DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

The trajectory of a stiff rod in a curved potential energy trough. An initial result for short nucleosomal rods

The equilibrium trajectory of the axis of a rod subject to an externally imposed curved potential energy trough tends to conform to the shape of the curved trough, but also tends to be straight because of elastic resistance to bending. The actual path of the axis is a balance between the two extremes. We consider a potential energy trough centered along a circular arc of radius R. For a rod of small length compared to R, we show that the axis at equilibrium forms an arc of a circle of radius greater than R. The value of the radius of the axial path depends on the relative values of the Hooke's Law bending constant for the rod and the depth and width of the trough. Motivation for the calculation is provided by nucleosomal DNA, which conforms to the surface of a roughly cylindrical histone core at physiological ionic strength, but is observed to unwind into a partially extended conformation at very low ionic strength. We suggest that the rigidity to bending of short DNA segments becomes sufficiently great at low ionic strength to overcome attractive interactions with the histone surface. Alternately, of course, if during the cell cycle mutually attractive forces between DNA and histone core are weakened at constant ionic strength, the same type of unfolding would be expected to occur as the strength of the DNA-histone contacts drops below the level required to overcome elastic resistance to bending of the DNA rod.     

Sequence-specific recognition of DNA in the nucleosome by pyrrole-imidazole polyamides

The ability of DNA-binding proteins to recognize their cognate sites in chromatin is restricted by the structure and dynamics of nucleosomal DNA, and by the translational and rotational positioning of the histone octamer. Here, we use six different pyrrole-imidazole polyamides as sequence-specific molecular probes for DNA accessibility in nucleosomes. We show that sites on nucleosomal DNA facing away from the histone octamer, or even partially facing the histone octamer, are fully accessible and that nucleosomes remain fully folded upon ligand binding. Polyamides only failed to bind where sites are completely blocked by interactions with the histone octamer. Removal of the amino-terminal tails of either histone H3 or histone H4 allowed these polyamides to bind. These results demonstrate that much of the DNA in the nucleosome is freely accessible for molecular recognition in the minor groove, and also support a role for the amino-terminal tails of H3 and H4 in modulating accessibility of nucleosomal DNA.     

The trajectory of a stiff rod in a curved potential energy trough

The equilibrium trajectory of the axis of a rod subject to an externally imposed curved potential energy trough tends to conform to the shape of the curved trough, but also tends to be straight because of elastic resistance to bending. The actual path of the axis is a balance between the two extremes. We consider a potential energy trough centered along a circular arc of radiusR. For a rod of small length compared toR, we show that the axis at equilibrium forms an arc of a circle of radius greater thanR. The value of the radius of the axial path depends on the relative values of the Hooke’s Law bending constant for the rod and the depth and width of the trough. Motivation for the calculation is provided by nucleosomal DNA, which conforms to the surface of a roughtly cylindrical histone core at physiological ionic strength, but is observed to unwind into a partially extended conformation at very low ionic strength. We suggest that the rigidity to bending of short DNA segments becomes sufficiently great at low ionic strength to overcome attractive interactions with the histone surface. Alternately, of course, if during the cell cycle mutually attractive forces between DNA and histone core are weakened at constant ionic strength, the same type of unfolding would be expected to occur as the strength of the DNA-histone contacts drops below the level required to overcome elastic resistance to bending of the DNA rod.     

Direct measurements of the nucleosome-forming preferences of periodic DNA motifs challenge established models

Several periodic motifs have been implicated in facilitating the bending of DNA around the histone core of the nucleosome. For example, di-nucleotides AA/TT/TA and GC at ∼10-bp periods, but offset by 5 bp, are found with higher-than-expected occurrences in aligned nucleosomal DNAs in vitro and in vivo. Additionally, regularly oscillating period-10 trinucleotide motifs non-T, A/T, G and their complements have been implicated in the formation of regular nucleosome arrays. The effects of these periodic motifs on nucleosome formation have not been systematically tested directly by competitive reconstitution assays. We show that, in general, none of these period-10 motifs, except TA, in certain sequence contexts, facilitates nucleosome formation. The influence of periodic TAs on nucleosome formation is appreciable; with some of the 200-bp DNAs out-competing bulk nucleosomal DNA by more than 400-fold. Only the nucleotides immediately flanking TA influence its nucleosome-forming ability. Period-10 TA, when flanked by a pair of permissive nucleotides, facilitates DNA bending through compression of the minor groove. The free energy change for nucleosome formation decreases linearly with the number of consecutive TAs, up to eight. We suggest how these data can be reconciled with previous findings.     

