A new protecting group for the 5'-hydroxyl group having O-S single bond oxidatively cleavable under mild conditions

We developed a new protecting group, ie., cis-[4-[[(4-methoxytrityl)sulfenyl]oxy]tetrahydrofuran-3-yl]oxycarbonyl (MTFOC), which could be removed under neutral conditions involving the oxidative removal of the MMTrS group followed by the self-cyclization of the resulting intermediate. The introduction of the protecting group into the 5-hydroxyl group of a thymidine derivative and its deprotection were studied.     

Rapid DNA synthesis by use of a new functionalized 5'-hydroxyl protecting group in the phosphorothio ester approach

This paper describes a new protecting group of the 5'-hydroxyl group, 3-(imidazol-l-ylmethyl)-4,4'-dimethoxytrityl (IDTr), which serves as potential catalytic site for internucleotide bond formation.     

New approach to automated synthesis of oligoribonucleotides

The combination of 2'-OH protection in ribonucleosides by the p-nitrophenylethylsulfonyl (NPES) group with the 3'-(beta-cyanoethyl) (N,N-diisopropyl)-phosphoramidite function reveals a new approach to oligoribonucleotide synthesis. The corresponding adenosine and guanosine derivatives have been applied to automated solid phase synthesis with good success.     

4,5-bis(ethoxycarbonyl)-[1,3]dioxolan-2-yl as a new orthoester-type protecting group for the 2'-hydroxyl function in the chemical synthesis of RNA

We wish to report 4,5-bis(ethoxycarbonyl)-[1,3]dioxolan-2-yl as a new protecting for the 2'-hydroxyl function. Our cyclic orthoester-type group is compatible with the DMTr strategy for oligonucleotide synthesis. This group was introduced to the 2'-hydroxyl group of appropriately protected nucleoside derivatives in good yields under mild acidic conditions. Post-synthetic conversion of the moiety of this protecting group with an amine resulted in formation of a new amide moiety that is more stable to acid deprotection in aqueous solution, but it can still be easily removed by treatment with acids in organic solvents. In this article, we also describe the stability of not only the original and modified protecting groups but also internucleotidic phosphate linkages of protected RNA intermediates under deprotection conditions.     

MDPSCL2: a new protecting group for chemoselective synthesis of 2'-O-alkylated guanosines

An improved strategy for the synthesis of 2'-O-methyl-guanosine (6) and 2'-MOE-guanosine (8) is reported. The regioselectivity of the alkylation was attained using a novel silicon-based protecting group, methylene-bis (diisopropyl-silylchloride) (MDPSCl2, 2). The alkylation proceeded in a chemoselective manner using NaHMDS as the base and MeCl or MOE-Br as the appropriate electrophiles.     

Solid phase synthesis of oligoribonucleotides using the o-nitrobenzyl group for 2''-hydroxyl protection and H-phosphonate chemistry.

Oligoribonucleotides with chain length of 7, 11, 15, 17, 24 and 34 were synthesized on long chain alkylamine controlled pore glass beads (LCA-CPG) using o-nitrobenzyl protection of 2'-hydroxyls via a H-phosphonate approach either manually or by using an automatic synthesizer. The oligoribonucleotides were obtained in yields of 0.6 0.6-20%, based on initial nucleoside bound to the LCA-CPG support.     

A new approach to the synthesis of branched and branched cyclic oligoribonucleotides.

The six-step synthesis of the di-triethylammonium salt of 5[prime]-O -trityl-6-N-pivaloyladenosine-2[prime]-(H -phosphonate)-3'-[(2-chlorophenyl) phosphate]9 from 3', 5'- O -(1,1,3,3-tetraisopropyldisiloxan-1,3-diyl)-6-N-pivaloyla denosine1in 68% overall yield is described. Compound9is converted into a branched pentaribonucleoside tetraphosphate 24 and a branched cyclic pentaribonucleotide ('lariat') 25 by solution phase triester chemistry involving both H-phosphonate and conventional phosphotriester coupling reactions. The monomeric building block 9 is proposed as a universal synthon for the preparation of branched and branched cyclic oligoribonucleotides derived from adenosine.     

A new solid-phase synthesis of oligoribonucleotides by the phosphoro-p-anisidate method using tetrahydrofuranyl protection of 2''-hydroxyl groups.

Six nonaribonucleotides containing the 5'-splice site, one complementary nonamer and an octadecamer containing the 3'-splice site have been synthesized on a polymer support using the phosphoro-p-anisidate method. A 5'-linked 2'-O-tetrahydrofuranyl-N-protected nucleoside 3'-(o-chlorophenyl)phosphoro-p-anisidate was used as the starting nucleotide, and the chain elongated in the 3'-direction by removing the p-anisidate protecting group with isoamyl nitrite under neutral conditions. The octadecamer has been synthesized using dinucleotide blocks and a 3'-terminal trinucleotide.     

Methylthiomethyl, a new carboxyl protecting group in peptide synthesis

N alpha-protected amino acid methylthiomethyl esters (MTM) were obtained in good yields under mild conditions using the "ButBr/Me2SO" reagent. Selective removal of the N-protecting group was achieved in HCl/anhydrous ethyl ether and the MTM ester hydrochlorides were successfully used in the synthesis of dipeptides.     

