共查询到20条相似文献,搜索用时 196 毫秒
1.
Malihe Ebrahimi Hassan Hadadzadeh Badraldin Ebrahim Sayed Tabatabaei Zahra Jannesari Ghazale Khaksar 《Journal of biomolecular structure & dynamics》2013,31(11):2316-2329
The guanine-rich sequence, specifically in DNA, telomeric DNA, is a potential target of anticancer drugs. In this work, a mononuclear Fe(III) complex containing two meloxicam ligands was synthesized as a G-quadruplex stabilizer. The interaction between the Fe(III) complex and G-quadruplex with sequence of 5′-G3(T2AG3)3-3′ (HTG21) was investigated using spectroscopic methods, molecular modeling, and polymerase chain reaction (PCR) assays. The spectroscopic methods of UV–vis, fluorescence, and circular dichroism showed that the metal complex can effectively induce and stabilize G-quadruplex structure in the G-rich 21-mer sequence. Also, the binding constant between the Fe(III) complex and G-quadruplex was measured by these methods and it was found to be 4.53(±0.30)?×?105 M?1). The PCR stop assay indicated that the Fe(III) complex inhibits DNA amplification. The cell viability assay showed that the complex has significant antitumor activities against Hela cells. According to the UV–vis results, the interaction of the Fe(III) complex with duplex DNA is an order of magnitude lower than G-quadruplex. Furthermore, the release of the complex incorporated in bovine serum albumin nanoparticles was also investigated in physiological conditions. The release of the complex followed a bi-phasic release pattern with high and low releasing rates at the first and second phases, respectively. Also, in order to obtain the binding mode of the Fe(III) complex with G-quadruplex, molecular modeling was performed. The molecular docking results showed that the Fe(III) complex was docked to the end-stacked of the G-quadruplex with a π–π interaction, created between the meloxicam ligand and the guanine bases of the G-quadruplex. 相似文献
2.
A series of water-soluble cationic phthalocyanine derivatives (1-10) were designed and synthesized to develop novel and potent telomerase inhibitors. These phthalocyanine derivatives as inhibitors of telomerase were investigated via modified telomerase repeat amplification protocol (TRAP) assay. The TRAP assay indicates that these cationic compounds had strong telomerase inhibitory activity (IC(50)<1.65 microM). To determine whether the phthalocyanine derivatives binding to G-quadruplex enhance the block to DNA synthesis, primer extension reactions were carried out in the presence of phthalocyanines. The interaction of the G-quadruplex of telomerase DNA with these molecules was examined by CD melting and PCR stop assay. These cationic phthalocyanine derivatives can stabilize G-quadruplex, which is demonstrated by the increased T(m) values. All these results indicate that the phthalocyanine derivatives might be potential lead compounds for the development of new telomerase inhibitor. 相似文献
3.
A series of bisaryldiketene derivatives were designed and synthesized as a new class of specific G-quadruplex ligands. The ligand-quadruplex interactions were further evaluated by FRET, ITC, and PCR stop assay. In contrast to most of the G-quadruplex ligands reported so far, which comprise an extended aromatic ring, these compounds are neither polycyclic nor macrocyclic, but have a non-aromatic and relative flexible linker between two quinoline moieties enabling the conformation of compounds to be flexible. Our results showed that these bisaryldiketene derivatives could selectively recognize G-quadruplex DNA rather than binding to duplex DNA. Moreover, they showed promising discrimination between different G-quadruplex DNA. The primary binding affinity of ligand M2 for c-myc G-quadruplex DNA was over 200 times larger than that for telomere G-quadruplex DNA. 相似文献
4.
DNA-binding agents have been considered as an established opportunity for the development of anticancer drugs and DNA fluorescence probes. This work reported the synthesis of two novel carbazole derivatives (1 and 2) and investigated their DNA binding properties, living cell image, and cytotoxicity. The results demonstrated that both compounds presented the higher binding affinity to G-quadruplex than to duplex DNA by means of UV–Vis absorption titration and fluorescent intercalator displacement. Continuous variation analysis indicated that their binding stoichiometries of the compound/G-quadruplex were near 2 except the compound/bcl-2. Circular dichroism spectra showed that both compounds had no influence on the conformation of G-quadruplexes. Fluorescence titrations indicated that 2 had the potential to be a G-quadruplex selective fluorescent probe, while 1 could be used as a fluorescent probe for duplex DNA. Confocal fluorescence images indicated that both compounds could enter the living HepG2 cells, and 1 mainly located in nucleus whereas 2 mainly distributed in cytoplasm. DNase and RNase digest tests indicated that both compounds could enter into the nucleus and interact with duplex DNA, especially, 2 could interact with RNA and/or G-quadruplex DNA. They also exhibited an obvious antiproliferative activity to HepG2 by using MTT assays, with IC50 values of 2.7 and 9.5?μM for 1 and 2, respectively. 相似文献
5.
