Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.     

Cloning of chemically synthesized lactose operators.

Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.     

Variants of a cloned synthetic lactose operator: I. A palindromic dimer lactose operator derived from one strand of the cloned 40-base pair operator

Starting with one strand of the 40-bp synthetic operator (Sadler et al., 1978), we have constructed and cloned a 66-bp, palindromic DNA segment with the following sequence

where the horizontal arrows indicate the locations of the two 21-bp “core? operator sequences in this segment and the vertical arrow designates the dyad axis of symmetry. Upon denaturation and rapid renaturation, each strand of this fragment forms a hairpin molecule still retaining an EcoRI cohesive end. Two hairpin molecules can be joined with T4 DNA ligase to form a duplex DNA molecule having no ends (dumbbell form A). Denaturation and rapid renaturation of dumbbell A yields a mixture of two dumbbell forms: dumbbell A which is a substrate for EcoKL, and a new form, dumbbell B, which is not a substrate. Each of the conformations of this DNA fragment have been purified and all are active in binding lactose repressor in vitro.     

Cloning and characterization of the natural lactose operator

A 55-bp DNA segment carrying the wild-type lactose operator sequence has been cloned. Its sequence is: (Formula: see text). With the exceptions of the bases at positions 19 and 41, 26 and 34, and 28 and 32, the sequence is a perfect inverted repeat about base pair 30. This segment was obtained from the wild-type lactose promoter and operator region of lambda h80dlac phage DNA by a combination of in vitro and in vivo steps. Up to four direct-repeat copies of this segment have been cloned in plasmid pMB9 and pBR325. Repressor affinity for this 55-bp fragment does not differ significantly from that for a 40-bp synthetic operator fragment cloned previously, even though the 55-bp fragment contains the complete set of sequence symmetries associated with the natural operator, whereas the 40-bp fragment does not. An improved procedure for operator purification is described: this was used to prepare 14 mg of the 55-bp fragment over a 2-month period.     

Synthetic lac operator mediates repression through lac repressor when introduced upstream and downstream from lac promoter.

Plasmids were constructed which carry a synthetic lac operator at various distances from the lac promoter. They were tested in vivo for function in the presence and absence of lac repressor. We found significant repression when the lac operator is situated at the 3' end of the lac I gene or at the 5' end of the lac Z gene. When lac operators are inserted at both sites, we found a greater than 150-fold repression. The complex between lac repressor and DNA carrying these two lac operators is exceedingly stable in vitro suggesting that one tetrameric lac repressor may bind to both lac operators.     

Interaction of tight binding repressors with lac operators. An analysis by DNA-footprinting

To increase our understanding of protein-DNA interaction in general, and in particular that of lac repressor with lac operator, we have investigated the interaction of tight binding (Itb) repressors with wild type (WT) operator and Oc operators. Nine Oc and a WT operator were cloned and sequenced. Three different Oc and an O+ were then chosen for the footprint analysis of six Itb repressors and WT repressor. Distinct protection patterns for the various repressor-operator pairs were observed at low repressor concentrations whereas, at high repressor concentrations, a stretch of 24 bases of the lower strand of the four different operators was protected in most cases. This protection pattern at high repressor concentration was almost completely redundant for all repressor-operator pairs, in spite of the fact that the affinities of the various pairs differed by more than three orders of magnitude. Two exceptions to this general observation were the two tight binding repressors R67 and R78a. These had been mapped in a region that codes for amino acid residues involved in subunit interaction. The two repressors showed reduced protection of O+ and of some Oc operators at the 3' (right) end of the lower strand. Dimethylsulfoxide, which is known to increase the affinity of O+ for repressor, did not increase the number of bases protected by WT repressor on the lower strand of O+. The footprinting results presented here clearly demonstrate that lac repressor can maximally protect about 24 bases of the lower strand of the operator and that the number and kind of interactions occurring in this region determine the strength of the repressor-operator interaction.     

Lac repressor with the helix-turn-helix motif of lambda cro binds to lac operator.

Lac repressor, lambda cro protein and their operator complexes are structurally, biochemically and genetically well analysed. Both proteins contain a helix-turn-helix (HTH) motif which they use to bind specifically to their operators. The DNA sequences 5'-GTGA-3' and 5'-TCAC-3' recognized in palindromic lac operator are the same as in lambda operator but their order is inverted form head to head to tail to tail. Different modes of aggregation of the monomers of the two proteins determine the different arrangements of the HTH motifs. Here we show that the HTH motif of lambda cro protein can replace the HTH motif of Lac repressor without changing its specificity. Such hybrid Lac repressor is unstable. It binds in vitro more weakly than Lac repressor but with the same specificity to ideal lac operator. It does not bind to consensus lambda operator.     

