Molecular mechanisms of pH-driven conformational transitions of proteins: insights from continuum electrostatics calculations of acid unfolding

The acid unfolding of staphylococcal nuclease (SNase) is very cooperative (Whitten and García-Moreno, Biochemistry 2000;39:14292-14304). As many as seven hydrogen ions (H+) are bound preferentially by the acid-unfolded state relative to the native (N) state in the pH range 3.2-3.9. To investigate the mechanism of acid unfolding, structure-based pKa calculations were performed with a variety of continuum electrostatic methods. The calculations reproduced successfully the H+ binding properties of the N state between pH 5 and 9, but they systematically overestimated the number of H+ bound upon acid unfolding. The calculated pKa values of all carboxylic residues in the N state were more depressed than they should be. The discrepancy between the observed and the calculated H+ uptake upon acid unfolding was not improved by using high protein dielectric constants, structures relaxed with molecular dynamics, or other empirical modifications implemented previously by others to maximize agreement between measured and calculated pKa values. This suggests an important role for conformational fluctuations of the backbone as important determinants of pKa values of carboxylic groups. Because no global or subglobal conformational changes have been observed previously for SNase under acidic conditions above the acid-unfolding region, these fluctuations must be local. The acid unfolding of SNase does not seem to involve the disruption of the N state by accruement of intramolecular repulsive interactions, nor the protonation of key ion paired carboxylic residues. It is more consistent with modest contributions from many H+ binding groups, with an important role for local conformational fluctuations in the coupling between H+ binding and the global structural transition.     

Backbone conformational dependence of peptide acidity

Electrostatic interactions at the protein surface yield over a billion-fold range of amide hydrogen exchange rates. This range is equivalent to the maximal degree of attenuation in exchange rates that have been shown to occur for amides buried within the protein interior. Continuum dielectric analysis of Ala-Ala, Ala-Gly, Gly-Ala and trans-Pro-Ala peptide conformer acidities predicts that the relative orientation of the two neighboring peptide groups can account for a million-fold variation in hydroxide-catalyzed hydrogen exchange rates. As in previous protein studies, an internal dielectric value of 3 was found to be applicable to simple model peptides, presumably reflecting the short lifetime of the peptide anion intermediate. Despite the million-fold range in conformer acidities, the small differences in the experimental exchange rates for these peptides are accurately predicted. Ala-Ala conformers with an extended N-terminal residue and the C-terminal residue in the α conformation are predicted to account for over 60% of the overall hydrogen exchange reaction, despite constituting only 12% of the protein coil population.     

Analysis of long-range interactions in a model denatured state of staphylococcal nuclease based on correlated changes in backbone dynamics.

An expanded, highly dynamic denatured state of staphylococcal nuclease exhibits a native-like topology in the apparent absence of tight packing and fixed hydrogen bonds (Gillespie JR, Shortle D, 1997, J Mol Biol 268:158-169, 170-184). To address the physical basis of the long-range spatial ordering of this molecule, we probe the effects of perturbations of the sequence and solution conditions on the local chain dynamics of a denatured 101-residue fragment that is missing the first three beta strands. Structural interactions between chain segments are inferred from correlated changes in the motional behavior of residues monitored by 15N NMR relaxation measurements. Restoration of the sequence corresponding to the first three beta strands significantly increases the average order of all chain segments that form the five strand beta barrel including loops but has no effect on the carboxy terminal 30 residues. Addition of the denaturing salt sodium perchlorate enhances ordering over the entire sequence of this fragment. Analysis of seven different substitution mutants points to a complex set of interactions between the hydrophobic segment corresponding to beta strand 5 and the remainder of the chain. General patterns in the data suggest there is a hierarchy of native-like interactions that occur transiently in the denatured state and are consistent with the overall topology of the denatured state ensemble being determined by many coupled local interactions rather than a few highly specific long-range interactions.     

Stabilization of a strained protein loop conformation through protein engineering.