Anisotropic flexibility of DNA and the nucleosomal structure.

Potential energy calculations of the DNA duplex dimeric subunit show that the double helix may be bent in the direction of minor and major grooves much more easily than in other directions. It is found that the total winding angle of DNA decreases upon such bending. A new model for DNA folding in the nucleosome is proposed on the basis of these findings according to which the DNA molecule is kinked each fifth base pair to the side of the minor and major grooves alternatively. The model explains the known contradiction between a C-like circular dichroism for the nucleosomal DNA and the nuclease digestion data, which testify to the B-form of DNA.     

Theoretical study of structural transition in a nucleosome at low ionic strength

The theoretical analysis of nucleosome stability at low ionic strength has been performed on the basis of consideration of different contributions to the free energy of compact state of the nucleosome DNA terminal regions. The proposed model explains: the fact of low-salt structural change; the transition point (approximately 1.7 mM NaCl) and width (approximately 1 mM); the shift of the transition to the higher salt concentrations in the case of histones tails removal by trypsin. According to the model the increase of electrostatic repulsion between neighbouring turns of DNA superhelix is the main cause of the unwinding of nucleosomal DNA terminal regions in the course of low-salt structural change. The interactions between histone (H2A-H2B) dimer and (H3-H4)2 tetramer provide the compact state of the nucleosomal DNA terminal regions. The existence of electrostatic interactions of nucleosomal DNA terminal regions with tetramer was suggested. These interactions can provide the compact state of nucleosomal DNA at physiological ionic strength even in the absence of (H2A-H2B) dimer.     

Exocyclic groups in the minor groove influence the backbone conformation of DNA

Exocyclic groups in the minor groove of DNA modulate the affinity and positioning of nucleic acids to the histone protein. The addition of exocyclic groups decreases the formation of this protein–DNA complex, while their removal increases nucleosome formation. On the other hand, recent theoretical results show a strong correlation between the B_I/B_II phosphate backbone conformation and the hydration of the grooves of the DNA. We performed a simulation of the d(CGCGAATTCGCG)₂ Drew Dickerson dodecamer and one simulation of the d(CGCIAATTCGCG)₂ dodecamer in order to investigate the influence of the exocyclic amino group of guanine. The removal of the amino group introduces a higher intrinsic flexibility to DNA supporting the suggestions that make the enhanced flexibility responsible for the enlarged histone complexation affinity. This effect is attributed to changes in the destacking interactions of both strands of the DNA. The differences in the hydration of the minor groove could be the explanation of this flexibility. The changed hydration of the minor groove also leads to a different B_I/B_II substate pattern. Due to the fact that the histone preferentially builds contacts with the backbone of the DNA, we propose an influence of these B_I/B_II changes on the nucleosome formation process. Thus, we provide an additional explanation for the enhanced affinity to the histone due to removal of exocyclic groups. In terms of B_I/B_II we are also able to explain how minor groove binding ligands could affect the nucleosome assembly without disrupting the structure of DNA.     

Hydration of the RNA duplex r(CGCAAAUUUGCG)2 determined by NMR.

The so-called spine of hydration in the minor groove of AnTn tracts in DNA is thought to stabilise the structure, and kinetically bound water detected in the minor groove of such DNA species by NMR has been attributed to a narrow minor groove [Liepinsh, E., Leupin, W. and Otting, G. (1994) Nucleic Acids Res. 22, 2249-2254]. We report here an NMR study of hydration of an RNA dodecamer which has a wide, shallow minor groove. Complete assignments of exchangeable protons, and a large number of non-exchangeable protons in r(CGCAAAUUUGCG)2 have been obtained. In addition, ribose C2'-OH resonances have been detected, which are probably involved in hydrogen bonds. Hydration at different sites in the dodecamer has been measured using ROESY and NOESY experiments at 11.75 and 14.1 T. Base protons in both the major and minor grooves are in contact with water, with effective correlation times for the interaction of approximately 0.5 ns, indicating weak hydration, in contrast to the hydration of adenine C2H in the homologous DNA sequence. NOEs to H1' in the minor groove are consistent with hydration water present that is not observed in the analogous DNA sequence. Hydration kinetics in nucleic acids may be determined by chemical factors such as hydrogen-bonding more than by simple conformational factors such as groove width.     

