Torus mandibularis in 45,X females (Turner syndrome)

Ninety-three Finnish females with a 45,X chromosome constitution, 78 first-degree female, and 37 first-degree male relatives were examined to determine the frequency and expression of torus mandibularis. The results indicate that among adults the frequency of the trait was significantly lower and the expression weaker in the 45,X females than in male control relatives. A similar trend was observed in comparison to normal females. In juveniles the trend was reversed. Our findings suggest that the sex chromosomes may have an influence on the occurrence, expression, and timing of development of the mandibular torus. Sexual dimorphism in the manifestation of torus mandibularis may result particularly from the effect of the Y chromosome on growth. © 1996 Wiley-Liss, Inc.     

Reduced tooth size in 45,X (Turner syndrome) females

Mean values and variances of deciduous and permanent tooth dimensions were compared between 121 45,X (Turner syndrome) females and 171 control subjects to clarify the role of the X chromosome on dental development. Although deciduous molars tended to be smaller than normal in 45,X females, there was no evidence of a reduction in tooth size for deciduous anterior teeth. In the permanent dentition, all mesiodistal dimensions were significantly smaller in 45,X females but only some of the buccolingual dimensions were smaller. The findings for deciduous tooth-size may reflect a sampling effect related to the extremely high frequency of spontaneous abortion in 45,X individuals. Results for permanent teeth are consistent with the concept of a decrease in enamel thickness in 45,X females.     

A Turner patient with a 45,X,t(1;2) (q41;p11.2) karyotype

The most common chromosomal anomaly is 45,X in the Turner syndrome. In addition to this, anomaly, mosaicism such as structural 46,X,i(Xq), 46,X,del(Xp), 46,X,r(X), 46,X,t(X;Y) and numerical 46XO/46,XX/47XXX are seen rather frequently. An infant with the Turner syndrome was found to have a karyotype 45X,t(1;2) (q41;p16) using high resolution banding. Based on our knowledge, we present the first case of 45X,t(1;2) (q41;p11.2), a karyotype in Turner's syndrome in the literature.     

45,X/47,XYY mosaicism in a patient with Turner's syndrome

Summary A patient with classical Turner's syndrome and a 45,X/47,XYY mosaicism is described. Each cell line was present in approximately equal amounts in the peripheral blood lymphocytes, while in fibroblasts derived from skin and both gonads only the 45,X karyotype was present. It is suggested that the latter fact is responsible for the patient not having the mixed gonadal dysgenesis syndrome or tumor formation in both streak gonads.     

Turner syndrome mosaicism: an unusual case with a de novo large dicentric marker chromosome: mos 45,X/46,X, ter rea(X;X)(p22.3;p22.3)

X/X translocations are quite rare in humans. The effect of this anomaly on the phenotype is variable and depends on the amount of deleted material and whether the chromosomes are joined by their long or short arms. We report an unusual case of Turner syndrome mosaicism in a 16-year-old girl, who was referred to our Institute for primary amenorrhoea associated with short stature. Endocrine evaluation revealed hypergonadotropic hypogonadism, which required a study of the karyotype. Cytogenetic analysis, performed on peripheral blood leucocytes, showed a mos 45,X/46,X,ter rea (X;X)(p22.3;p22.3) de novo karyotype. The prevalent cell line was 45,X (90% cells). A second cell line (10% cells) showed a very large marker chromosome, similar to a large metacentric chromosome. FISH (fluorescent in situ hybridisation) and molecular analysis revealed that the marker chromosome was dicentric and totally derived from the paternal X chromosome.     

del(X)(p22.1)/r(X)(p22.1q28) Dynamic mosaicism in a Turner syndrome patient

We report on a 16-year-old patient with Turner syndrome who presented a mos 46,X,del(X)(p22.1)[35]/45,X [19]/46,X,r(X)(p22.1q28)[6]GTG-band karyotype. The R-banding showed that the abnormal X-chromosome was inactive in all 61 cells analyzed. Fluorescence in situ hybridization with a Xp/Yp subtelomeric probe revealed that both abnormal chromosomes lacked the complementary sequences, a fact consistent with a terminal deletion. Besides, the molecular analysis of the human androgen receptor gene showed that the rearranged chromosome was paternal in origin. Since the deleted and the ring chromosomes had the same size and banding pattern, and because the former was the predominant cell line, it was inferred that the Xp- formed a ring in some cells apparently without further loss of genetic material. However, the reverse sequence and even a simultaneous origin due to a complex intrachromosomal exchange are also conceivable. The mild Turner syndrome phenotype is explained by the mosaicism and by the size of the deleted segment.     