The ban operon of bacteriophage P1. Localization of the promoter controlled by P1 repressor

Repression of a strong promoter localized 5' to the P1 ban gene is a prerequisite for cloning the ban operon in the multicopy plasmid pBR325. Repression is brought about by the binding of P1 repressor to the operator of the ban operon (Heisig, A., Severin, I., Seefluth, A. K., and Schuster, H. (1987) Mol. Gen. Genet. 206, 368-376). Binding of RNA polymerase in vitro overlaps with the operator and is inhibited by P1 repressor as shown by electron microscopy. The mutant P1 bac, which renders ban expression constitutive, contains a single base pair exchange within the operator. As a consequence, more repressor is required (i) for the inhibition of binding of RNA polymerase, and (ii) for the electrophoretic retardation of a P1 bac DNA fragment when compared to the corresponding bac+ fragment. A P1 ban recombinant plasmid containing a 4-base pair deletion close to the operator still allows binding of repressor but not of RNA polymerase. By that means, a repressible promoter is located at the P1 map position 72 in a distance of about 2.5 kilobase pairs to the beginning of the ban gene.     

Characterization of the interaction of the glp repressor of Escherichia coli K-12 with single and tandem glp operator variants.

The glp operons of Escherichia coli are negatively controlled by the glp repressor. Comparison of the repressor-binding affinities for consensus and altered consensus operators in vivo showed that all base substitutions at positions 3, 4, 5, and 8 from the center of the palindromic operator caused a striking decrease in repressor binding. Substitutions at other positions had a severe to no effect on repressor binding, depending on the base substitution. The results obtained indicate that the repressor binds with highest affinity to operators with the half-site WATKYTCGWW, where W is A or T, K is G or T, and Y is C or T. Strong cooperative binding of the repressor to tandem operators was demonstrated in vivo. Cooperativity was maximal when two 20-bp operators were directly repeated or when 2 bp separated the two operators. Cooperativity decreased with the deletion of 2 bp or the addition of 4 bp between the individual operators. Cooperativity was eliminated with a 6-bp insertion between the operators.     

Operator sequences of bacteriophages P22 and 21

We have determined the sequences of the left and right operators of bacteriophages P22 and 21. The corresponding operators of the two phages have nearly identical sequences, thus explaining how the repressor of each phage recognizes the operators of the other. Experiments probing the binding of repressor and operator show that each operator contains three repressor binding sites. The repressor binding sites are 18 base-pair, partially symmetric sequences. The dispersed symmetric sequence A.T.AAG.…CTT.A.T is highly conserved among the 12 repressor binding sites of the two phages. Four virulent mutations have been sequenced; all of them alter bases in the conserved sequence.     

Lac repressor — Lac operator complexes

Complexes between the Lac repressor and a small DNA operator fragment (29 base pairs) were investigated using polyacrylamide gel electrophoresis and solution X-ray scattering. Titration of the DNA fragment with the repressor, followed by gel electrophoresis showed that only two types of complexes are formed with repressor/operator ratios of 0.5 and 2. Radii of gyration and forward scattered intensities were obtained from Guinier plots for repressor/operator ratios ranging from 0.3 to 2. They demonstrated that the first complex contains one repressor and two operators, whereas the second one contains four repressors and two operators. Mixing operator and repressor in equimolar concentrations leads to a mixture of both complexes. A possible model for the four repressor/two operator complex is proposed.     

Purification and properties of Gal repressor:pL-galR fusion in pKC31 plasmid vector

The galR gene, which encodes the Gal repressor protein in Escherichia coli, has been fused to the strong pL promoter of bacteriophage lambda in plasmid pKC31. The pL promoter is kept repressed by a thermolabilie lambda repressor, CIts857, to prevent cell killing. Heat induction of the pL-galR fusion plasmid synthesizes large amounts of active Gal repressor. The protein has been purified to homogeneity in three steps. The purification is greatly aided by the reversible insolubility of active repressor in crude extract at salt concentrations of less than 200 mM. The amino-terminal amino acid sequence determined by automated Edman degradation is: N-Ala-Thr-Ile-Lys-Asp-Val-Ala-Arg-Leu-Ala-Gly-Val-Ser-Val-Ala-Thr-Val-. Comparison of this sequence with that deduced from the DNA sequence of the galR gene showed that the formyl methionine residue preceding alanine at position 1 is cleaved off. The repressor is present in solution as a dimer of a 37-kDa subunit. The protein binds to gal DNA containing wild type and not mutant operator sequences. As predicted, this sequence-specific binding is inhibited by the presence of D-galactose or D-fucose, both of which are in vivo inducers of the gal operon. Gal repressor inhibits the expresison of gal operon by binding to two spatially separated operators which flank, but do not overlap, the gal promoter segment. Experiments to study the mechanism of repressor action are discussed.     