Clipping of Flexible Tails of Histones H3 and H4 Affects the Structure and?Dynamics of the Nucleosome

Förster resonance energy transfer was used to monitor the dynamic conformations of mononucleosomes under different chromatin folding conditions to elucidate the role of the flexible N-terminal regions of H3 and H4 histones. The H3 tail was shown to partake in intranucleosomal interactions by restricting the DNA breathing motion and compacting the nucleosome. The H3 tail effects were mostly independent of the ionic strength and valency of the ions. The H4 tail was shown to not greatly affect the nucleosome conformation, but did slightly influence the relative population of the preferred conformation. The role of the H4 tail varied depending on the valency and ionic strength, suggesting that electrostatic forces play a primary role in H4 tail interactions. Interestingly, despite the H4 tail’s lack of influence, when H3 and H4 tails were simultaneously clipped, a more dramatic effect was seen than when only H3 or H4 tails were clipped. The combinatorial effect of H3 and H4 tail truncation suggests a potential mechanism by which various combinations of histone tail modifications can be used to control accessibility of DNA-binding proteins to nucleosomal DNA.     

Molecular modeling of the chromatosome particle

In an effort to understand the role of the linker histone in chromatin folding, its structure and location in the nucleosome has been studied by molecular modeling methods. The structure of the globular domain of the rat histone H1d, a highly conserved part of the linker histone, built by homology modeling methods, revealed a three-helical bundle fold that could be described as a helix–turn–helix variant with its characteristic properties of binding to DNA at the major groove. Using the information of its preferential binding to four-way Holliday junction (HJ) DNA, a model of the domain complexed to HJ was built, which was subsequently used to position the globular domain onto the nucleosome. The model revealed that the primary binding site of the domain interacts with the extra 20 bp of DNA of the entering duplex at the major groove while the secondary binding site interacts with the minor groove of the central gyre of the DNA superhelix of the nucleosomal core. The positioning of the globular domain served as an anchor to locate the C-terminal domain onto the nucleosome to obtain the structure of the chromatosome particle. The resulting structure had a stem-like appearance, resembling that observed by electron microscopic studies. The C-terminal domain which adopts a high mobility group (HMG)-box-like fold, has the ability to bend DNA, causing DNA condensation or compaction. It was observed that the three S/TPKK motifs in the C-terminal domain interact with the exiting duplex, thus defining the path of linker DNA in the chromatin fiber. This study has provided an insight into the probable individual roles of globular and the C-terminal domains of histone H1 in chromatin organization.     

The use of diaminopurine to investigate structural properties of nucleic acids and molecular recognition between ligands and DNA.

2,6-Diaminopurine (DAP) is an analogue of adenine which can be converted to nucleotides that serve as substrates for incorporation into nucleic acids by polymerases in place of (d)AMP. It pairs with thymidine (or uracil), engaging in three hydrogen bonds of the Watson-Crick type. The result of DAP incorporation is to add considerable stability to the double helix and to impart other structural features, such as an altered groove width and disruption of the normal spine of hydration. DNA containing DAP may or may not be recognized by restriction endonucleases; RNA containing DAP may not engage in normal splicing. The DAP.T pair affects the local flexibility of DNA and impedes the interaction with helix bending proteins. By providing a non-canonical hydrogen bond donor in the minor groove and/or blocking access to the floor of that groove it strongly affects interactions with small molecules such as antibiotics and anticancer drugs. Examples which illustrate altered recognition of nucleotide sequences in DAP-containing DNA are presented: changed sites of cutting by bleomycin, photocleavage by uranyl nitrate and footprinting with mithramycin. Using DNA in which both A-->DAP and G-->Inosine substitutions have been made it is possible to assess precisely the role of the purine 2-amino group in ligand-DNA recognition.     

Alteration of the groove width of DNA induced by the multimodal hydrogen bonding of denaturants with DNA bases in its grooves affects their stability