A complex mosaicism 45,X/46,X,del(Xq)/46,X,idic(Xq) in a patient with secondary amenorrhea

A complex mosaicism involving the X chromosome was found in a 35-year-old female affected by secondary amenorrhea and short stature. Her karyotype was: 45,X[20]/46,X,del(X)(pter-->q26::qter)[15]/46,X,idic(X)(pter-->q26::q26-->pter)[9]. No cell contained both abnormal X chromosomes. This observation would suggest a possible mechanism underlying the formation of isodicentric chromosomes.     

X/X translocation in a patient with Turner's syndrome

Summary An abnormally large X chromosome was found in a girl with Turner's syndrome, and was identified as a X/X translocation (karyotype 45,X/46,X,-X,+t(XqXp)).Aided by contract No. 20. 122 F.W.G.O., Belgium.     

Cri du chat and Turner syndrome features in a newborn girl with an unbalanced 45,X,psu dic(5;X)(p15.2;p22.1) karyotype: FISH and replication banding studies.

A newborn girl with features of Turner and Cri du chat syndromes was found to have a pseudodicentric 5;X chromosome. Her karyotype was 45,X, psu dic(5;X)(p15.2;p22.1). The net result was monosomy for 5p15.2-pter and Xp22.1-pter. Fluorescence in situ hybridization (FISH) showed the Cri du chat region was deleted. Replication banding studies to assess the X-inactivation pattern found only the X portion of the pseudodicentric chromosome to be late replicating without any apparent spread of inactivation into chromosome 5 segment. There are only two cases reported with a dicentric X; autosome. In this paper, we compare the cytogenetics of the present case and those in the literature.     

Mosaicism 45,X/46,X, t dic(Xp:Xp) in a girl with short stature

An eight-year-old girl with marked short stature and no apparent stigmata of Turner syndrome was investigated. Clinical features include bilateral epicanthic folds, frontal bossing, prominent ears and normal intelligence. Ultrasound scanning revealed an apparently normal vagina, streak ovaries and no uterus. Bone age was normal. Karyotype analysis of peripheral blood lymphocytes showed mos 45,X/46,X tdic(Xp:Xp) in the ratio 66:34, respectively. In addition, three cells with different abnormal X chromosomes were present which possibly originated from a 46,XX clone. Replication of the duplicated X chromosome was consistently late and symmetrical. Buccal smear confirmation of the karyotype showed Barr body negative in 90% and large or bipartite in 10% of the cells. Karyotypes of the parents were normal. The clinical manifestations in cases of Xp deletion due to terminal rearrangement associated with or without a 45,X cell line are discussed.     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

45,X/46,X,dic(Yq) mosaicism and mixed gonadal dysgenesis. Case report and review of the literature.

A 4 year 7 month-old boy with ambiguous genitalia, histological evidence of mixed gonadal dysgenesis, and 45,X/46,X,dic(Yq) mosaicism is reported. The identity of the dicentric Y chromosome was stablished by its typical fluorescent banding patterns and the presence of two centromeres demonstrated by C-band technique. A review of the literature yielded nine additional cases of mosaic 45,X/46,X,dic(Yq). Phenotypical and histological findings among these cases were compared, and the possible localization of the genes responsible for testicle induction and maturation is discussed.     

Cytogenetic analysis of spermatozoa in a patient with chromosome constitution 45,X/46,X,r(Y) by intracytoplasmic injection into mouse oocytes

The chromosome set of human spermatozoa was studied by intracytoplasmic injection into mouse oocytes. A total of 85 metaphase plates of male pronuclei of a patient with chromosome constitution 46,X,r(Y)/45,X and 108 metaphase plates of patients with normal sperm parameters (control group) were examined. The ratio between X- and Y-bearing chromosomes in the 46,X,r(Y)/45,X patient and in the control group did not differ from 1:1. A significant increase in the rates of diploidy, hypoploidy, hyperploidy of sex chromosomes, and chromosome structure rearrangements in spermatozoa of the patient in comparison with spermatozoa in the control group was recorded.