Repetitive sequences and their organization on genomic clones of Zea mays

Fourteen recombinant clones from Zea mays were studied with regard to their composition of unique and repetitive sequences. Southern hybridization experiments were used to classify restriction fragments of the clones into a unique, middle or highly repetitive class of reiteration frequency. All three classes were often found on the same genomic clone. Crosshybridization studies between clones showed that a given repeat might be present on several clones, and thus four families of highly repetitive elements were established. Heteroduplex analysis was used to show the arrangement and size of repeats common between several clones. A short interspersion pattern of unique, middle and highly repetitive DNA was found. The dispersed repetitive elements were 300-1300 bp in length. Analysis of the pattern produced by a given repeat in genomic Southern experiments suggests that some small dispersed repeats may also exist as part of a larger repeating unit elsewhere in the genome.     

Diversity and evolution of four dispersed repetitive DNA sequences in the genus Secale

We present the first characterization of 360 sequences in six species of the genus Secale of both cultivated and wild accessions. These include four distinct kinds of dispersed repetitive DNA sequences named pSc20H, pSc119.1, pSaO5(411), and pSaD15(940) belonging to the Revolver family. During the evolution of the genus Secale from wild to cultivated accessions, the pSaO5(411)-like sequences became shorter mainly because of the deletion of a trinucleotide tandem repeating unit, the pSc20H-like sequences displayed apparent homogenization in cultivated rye, and the second intron of Revolver became longer. In addition, the pSc20H-, pSc119.1-, and pSaO5(411)-like sequences cloned from wild rye and cultivated rye could be divided into two large clades. No single case of the four kinds of repetitive elements has been inherited by each Secale accession from a lone ancestor. It is reasonable to consider the vertical transmission of the four repetitive elements during the evolution of the genus Secale. The pSc20H- and pSaO5(411)-like sequences showed evolutionary elimination at specific chromosomal locations from wild species to cultivated species. These cases imply that different repetitive DNA sequences have played different roles in the chromosome development and genomic evolution of rye. The present study adds important information to the investigations dealing with characterization of dispersed repetitive elements in wild and cultivated rye.     

Distribution of moderately repetitive sequences pTR5 and LF1 in Xq24-q28 human DNA and their use in assembling YAC contigs.

Xq24-q28 DNA, from a hamster/human hybrid cell containing only that portion of the human X chromosome, was found to contain 56 TaqI restriction fragments that hybridized to the moderately repetitive sequence pTR5. Using the pTR5 sequence as a probe in colony hybridization, 136 cognate yeast artificial chromosome (YAC) clones were detected among a collection of 820 containing about three genomic equivalents of the Xq24-q28 DNA. The YACs were then grouped into 48 contigs and single clones containing one or more of the TaqI fragments. Overlaps were confirmed both by fingerprinting YACs with AluI and L1 probes and by additional information. A less complete analysis was also carried out with a second moderately repetitive sequence, LF1, and some smaller contigs were merged into larger ones. Moderately repetitive sequences can thus be used as probes for multiple loci in single hybridization experiments and can help to organize and confirm YAC overlaps during the development of maps with long-range contiguity.     

Analysis of clones carrying repeated DNA sequences in two YAC libraries of Arabidopsis thaliana DNA

YAC clones carrying repeated DNA sequences from the Arabidopsis thaliana genome have been characterized in two widely used Arabidopsis YAC libraries, the EG library and the EW library. Ribosomal, chloroplast and the paracentromeric repeat sequences are differentially represented in the two libraries. The coordinates of YAC clones hybridizing to these sequences are given. A high proportion of EG YAC clones were classified as containing chimaeric inserts because individual clones carried unique sequences and repetitive sequences originating from different locations in the genome. None of the EW YAC clones analysed were chimaeric in this way. YAC clones carrying tandemly repeated sequences, such as the paracentromeric or rDNA sequences, exhibited a high degree of instability. These observations need to be taken into account when using these libraries in the development of a physical map of the Arabidopsis genome and in chromosome walking experiments.     

An automated method for DNA preparation from thousands of YAC clones.

We describe an automated method for the preparation of yeast genomic DNA capable of preparing thousands of DNAs in parallel from a YAC library. Briefly, the protocol involves four steps: (1) Yeast clones are grown in the wells of 96-well microtiter plates with filter (rather than plastic) well-bottoms, which are embedded in solid growth media; (2) These yeast cultures are resuspended and their concentrations determined by optical density measurement; (3) Equal numbers of cells from each well are embedded in low-melting temperature agarose blocks in fresh 96-well plates, again with filter bottoms; and (4) DNA is prepared in the agarose blocks by a protocol similar to that used for preparing DNA for pulsed-field gels, with the reagents being dialyzed through the (filter) bottoms of the microtiter plate. The DNA produced by this method is suitable for pulsed-field gel electrophoresis, for restriction enzyme digestion, and for the polymerase chain reaction (PCR). Using this protocol, we produced 3000 YAC strain DNAs in three weeks. This automated procedure should be extremely useful in many genomic mapping projects.     