BackgroundDenaturants, namely, urea and guanidinium chloride (GdmCl) affect the stability as well as structure of DNA. Critical assessment of the role of hydrogen bonding of these denaturants with the different regions of DNA is essential in terms of its stability and structural aspect. However, the understanding of the mechanistic aspects of structural change of DNA induced by the denaturants is not yet well understood.MethodsIn this study, various spectroscopic along with molecular dynamics (MD) simulation techniques were employed to understand the role of hydrogen bonding of these denaturants with DNA bases in their stability and structural change.Results and conclusionIt has been found that both, GdmCl and urea intrude into groove region of DNA by striping surrounding water. The hydrogen bonding pattern of Gdm⁺ and urea with DNA bases in its groove region is multimodal and distinctly different from each other. The interaction of GdmCl with DNA is stabilized by electrostatic interaction whereas electrostatic and Lennard-Jones interactions both contribute for urea. Gdm⁺ forms direct hydrogen bond with the bases in the minor groove of DNA whereas direct and water assisted hydrogen bond takes place with urea. The hydrogen bond formed between Gdm⁺ with bases in the groove region of DNA is stronger than urea due to strong electrostatic interaction along with less self-aggregation of Gdm⁺ than urea. The distinct hydrogen bonding capability of Gdm⁺ and urea with DNA bases in its groove region affects its width differently. The interaction of Gdm⁺ decreases the width of the minor and major groove which probably increases the strength of hydrogen bond between the Watson-Crick base pairs of DNA leading to its stability. In contrast, the interaction of urea does not affect much to the width of the grooves except the marginal increase in the minor groove width which probably decreases the strength of hydrogen bond between Watson Crick base pairs leading to the destabilization of DNA.General significanceOur study clearly depicts the role of hydrogen bonding between DNA bases and denaturants in their stability and structural change which can be used further for designing of the guanidinium based drug molecules.     

DNA A-tracts bending: polarization effects on electrostatic interactions across their minor groove

Bending by the DNA A-tracts constitutes a contentious issue, suggesting deficiencies in the physics employed so far. Here, we inquire as to the importance in this bending of many-body polarization effects on the electrostatic interactions across their narrow minor groove. We have done this on the basis of the findings of Jarque and Buckingham who developed a procedure based on a Monte Carlo simulation for two charges of the same sign embedded in a polarizable medium. Remarkably, the present analysis reveals that for compact DNA conformations, which result from dynamic effects, an overall attractive interaction operates between the phosphate charges; this interaction is especially strong for the narrow minor groove of the A-tracts, suggesting a tendency for DNA to bend toward this groove. This tendency is in agreement with the conclusions of electrophoretic and NMR solution studies. The present analysis is also consistent with the experimental observations that the minor groove is much more easily compressible than the major groove and the bending propensity of the A-tracts is greatly reduced at “premelting” temperatures. By contrast, the dielectric screening model predicts a repulsion between the phosphate charges and is not consistent with the aforementioned bending tendency or experimental observations.     

Effects of DNA sequence and histone-histone interactions on nucleosome placement

Using competitive reconstitution, we have refined the parameters for the binding of histone octamers to artificial nucleosome-positioning sequences of the form: (A/T3nn(G/C)3nn. We find that the optimal period between flexible segments is approximately 10.1 base-pairs, supporting the view that the DNA on the nucleosome surface is overwound. The strongest requirement for flexible DNA is near the protein dyad. However, we see no indication of changes in DNA helical repeat in this region. Using a series of repetitive sequences, we confirm that neither all A/T-rich nor all G/C-rich regions are identical in promoting nucleosome formation. Surprisingly, A/T-rich segments containing the TpA step, subject to purine-purine clash in the minor groove, favor nucleosome formation over sequences lacking this step. Short tracts of adenine residues are found to position on the histone surface like other A/T-rich regions, in the manner predicted by the direction of their sequence-directed bends as determined by electrophoretic methods. Tracts containing five adenine residues are extremely aniostropic in their flexibility and are strongly detrimental to nucleosome formation when positioned for major groove compression. Longer adenine tracts are found to position near the ends of the nucleosomal DNA. However, other positions may be occupied by an A12 tract, with only a minor penalty in the free energy of nucleosome formation. Overall, reconstituted nucleosome positions are translationally degenerate, suggesting a weak dependence on DNA flexibility for nucleosome positioning. Dinucleosomal reconstitutions on tandem dimers of the 5 S RNA gene of Lytechinus variegatus demonstrate a weak phasing dependence for the interaction between nucleosomes. This interaction is maximal for the 202 base-pair repeat and suggests a co-operative mechanism for the formation of ordered nucleosomal arrays based on a combination of DNA flexibility and nucleosome-nucleosome interactions.     

Molecular modelling of ligand-DNA minor groove binding: role of ligand-water interactions

A procedure was developed for quantitative estimation of the ligand affinity for the DNA minor groove with allowance for ligand hydration, whereby the binding energy was calculated as the difference in the energies of ligand-DNA and ligand-water interactions. Adequacy of the procedure was demonstrated with the structural motifs (pyrrolecarboxamide, benzimidazole, furancarboxamide, and phthalimide) of well-known ligands for the case of a d(GCA10CG).d(CGT10GC) duplex. On the strength of the results obtained, an indole-based motif was proposed as the basis for a highly affined minor groove binder.