2-(2-Pyridyl)ethyl group: new type protecting group in the synthesis of DNA via phosphoramidite intermediates

2-(2-Pyridyl)ethyl group is a new type P-O protecting group for the synthesis of oligodeoxyribonucleotides by the phosphite triester method. This group is stable to alkali and acid conditions, and to be removed from internucleotidic bonds under mild conditions via two step procedures without any side reactions. Further we have found that bis(diisopropylamino)chlorophosphine is much more effective for the preparation of bis(diisopropylamino)alkoxyphosphines than various dichlorophosphines.     

(Butylthio)carbonyl group: a new protecting group for the guanine and uracil residues in oligoribonucleotide synthesis

The protection of the O6-amide and N2-amino groups of guanosine and the N3-imide group of uridine with the (butylthio)carbonyl group is described. This group could be rapidly introduced in good yields and removed very easily under the conventional deprotective conditions of the exo-amino acyl groups of other nucleoside bases.     

Use of the excluded protecting group (EPG) method for peptide synthesis.

The excluded protecting group (EPG) method has been used for the solution synthesis of several peptides including Merrifield's Model Tetrapeptide, linear antamanide and an analogue of magainin-1, [Ala(19), Asn(22)]magainin-1. In the approach reported, the C-terminal amino acid is esterified to the 2-position of cholestane as the [2s,3s]iodohydrin ester and the penultimate amino acid added to the aminoacyl-steroid as the Fmoc-pentafluorophenyl-ester. The Fmoc group is removed with Et(2)NH/DMF ( approximately 15% v/v) and, after evaporation to approximately 10 mL, the solution chromatographed on Sephadex LH-20 in DMF. The dipeptidyl-steroid elutes as the free amine well separated from other reaction mixture components. Fractions containing the dipeptide, as determined by counting and TLC, are pooled and reacted with the next Fmoc-amino acid-pentafluorophenyl ester in the sequence. Repetition of the deprotection/purification/reaction cycle yields the fully protected peptide.On completion of the synthesis, the cholestane iodohydrin ester is selectively removed by treatment with Zn degrees /AcOH to yield the peptide with intact alpha-amino and side chain protecting groups. Global deprotection is achieved with HF. All intermediates from the syntheses reported were characterized. The magainin analogue was shown to have full biologic activity. The Fmoc iodohydrin esters of 16 of the 20 proteogenic amino acids have been prepared and characterized for use as the C-terminal amino acids in other EPG syntheses.     

An azidomethyl protective group in the synthesis of oligoribonucleotides by the phosphotriester method

A rapid and effective method of an automatic oligoribonucleotide synthesis alternative to the phosphoramidite one was developed. This method is based on the phosphotriester approach to internucleotide bond formation under intramolecular O-nucleophilic catalysis and the use of an azidomethyl group for protection of a nucleotide 2′-hydroxyl function.     

(2-Azidomethyl)phenylacetyl as a new, reductively cleavable protecting group for hydroxyl groups in carbohydrate synthesis

The (2-azidomethyl)phenylacetyl group (AMPA) is described as a new protecting group for carbohydrates. AMPA was introduced to carbohydrate hydroxyl groups in the presence of DCC, while its removal was conveniently achieved via Lindlar catalyst-catalyzed hydrogenation that had no influence on other protecting groups including benzyl, acyl, acetal and ketal.     

Simplified methods for large scale enzymatic synthesis of oligoribonucleotides.

We report simplified methods for large scale enzymatic synthesis of oligoribonucleotides using polynucleotide phosphorylase. The main features of the method are use of RPC-5 chromatography, including chromatography at two pH values to deal with the problem of primer phosphorolysis, rapid dialysis for large scale desalting, simplified methods for enzyme removal, and high resolution 1H and 31P NMR for product identification and demonstration of purity. The capacity of the method is adequate to allow beginning with grams of material in the first polymerization step, so that product yields of several milligrams, sufficient for many physical studies, are possible after as many as three separate polymerization reactions.     

Prevention of chain cleavage in the chemical synthesis of 2''-silylated oligoribonucleotides.

Strong aqueous ammonium hydroxide used to remove N-acyl protecting groups from synthetic oligoribonucleotides causes removal of some alkylsilyl protecting groups from 2'-hydroxyls and leads to chain cleavage. This problem is most severe when 30% ammonium hydroxide is used and substantially reduced but still detectable when 3:1 ammonium hydroxide-ethanol is used. We have virtually eliminated this unwanted cleavage by incorporating the labile phenoxyacetyl amino protecting group on adenosine and guanosine. The N-benzoyl protecting group remains adequate for cytidine nucleosides. Synthetic oligoribonucleotides containing these N-acylated nucleosides and 2'-t-butyldimethylsilyl or 2'-triisopropylsilyl protecting groups can be deacylated by room temperature treatment in saturated anhydrous methanolic ammonia (8-12 h) without causing any detectable chain cleavage.     

5''-Levulinyl and 2''-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach.

The levulinyl group has been employed for protection of the 5'-hydroxyl group in the synthesis of oligoribonucleotides by the phosphoramidite approach, using the acid-labile 2'-tetrahydro-furanyl group. The hydrazine treatment was performed for 10 minutes in order to remove the levulinyl group on controlled pore glass. Four decaribonucleotides (AAAAAAAAAU, GGGGGGGGGU, CCCCCCCCCU and UUUUUUUUUU) and a heneicosamer (GCCUAGCUGAUGAAGGGUGAU) were prepared with an automatic synthesizer in good yields.