Small DNA fragments isolated from human T-cell clones are enriched in sequences involved in DNA bending

IL-2 deprivation induces apoptosis in human IL-2-dependent T-cell clones. This process is characterized by typical cell morphology, changes in the cellular membranes and fragmentation of chromatin into units of single and multiple nucleosomes. We isolated apoptotic DNA of an IL-2-deprived T-cell clone and sequenced randomly selected fragments representing single and multiple nucleosomes.The frequency of phased adenosine tracts was markedly increased in the small apoptotic fragments as compared to oligonucleosomes. Our results thus indicate that chromatin fragmentation in human apoptotic T-cells is not random but preferentially involves DNA sequences with the capability to form bent DNA. Whether this indicates a colocalization of DNase cleavage sites and phased adenosine tracts on the chromosomes or a bias in selecting sites for apoptotic DNA fragmentation is discussed. Analysing the underlying mechanisms will shed new light on DNA degradation in apoptosis.     

Characterization of three distinct cDNA clones encoding cysteine proteinases from maize (Zea mays L.) callus

In previous work, a 33 kDa cysteine proteinase was found in callus initiated from maize (Zea mays L.) resistant to fall armyworm feeding. A callus cDNA library from the maize inbred Mp708 was screened with oligonucleotides derived from the N-terminal amino acid sequence of the 33 kDa proteinase and several cDNA clones were isolated and sequenced. A cDNA clone encoding the 33 kDa cysteine proteinase, mir1, was identified. Two additional clones, mir2 and mir3, encoding putative cysteine proteinases were also identified. mir2 and mir3 are distinct from mir1 and each other, but show a high degree of homology. All of the mir cDNA clones map to distinct sites on the maize genome. Amino acid sequences encoded by the mir clones are similar to other known cysteine proteinases and are most closely related to the oryzain- and - precursors. The ERFNIN motif and a 12 amino acid conserved sequence are present in the propeptide region of the putative proteinases encoded by mir clones. mir2 and mir3 appear to have C-terminal extensions. The phylogenetic tree of nucleotide sequences of mir1, mir2, mir3 and other representative cysteine proteinases from protozoa, plants and animals was constructed.     

Isolation of A/D and C genome specific dispersed and clustered repetitive DNA sequences from Avena sativa.

DNA gel-blot and in situ hybridization with genome-specific repeated sequences have proven to be valuable tools in analyzing genome structure and relationships in species with complex allopolyploid genomes such as hexaploid oat (Avena sativa L., 2n = 6x = 42; AACCDD genome). In this report, we describe a systematic approach for isolating genome-, chromosome-, and region-specific repeated and low-copy DNA sequences from oat that can presumably be applied to any complex genome species. Genome-specific DNA sequences were first identified in a random set of A. sativa genomic DNA cosmid clones by gel-blot hybridization using labeled genomic DNA from different Avena species. Because no repetitive sequences were identified that could distinguish between the A and D gneomes, sequences specific to these two genomes are refereed to as A/D genome specific. A/D or C genome specific DNA subfragments were used as screening probes to identify additional genome-specific cosmid clones in the A. sativa genomic library. We identified clustered and dispersed repetitive DNA elements for the A/D and C genomes that could be used as cytogenetic markers for discrimination of the various oat chromosomes. Some analyzed cosmids appeared to be composed entirely of genome-specific elements, whereas others represented regions with genome- and non-specific repeated sequences with interspersed low-copy DNA sequences. Thus, genome-specific hybridization analysis of restriction digests of random and selected A. sativa cosmids also provides insight into the sequence organization of the oat genome.     

Cytological localization and organization of dispersed middle repetitive DNA sequences of Drosophila subobscura

To study the middle repetitive fraction of the Drosophila subobscura genome, 26 phage clones containing repetitive sequences were examined by Southern DNA blot analysis and by in situ hybridization to polytene chromosomes. These results led to a classification of the clones according to five different types of hybridization patterns. Two types, each containing seven clones, are characterized by hybridization at 100 to 300 sites dispersed over the euchromatic parts of the chromosomes, and in addition by one prominently labelled chromosome band. One of these two classes also showed strong labelling of the chromocentre. The remaining types of hybridization pattern lacked a prominent band but showed hybridization either to the euchromatic regions or to the chromocentre or both. Chromosome A (=X) was the preferred location of prominently labelled bands and it also showed an excess of labelling by some clones. Some of the cloned dispersed sequences were localized cytologically on chromosomes of larvae from crosses between different strains of D. subobscura and between two closely related species, in order to detect heterozygosity at hybridization sites. Comparisons of the chromosomal distribution of labelling sites showed differences in number and location, indicating the possibility of transposition events.     