Human telomeric G-quadruplex DNA interactions of N-phenanthroline glycosylamine copper(II) complexes
《Bioorganic & medicinal chemistry》2016,24(1):33-41
We report in this article the interactions of five N-(1,10-phenanthrolin-5-yl)-β-glycopyranosylamine copper(II) complexes with G-quadruplex DNA. Specifically, the interactions of these compounds with a human telomeric oligonucleotide have been assessed by fluorescence-based assays (FRET melting and G4-FID), circular dichroism and competitive equilibrium dialysis experiments. The metal complexes bind and stabilize G-quadruplex DNA structures with apparent association constants in the order of 104–105 M−1 and the affinity observed is dependent on the ionic conditions utilized and the specific nature of the carbohydrate moiety tethered to the 1,10-phenanthroline system. The compounds showed only a slight preference to bind G-quadruplex DNA over duplex DNA when the quadruplex DNA was folded in sodium ionic conditions. However, the binding affinity and selectivity, although modest, were notably increased when the G-quadruplex DNA was folded in the presence of potassium metal ions. Moreover, the study points towards a significant contribution of groove and/or loop binding in the recognition mode of quadruplex structures by these non-classical quadruplex ligands. The results reported herein highlight the potential and the versatility of carbohydrate bis-phenanthroline metal-complex conjugates to recognize G-quadruplex DNA structures. 相似文献
6.
Peduto A Pagano B Petronzi C Massa A Esposito V Virgilio A Paduano F Trapasso F Fiorito F Florio S Giancola C Galeone A Filosa R 《Bioorganic & medicinal chemistry》2011,19(21):6419-6429
A series of trisubstituted naphthalimides have been synthesized and evaluated as telomeric G-quadruplex ligands by biophysical methods. Affinity for telomeric G-quadruplex AGGG(TTAGGG)(3) binding was first screened by fluorescence titrations. Subsequently, the interaction of the telomeric G-quadruplex with compounds showing the best affinity has been studied by isothermal titration calorimetry and UV-melting experiments. The two best compounds of the series tightly bind the telomeric quadruplex with a 2:1 drug/DNA stoichiometry. These derivatives have been further evaluated for their ability to inhibit telomerase by a TRAP assay and their pharmacological properties by treating melanoma (M14) and human lung cancer (A549) cell lines with increasing drug concentrations. A dose-dependent inhibition of cell proliferation was observed for all cellular lines during short-term treatment. 相似文献
7.
9-Substituted berberine derivatives as G-quadruplex stabilizing ligands in telomeric DNA 总被引:2,自引:0,他引:2
Zhang WJ Ou TM Lu YJ Huang YY Wu WB Huang ZS Zhou JL Wong KY Gu LQ 《Bioorganic & medicinal chemistry》2007,15(16):5493-5501
The interaction of berberine and its 9-substituted derivatives with human telomeric DNA d[G(3)(T(2)AG(3))(3)](telo21) has been investigated via CD spectroscopy, fluorescence spectroscopy, PCR-stop assay, competitive dialysis, and telomerase repeat amplification protocol (TRAP) assay. The results indicated that these semisynthesized compounds could induce and stabilize the formation of anti-parallel G-quadruplex of telomeric DNA in the presence or absence of metal cations. Compared with berberine, the 9-substituted derivatives exhibit stronger binding affinity with G-quadruplex and higher inhibitory activity for telomerase. Introduction of a side chain with proper length of methylene and terminal amino group to the 9-position of berberine would significantly strengthen the binding affinity with G-quadruplex, resulting in increasing inhibitory effects on the amplification of telo21 DNA and on the telomerase activity. 相似文献
8.
9.