Staphylococcal nuclease is found in two folded conformations that differ in the isomerization of the Lys 116-Pro 117 peptide bond, resulting in two different conformations of the residue 112-117 loop. The cis form is favored over the trans with an occupancy of 90%. Previous mutagenesis studies have shown that when Lys 116 is replaced by glycine, a trans conformation is stabilized relative to the cis conformation by the release of steric strain in the trans form. However, when Lys 116 is replaced with alanine, the resulting variant protein is identical to the wild-type protein in its structure and in the dominance of the cis configuration. The results of these studies suggested that any nuclease variant with a non-glycine residue at position 116 should also favor the cis form because of steric requirements of the beta-carbon at this position. In this report, we present a structural analysis of four nuclease variants with substitutions at position 116. Two variants, K116E and K116M, follow the "beta-carbon" hypothesis by favoring the cis form. Furthermore, the crystal structure of K116E is nearly identical to that of the wild-type protein. Two additional variants, K116D and K116N, provide exceptions to this simple "beta-carbon" rule in that the trans conformation is stabilized relative to the cis configuration by these substitutions. Crystallographic data indicate that this stabilization is effected through the addition of tertiary interactions between the side chain of position 116 with the surrounding protein and water structure. The detailed trans conformation of the K116D variant appears to be similar to the trans conformation observed in the K116G variant, suggesting that these two mutations stabilize the same conformation but through different mechanisms.     

A buried lysine that titrates with a normal pKa: role of conformational flexibility at the protein-water interface as a determinant of pKa values

Previously we reported that Lys, Asp, and Glu residues at positions 66 and 92 in staphylococcal nuclease (SNase) titrate with pK(a) values shifted by up to 5 pK(a) units in the direction that promotes the neutral state. In contrast, the internal Lys-38 in SNase titrates with a normal pK(a). The crystal structure of the L38K variant shows that the side chain of Lys-38 is buried. The ionizable moiety is approximately 7 A from solvent and ion paired with Glu-122. This suggests that the pK(a) value of Lys-38 is normal because the energetic penalty for dehydration is offset by a favorable Coulomb interaction. However, the pK(a) of Lys-38 was also normal when Glu-122 was replaced with Gln or with Ala. Continuum electrostatics calculations were unable to reproduce the pK(a) of Lys-38 unless the protein was treated with an artificially high dielectric constant, consistent with structural reorganization being responsible for the normal pK(a) value of Lys-38. This reorganization must be local because circular dichroism and NMR spectroscopy indicate that the L38K protein is native-like under all conditions studied. In molecular dynamics simulations, the ion pair between Lys-38 and Glu-122 is unstable. The simulations show that a minor rearrangement of a loop is sufficient to allow penetration of water to the amino moiety of Lys-38. This illustrates both the important roles of local flexibility and water penetration as determinants of pK(a) values of ionizable groups buried near the protein-water interface, and the challenges faced by structure-based pK(a) calculations in reproducing these effects.     

Heat capacities and a snapshot of the energy landscape in protein GB1 from the pre-denaturation temperature dependence of backbone NH nanosecond fluctuations

Protein stability is usually characterized calorimetrically by a melting temperature and related thermodynamic parameters. Despite its importance, the microscopic origin of the melting transition and the relationship between thermodynamic stability and dynamics remains a mystery. Here, NMR relaxation parameters were acquired for backbone 15NH groups of the 56 residue immunoglobulin-binding domain of streptococcal protein G over a pre-denaturation temperature range of 5-50 degrees C. Relaxation data were analyzed using three methods: the standard three-Lorentzian model free approach; the F(omega)=2omegaJ(omega) spectral density approach that yields motional correlation time distributions, and a new approach that determines frequency-dependent order parameters. Regardless of the method of analysis, the temperature dependence of internal motional correlation times and order parameters is essentially the same. Nanosecond time-scale internal motions are found for all NHs in the protein, and their temperature dependence yields activation energies ranging up to about 33kJ/mol residue. NH motional barrier heights are structurally correlated, with the largest energy barriers being found for residues in the most "rigid" segments of the fold: beta-strands 1 and 4 and the alpha-helix. Trends in this landscape also parallel the free energy of folding-unfolding derived from hydrogen-deuterium (H-D) exchange measurements, indicating that the energetics for internal motions occurring on the nanosecond time-scale mirror those occurring on the much slower time-scale of H-D exchange. Residual heat capacities, derived from the temperature dependence of order parameters, range from near zero to near 100J/mol K residue and correlate with this energy landscape. These results provide a unique picture of this protein's energy landscape and a relationship between thermodynamic stability and dynamics that suggests thermosensitive regions in the fold that could initiate the melting process.     