Effects of dominant-negative lac repressor mutations on operator specificity and protein stability

The specific binding of dominant-negative (I-d) lactose (lac) repressors to wild-type (wt) as well as mutant (Oc) lac operators has been examined to explore the sequence-specific interaction of the lac repressor with its target. Mutant lacI genes encoding substitutions in the N-terminal 60 amino acids (aa) were cloned in a derivative of plasmid pBR322. Twelve of these lacI-d missense mutations were transferred from F'lac episomes using general genetic recombination and molecular cloning, and nine lacI missense mutations were recloned from M13-lacI phages [Mott et al., Nucl. Acids Res. 12 (1984) 4139-4152]. The mutant repressors were examined for polypeptide size and stability, for binding the inducer isopropyl-beta-D-thiogalactoside (IPTG), as well as binding to wt operator. The mutant repressors' affinities for wt operator ranged from undetectable to about 1% that of wt repressor, and the mutant repressors varied in transdominance against repressor expressed from a chromosomal lacIq gene. Six of the I-d repressors were partially degraded in vivo. All repressors bound IPTG with approximately the affinity of wt repressor. Repressors having significant affinity for wt operator or with substitutions in the presumed operator recognition helix (aa 17-25) were examined in vivo for their affinities for a series of single site Oc operators. Whereas the Gly-18-, Ser-18- and Leu-18-substituted repressors showed altered specificity for position 7 of the operator [Ebright, Proc. Natl. Acad. Sci. USA 83 (1986) 303-307], the His-18 repressor did not affect specificity. This result may be related to the greater side-chain length of histidine compared to the other amino acid substitutions.     

Methylphosphonates as probes of protein-nucleic acid interactions.

Deoxydinucleoside methylphosphonates were prepared by chemical synthesis and were introduced stereospecifically into the lac operator at two sites. These sites within d(ApApTpTpGpTpGpApGpCpGpGpApTpApApCpApApTpT), segment I, and d(ApApTpTpGpTpTpApTpCpCpGpCpTpCpApCpApApTpT), segment II, are indicated by p. Each segment containing a chiral methylphosphonate was annealed to the complementary unmodified segment. The interactions of these four modified lac operators with lac repressor were analyzed by the nitrocellulose filter binding assay. Introduction of either chiral phosphonate in segment II had little effect on the stability of the repressor-operator complex. When methylphosphonates were introduced into segment I, the affinity of lac repressor for the modified operators was shown to be dependent on the stereochemical configuration of the methylphosphonate.     

Characterization of the arginine repressor from Salmonella typhimurium and its interactions with the carAB operator.

Primer extension experiments showed that the argR gene, encoding the arginine repressor in Salmonella typhimurium, is transcribed from a single promoter that is negatively regulated by arginine. A repressor overproducing strain was constructed and the repressor was purified to homogeneity. Gel filtration, sedimentation and cross-linking studies established that the native repressor is a hexamer of identical 17,000 Mr subunits. Gel retardation experiments indicate that the apparent dissociation constant for repressor/carAB operator is 6 x 10(-12) M. These experiments showed that arginine is essential for binding of the repressor to the DNA and that pyrimidine nucleotides have no significant effect on this binding. These results indicate that the effect of pyrimidines on expression of the arginine sensitive "downstream" carAB promoter is not directly mediated by the arginine repressor. These experiments also suggest that a single hexamer binds to the carAB operator, which carries two previously defined "ARG box" sequences that characterize operators for arg genes. Gel retardation experiments with DNA fragments carrying the individual ARG boxes showed that both boxes are required for effective binding of the hexameric repressor to the operator, indicating that the ARG boxes comprise a single binding site for the repressor. Analysis of the potential secondary structure of the arginine repressor does not reveal any of the recognizable structural motifs common to a number of DNA-binding proteins. A combination of DNase I, premethylation interference, depurination and hydroxyl radical footprinting techniques were employed to characterize the interactions of the repressor with the carAB operator, with the results suggesting that the repressor predominantly interacts with A.T residues in this region. Comparative DNA sequence analysis of the known arginine operators of enteric bacteria further indicates that the specificity of interaction may be based more on the precise distance between two defined A.T-rich regions rather than on the specific nucleotide sequence.