Disubstituted 1,8-dipyrazolcarbazole derivatives as a new type of c-myc G-quadruplex binding ligands
Chen WJ Zhou CX Yao PF Wang XX Tan JH Li D Ou TM Gu LQ Huang ZS 《Bioorganic & medicinal chemistry》2012,20(9):2829-2836
A series of 1,8-dipyrazolcarbazole (DPC) derivatives (6a-6d, 7a-7d) designed as G-quadruplex ligands have been synthesized and characterized. The FRET-melting and SPR results showed that the DPC derivatives could well recognize G-quadruplex with strong discrimination against the duplex DNA. In addition, the DPC derivatives showed much stronger stabilization activities and binding affinities for c-myc G-quadruplex rather than telomeric G-quadruplex. Therefore, their interactions with c-myc G-quadruplex were further explored by means of CD spectroscopy, PCR-stop assay, and molecular modeling. In cellular studies, all compounds showed strong cytotoxicity against cancer cells, while weak cytotoxicity towards normal cells. RT-PCR assay showed that compound 7b could down-regulate c-myc gene expression in Ramos cell line, while had no effect on c-myc expression in CA46 cell line with NHE III(1) element removed, indicating its effective binding with G-quadruplex on c-myc oncogene in vivo. 相似文献
10.
The binding properties of five G-quadruplex oligonucleotides (humtel24, k-ras32, c-myc22, c-kit1 and c-kit2) with polyamines have been investigated by electrospray ionization-quadrupole time of flight mass spectrometry, circular dichroism, melting temperature, atomic force microscopy (AFM) and molecular simulation. The MS results demonstrated that the polyamines and G-quadruplex DNA can form complexes with high affinity, and one molecule of G-quadruplex DNA can combine several molecules (1–5) of polyamines. The binding affinities of the polyamines to DNA were in the order of spermine > spermidine > putrescine. After binding with polyamines, the conformations of the G-quadruplex DNA were significantly changed, and spermine can induce the configurations of k-ras32 and c-kit1 to deviate from their G-quadruplex structures at high concentrations. In the presence of K+, the conformations of G-quadruplex DNA were stabilized, while polyamines can also induced alterations of their configurations. Melting temperature experiments suggested that the Tm of the DNA–polyamine complexes obviously increased both in the absence and presence of K+. The AFM results indicated that polyamines can induce aggregation of G-quadruplex DNA. Above results illustrated that the polyamines bound with the phosphate backbone and the base-pairs of G-quadruplex structures. Combining with the molecular simulation, the binding mode of the G-quadruplex DNA and polyamines were discussed. The results obtained would be beneficial for understanding the biological and physiological functions of polyamines and provide useful information for development of antitumor drugs. 相似文献
11.
Formation of the G-quadruplex and i-motif structures in retinoblastoma susceptibility genes (Rb) 总被引:6,自引:2,他引:4
The formation of G-quadruplex and i-motif structures in the 5′ end of the retinoblastoma (Rb) gene was examined using chemical modifications, circular dichroism (CD) and fluorescence spectroscopy. It was found that substitutions of 8-methylguanine at positions that show syn conformations in antiparallel G-quadruplexes stabilize the structure in the G-rich strand. The complementary C-rich 18mer forms an i-motif structure, as suggested by CD spectroscopy. Based on the C to T mutation experiments, C bases participated in the C–C+ base pair of the i-motif structure were determined. Experiments of 2-aminopurine (2-AP) substitution reveal that an increase of fluorescence in the G-quadruplex relative to duplex is attributed to unstacked 2-AP within the loop of G-quadruplex. The fluorescence experiments suggest that formation of the G-quadruplex and i-motif can compete with duplex formation. Furthermore, a polymerase arrest assay indicated that formation the G-quadruplex structure in the Rb gene acts as a barrier in DNA synthesis. 相似文献
12.
