reiterate to various degrees. We sequenced the repetitious region consisting of the repeating sequences and its flanking regions using two cloned plasmids, which contain V. faba rDNA segments encompassing the whole region of the large spacer. The repetitious region was found to consist of multiple complete copies and one truncated copy of a 325 bp repeat unit and to be flanked by direct repeat sequences of about 150 bp. The set of direct repeats located at either side of the repetitious region differed from each other with about 10% sequence heterogeneity. However, nucleotide sequences of the direct repeats were well conserved between the two clones examined. Southern blot hybridization indicated a widespread distribution within the whole V. faba genome of some related sequences with high homologies to the 325 bp repeat unit and to the direct repeats.     

Molecular cloning and characterization of novel centromeric repetitive DNA sequences in the blue-breasted quail (Coturnix chinensis,Galliformes)

A new family of centromeric highly repetitive DNA sequences was isolated from EcoRI-digested genomic DNA of the blue-breasted quail (Coturnix chinensis, Galliformes), and characterized by filter hybridization and chromosome in situ hybridization. The repeated elements were divided into two types by nucleotide length and chromosomal distribution; the 578-bp element predominantly localized to microchromosomes and the 1,524-bp element localized to chromosomes 1 and 2. The 578-bp element represented tandem arrays and did not hybridize to genomic DNAs of other Galliformes species, chicken (Gallus gallus), Japanese quail (Coturnix japonica) and guinea fowl (Numida meleagris). On the other hand, the 1,524-bp element was not organized in tandem arrays, and did hybridize to the genomic DNAs of three other Galliformes species, suggesting that the 1,524-bp element is highly conserved in the Galliformes. The 578-bp element was composed of basic 20-bp internal repeats, and the consensus nucleotide sequence of the internal repeats had homologies to the 41-42 bp CNM repeat and the XHOI family repeat of chicken. Our data suggest that the microchromosome-specific highly repetitive sequences of the blue-breasted quail and chicken were derived from a common ancestral sequence, and that they are one of the major and essential components of chromosomal heterochromatin in Galliformes species.     

L1 repeat elements in the human epsilon-G gamma-globin gene intergenic region: sequence analysis and concerted evolution within this family

We have deduced the sequence of a composite long interspersed repeated DNA in primates and herein describe its relationship to a complex repeat element (L1Heg) located in the interval linking the human epsilon- and G gamma-globin genes. The main element of L1Heg is 3' truncated and interrupted by the insertion of the 3' end of a second L1 element. Transposition of L1Heg into this intergenic locus generated a 62-bp duplication of flanking sequences. In contrast, insertion of the second repeat may have been mediated by homology between donor and target sequences. The main repeat represents a novel class of abundant elements whose sequences have diverged from other rodent and primate LINES approximately 1.3 kb downstream from the 5' terminus of L1Heg. Comparison of L1Heg with the sequences of two other related L1 members revealed a complex set of rearrangements confined within a region that resembles the long terminal repeats of other types of retroposons. The boundaries of conversion-like events were defined on the basis of the clustering of nucleotide sequence variants common to two or more nonallelic 3' L1H elements. Several of these events are apparently initiated or resolved within a common 150-bp region that coincides with the 3' terminus of a pan-mammalian open reading frame. This analysis showed that concerted genetic interactions and random drift both contribute appreciably to sequence variation within this set of L1H members.     

Genome structure of cottontail rabbit herpesvirus.

The genome structure of a herpesvirus isolated from primary cultures of kidney cells from the cottontail rabbit Sylvilagus floridanus was elucidated by using electron microscopy and restriction enzyme analysis. The genome, which was about 150 kilobase pairs long and which had an average G + C composition of 45%, consisted of two regions with unique base sequences (54 and 47 kilobase pairs) enclosed by reiterations of a 925-base-pair sequence with a variable copy number. The internal repeats were in opposite polarity with respect to the terminal repeats, and both unique regions underwent inversion. The nucleotide sequence of the repeat unit was determined, and virion DNA termini were precisely localized within this sequence. Elements showing homology with the cleavage-packaging signals common to other herpesviruses were detected. The data indicate that this virus is different from the previously described herpesvirus sylvilagus.     

Tnat1 and Tnat2 from Arabidopsis thaliana: novel transposable elements with tandem repeat sequences.

A computer-aided homology search of databases found that the nucleotide sequences flanking ATLN44, a non-LTR retrotransposon (LINE) from Arabidopsis thaliana, are repeated in the A. thaliana genome. These sequences are homologous to flanking sequences of 664 bp with terminal inverted repeat sequences of about 70 bp. The 664-bp sequence and most of the 14 homologues identified were flanked by direct repeat sequences of 9 bp. These findings indicate that the repeated sequence, named Tnat1, is a transposable element that duplicates a 9-bp sequence at the target site on transposition and that ATLN44 is inserted in one Tnat1 member. Interestingly, all of the Tnat1 members had tandem repeats comprised of several units of a 60-bp sequence, the number of repeats differing among Tnat1 members. Of the Tnat1 members identified, one was inserted into another sequence repeated in the A. thaliana genome: that sequence is about 770 bp long and has terminal inverted repeat sequences of about 110 bp. The sequence is flanked by direct repeats of a 9-bp sequence, indicating that it is another transposable element, named Tnat2, from A. thaliana. Moreover, Tnat2 members had a tandem repeat about 240 bp long. Tnat1 and Tnat2 with tandem repeats in their internal regions show no homology to each other or to any of the elements identified previously; therefore they appear to be novel transposable elements.