Characterization of a pollen-specific cDNA clone from Zea mays and its expression.

A pollen-specific cDNA clone, Zmc13, has been isolated from a cDNA library constructed to poly(A) RNA from mature maize pollen. The cDNA as shown by primer extension analysis is a full-length copy of the mRNA. The cDNA has been sequenced and is 929 nucleotides in length plus a 47-nucleotide poly(A) tail. Putative polyadenylation signals are identifiable in the 3'-nontranslated region. The mRNA codes for a predicted polypeptide containing 170 amino acid residues and with a molecular mass of 18.3 kilodaltons. The hydropathy profile suggests a possible signal sequence on the amino terminus. A comparison of the nucleotide and deduced amino acid sequence with sequences in data banks has not shown homology to known molecules. In situ hybridizations using RNA probes show that the mRNA is located in the cytoplasm of the vegetative cell of the pollen grain and after germination is distributed throughout the pollen tube cytoplasm.     

Characterization of a highly repetitive family of DNA sequences in the mouse.

A large proportion (0.5-1%) of total mouse DNA is cleaved by Bam HI into fragments whose size is about 500 base pairs. A cloned member of this repetitive family of DNA sequences (BAM5 family) was sequenced by the dideoxy chain termination procedure and shown to contain 507 base pairs. The sequence exhibited no unusual or remarkable features. Repetitive sequences complementary to the cloned BAM5 fragment were found in rat DNA, but not in feline or human DNA. Restriction mapping suggested that many BAM5 sequences were components of much larger repetitive DNAs which were scattered throughout the mouse genome. The BAM5 sequences within the larger repetitive DNAs did not appear to be arranged tandemly or as members of scrambled tandem repeats. RNA homologous to the cloned BAM5 sequence was detected in cultured mouse cells, but not in cultured rat cells.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

Clustered and interspersed repetitive DNA sequences in four amphibian species with different genome size.

We have compared the amount of clustered and interspersed repetitive sequences in the genome of four Amphibia with different DNA contents per haploid nucleus: two Anura (Xenopus laevis, 3 pg and Bufo bufo, 7 pg) and two Urodela (Triturus cristatus, 23 pg and Necturus maculosus, 52 pg). High molecular weight DNA of the four species was denatured and reassociated to the same Cot in order to obtain duplex sequences with a similar reiteration frequency. Single-stranded DNA was digested off with the Aspergillus S1 nuclease. DNA was then fractionated according to the molecular weight through an agarose A-50 column. We found that the amount of long repetitive sequences is roughly proportional to the genome size in the four species, while the number of short (about 300 base pairs) repetitive sequences is increased many-fold in the species with the larger DNA content, both in Anura and in Urodela.     

Cloning of V region fragments from mouse liver DNA and localization of repetitive DNA sequences in the vicinity of immunoglobulin gene segments.

Two different kappa light chain genes have previously been isolated from one mouse myeloma. The V (variable, abbreviations in ref. 2) gene segments of the two genes were now used to identify their germline counterparts in EcoRI digests of mouse liver DNA. In addition two sets of related V gene segments were found which hybridize with either of the two DNA probes. Five of the V region fragments of one set were cloned in a lambda phage vector and partially characterized by restriction mapping and Southern blot hybridization. Repetitive DNA sequences were found on each of the five fragments as well as on other cloned immunoglobulin gene containing fragments. Cross-hybridization between some but not all of the regions containing repetitive DNA sequences was observed.     

A study of 28 Elymus species using repetitive DNA sequences.

Four repetitive DNA sequences cloned from the barley (Hordeum vulgare) genome and common for different Triticeae species were used for a molecular study of phylogenetic relationships among 28 Elymus species. Two wild Hordeum species (H genome), two Pseudoroegneria species (S genome), Agropyron cristatum (P genome), and Australopyrum velutinum (W genome) were included as genomic representatives for the genomes that supposedly were involved in the evolution of the genus Elymus. Our results are essentially congruent with the genomic classification system. This study demonstrates that Elymus is not a monophyletic genus. Based on an analysis of Southern blot hybridization we could discriminate between SY and SH species owing to the strong specific hybridization pattern of the H genome. Hexaploid SYH species gave a hybridization pattern similar to SH species for the same reason. The results support the genomic composition of Elymus batalinii as SYP and also indicated the presence of at least one H genome in Elymus enysii with a hitherto unknown genomic constitution. Elymus erianthus had a hybridization pattern distinctly different from all other species in the investigation. Key words : Elymus, RFLP, phylogeny, repetitive DNA.