Two ruthenium(II) complexes, Λ-[Ru(phen)2(p-HPIP)]2+ and Δ-[Ru(phen)2(p-HPIP)]2+, were synthesized and characterized via proton nuclear magnetic resonance spectroscopy, electrospray ionization-mass spectrometry, and circular dichroism spectroscopy. This study aims to clarify the anticancer effect of metal complexes as novel and potent telomerase inhibitors and cellular nucleus target drug. First, the chiral selectivity of the compounds and their ability to stabilize quadruplex DNA were studied via absorption and emission analyses, circular dichroism spectroscopy, fluorescence-resonance energy transfer melting assay, electrophoretic mobility shift assay, and polymerase chain reaction stop assay. The two chiral compounds selectively induced and stabilized the G-quadruplex of telomeric DNA with or without metal cations. These results provide new insights into the development of chiral anticancer agents for G-quadruplex DNA targeting. Telomerase repeat amplification protocol reveals the higher inhibitory activity of Λ-[Ru(phen)2(p-HPIP)]2+ against telomerase, suggesting that Λ-[Ru(phen)2(p-HPIP)]2+ may be a potential telomerase inhibitor for cancer chemotherapy. MTT assay results show that these chiral complexes have significant antitumor activities in HepG2 cells. More interestingly, cellular uptake and laser-scanning confocal microscopic studies reveal the efficient uptake of Λ-[Ru(phen)2(p-HPIP)]2+ by HepG2 cells. This complex then enters the cytoplasm and tends to accumulate in the nucleus. This nuclear penetration of the ruthenium complexes and their subsequent accumulation are associated with the chirality of the isomers as well as with the subtle environment of the ruthenium complexes. Therefore, the nucleus can be the cellular target of chiral ruthenium complexes for anticancer therapy. 相似文献
13.
Urmila Saha Asma Yasmeen Khan Sutanwi Bhuiya Suman Das Gaetano Fiorillo Paolo Lombardi 《Journal of biomolecular structure & dynamics》2019,37(6):1375-1389
Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M?1, and that of BER was (0.98 ± 0.03) × 105 M?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands. 相似文献
14.
Chun-Ying Wei Jun-Hong Wang Ye Wen Jie Liu Li-Hua Wang 《Bioorganic & medicinal chemistry》2013,21(11):3379-3387
Four novel 4-(1H-imidazo[4,5-f]-1,10-phenanthrolin-2-yl)phenol derivatives 1–4 have been synthesized, and their G-quadruplex DNA-binding interactions, telomerase inhibition, antiproliferative activity, cell cycle arrest, and apoptotic induction were studied. All compounds show the preferential h-telo, c-myc, and c-kit2 G-quadruplex binding affinity and the G-quadruplex versus duplex selectivity. In the case of the same G-quadruplex target, the compound 1 exhibits better stabilization effect (ΔTm) than the other three compounds and also gives 80.2% inhibition of telomerase activity at 7.5 μM. All compounds can promote selectively the formation of parallel G-quadruplex structure of both c-myc and c-kit2 without addition of any cations. Four compounds display the cytotoxicity activities against HeLa and HepG2 cells by MTT assay with IC50 values of about 10?6 and 10?5 M, respectively, and cause a substantial decrease in the G2/M-phase cell population and a significant increase in the number of apoptotic cells. 相似文献
15.
We have developed and characterized an assay for G-quadruplex-interactive compounds that makes use of the fact that G-rich DNA templates present obstacles to DNA synthesis by DNA polymerases. Using Taq DNA polymerase and the G-quadruplex binding 2, 6-diamidoanthraquinone BSU-1051, we find that BSU-1051 leads to enhanced arrest of DNA synthesis in the presence of K+by stabilizing an intramolecular G-quadruplex structure formed by four repeats of either TTGGGG or TTAGGG in the template strand. The data provide additional evidence that BSU-1051 modulates telomerase activity by stabilization of telomeric G-quadruplex DNA and point to a polymerase arrest assay as a sensitive method for screening for G-quadruplex-interactive agents with potential clinical utility. 相似文献
16.
Shuo Shi Shane Gao Tongcheng Cao Jie Liu Xing Gao Jian Hao Chunyan Lv Hailiang Huang Jun Xu Tianming Yao 《PloS one》2013,8(12)
Inhibition of telomerase by inducing/stabilizing G-quadruplex formation is a promising strategy to design new anticancer drugs. We synthesized and characterized a new dinuclear complex [(dmb)2Ru(obip)Ru(dmb)2]4+ (dmb = 4,4’-dimethyl-2,2’-bipyridine, obip = (2-(2-pyridyl)imidazo[4,5-f][1,10]phenanthroline) with high affinity for both antiparallel and mixed parallel / antiparallel G-quadruplex DNA. This complex can promote the formation and stabilize G-quadruplex DNA. Dialysis and TRAP experiments indicated that [(dmb)2Ru(obip)Ru(dmb)2]4+ acted as an excellent telomerase inhibitor due to its obvious selectivity for G-quadruplex DNA rather than double stranded DNA. In vitro co-culture experiments implied that [(dmb)2Ru(obip)Ru(dmb)2]4+ inhibited telomerase activity and hindered cancer cell proliferation without side effects to normal fibroblast cells. TUNEL assay indicated that inhibition of telomerase activity induced DNA cleavage further apoptosis in cancer cells. Therefore, RuII complex represents an exciting opportunity for anticancer drug design by specifically targeting cancer cell G-quadruplexes DNA. 相似文献
17.
Chuan Wang Qianqian Yu Licong Yang Yanyu Liu Dongdong Sun Yongchao Huang Yanhui Zhou Qianling Zhang Jie Liu 《Biometals》2013,26(3):387-402
In the present study, the interaction between GC-rich sequence of bcl-2 gene P1 promoter (Pu39) and two ruthenium (II) polypyridyl complexes, [Ru(bpy)2(tip)]2+ (1) and [Ru(phen)2(tip)]2+ (2), was investigated by UV–Visible, fluorescence spectroscopy, circular dichroism, fluorescence resonance energy transfer melting assay and polymerase chain reaction stop assay. Those experimental results indicated that the two complexes can effectively stabilize the G-quadruplex of Pu39. It was found that the complex 2 exhibited greater cytotoxic activity than 1 against human Hela cells and can enter into Hela cells in a short period of time to effectively induce apoptosis of cells. Further experiments found that complexes 1 and 2 had as potent inhibitory effects on ECV-304 cell migration as suramin. Those noteworthy results provide new insights into the development of anticancer agents for targeting G-quadruplex DNA. 相似文献
18.
19.
Schultes CM Guyen B Cuesta J Neidle S 《Bioorganic & medicinal chemistry letters》2004,14(16):4347-4351
Telomerase and telomere maintenance are emerging targets for the treatment of human cancers. We report here on the targeting of the telomere-telomerase complex with a series of small molecules based on an acridine platform. A series of 3,6-bisamidoacridines with extended 9-anilino sidechains were designed and synthesised as potential telomeric G-quadruplex DNA (G4) interacting compounds. G4-stabilisation was assessed using a high-throughput FRET (fluorescence resonance energy transfer) assay and telomerase inhibition quantified by a modified TRAP (telomerase repeat amplification protocol) method. Within the series, the compounds showed significant G4-stabilising ability (Delta T(m) values of 25-36 degrees C at 1 microM concentration) and telomerase inhibition in the nanomolar region ((tel)EC(50) values of 80-318 nM). Furthermore, a direct correlation between the FRET and TRAP assays was observed, supporting the use of the rapid screening FRET assay for early assessment of potential G4-stabilising telomerase inhibitors. 相似文献
20.
Marziyeh Poshteh Shirani Taghi Khayamian Mohammad Dinari Kazem Karami Zohreh Mehri-Lighvan 《Journal of biomolecular structure & dynamics》2013,31(16):4156-4169
New folic acid-conjugated mesoporous silica nanoparticles were synthesized. The effect of calcination at 400°C on the fluorescence characteristics of mesoporous silica nanoparticles were studied in this work. The formed carbon dots (CDs) from calcination were used as the source of fluorescence. 3-Aminopropyltriethoxysilane was then used to amine-functionalized the fluorescent surface of mesoporous silica nanoparticles. The amine fluorescence mesoporous silica nanoparticles (amine-FMSNs) were coupled with folic acid (FA) as the target ligand (FA-amine-FMSNs). A palladium complex was also synthesized and encapsulated in the FA-amine-FMSNs yielded fluorescent property with therapeutic effect. The in vitro release of an entrapped palladium complex from FA-amine-FMSNs was studied under physiological conditions. According to the cell viability assay on HeLa (positive FR) and Hep-G2 (negative FR) cells, the targeted delivery system inhibited the growth of positive FR with higher selectivity compared with negative FR cells. Also, the emission CDs were used for fluorescence microscopic imaging. To confirm anti-cancer activity of the palladium complex, the interaction between palladium complex and G-quadruplex DNA were investigated with multi-spectroscopic methods and molecular modeling. The molecular docking studies showed a partial intercalation mode with a 4.27 × 105 M?1 binding constant. 相似文献