NMR‐monitored titration of acid‐stress bacterial chaperone HdeA reveals that Asp and Glu charge neutralization produces a loosened dimer structure in preparation for protein unfolding and chaperone activation

HdeA is a periplasmic chaperone found in several gram‐negative pathogenic bacteria that are linked to millions of cases of dysentery per year worldwide. After the protein becomes activated at low pH, it can bind to other periplasmic proteins, protecting them from aggregation when the bacteria travel through the stomach on their way to colonize the intestines. It has been argued that one of the major driving forces for HdeA activation is the protonation of aspartate and glutamate side chains. The goal for this study, therefore, was to investigate, at the atomic level, the structural impact of this charge neutralization on HdeA during the transition from near‐neutral conditions to pH 3.0, in preparation for unfolding and activation of its chaperone capabilities. NMR spectroscopy was used to measure pK_a values of Asp and Glu residues and monitor chemical shift changes. Measurements of R₂/R₁ ratios from relaxation experiments confirm that the protein maintains its dimer structure between pH 6.0 and 3.0. However, calculated correlation times and changes in amide protection from hydrogen/deuterium exchange experiments provide evidence for a loosening of the tertiary and quaternary structures of HdeA; in particular, the data indicate that the dimer structure becomes progressively weakened as the pH decreases. Taken together, these results provide insight into the process by which HdeA is primed to unfold and carry out its chaperone duties below pH 3.0, and it also demonstrates that neutralization of aspartate and glutamate residues is not likely to be the sole trigger for HdeA dissociation and unfolding.     

The importance of anchorage in determining a strained protein loop conformation.

We examine the role of the conformational restriction imposed by constrained ends of a protein loop on the determination of a strained loop conformation. The Lys 116-Pro 117 peptide bond of staphylococcal nuclease A exists in equilibrium between the cis and trans isomers. The folded protein favors the strained cis isomer with an occupancy of 90%. This peptide bond is contained in a solvent-exposed, flexible loop of residues 112-117 whose ends are anchored by Val 111 and Asn 118. Asn 118 is constrained by 2 side-chain hydrogen bonds. We investigate the importance of this constraint by replacing Asn 118 with aspartate, alanine, and glycine. We found that removing 1 or more of the hydrogen bonds observed in Asn 118 stabilizes the trans configuration over the cis configuration. By protonating the Asp 118 side chain of N118D through decreased pH, the hydrogen bonding character of Asp 118 approached that of Asn 118 in nuclease A, and the cis configuration was stabilized relative to the trans configuration. These data suggest that the rigid anchoring of the loop end is important in establishing the strained cis conformation. The segment of residues 112-117 in nuclease A provides a promising model system for study of the basic principles that determine polypeptide conformations. Such studies could be useful in the rational design or redesign of protein molecules.     

The role of backbone conformational heat capacity in protein stability: temperature dependent dynamics of the B1 domain of Streptococcal protein G

The contributions of backbone NH group dynamics to the conformational heat capacity of the B1 domain of Streptococcal protein G have been estimated from the temperature dependence of 15N NMR-derived order parameters. Longitudinal (R1) and transverse (R2) relaxation rates, transverse cross-relaxation rates (eta(xy)), and steady state [1H]-15N nuclear Overhauser effects were measured at temperatures of 0, 10, 20, 30, 40, and 50 degrees C for 89-100% of the backbone secondary amide nitrogen nuclei in the B1 domain. The ratio R2/eta(xy) was used to identify nuclei for which conformational exchange makes a significant contribution to R2. Relaxation data were fit to the extended model-free dynamics formalism, incorporating an axially symmetric molecular rotational diffusion tensor. The temperature dependence of the order parameter (S2) was used to calculate the contribution of each NH group to conformational heat capacity (Cp) and a characteristic temperature (T*), representing the density of conformational energy states accessible to each NH group. The heat capacities of the secondary structure regions of the B1 domain are significantly higher than those of comparable regions of other proteins, whereas the heat capacities of less structured regions are similar to those in other proteins. The higher local heat capacities are estimated to contribute up to approximately 0.8 kJ/mol K to the total heat capacity of the B1 domain, without which the denaturation temperature would be approximately 9 degrees C lower (78 degrees C rather than 87 degrees C). Thus, variation of backbone conformational heat capacity of native proteins may be a novel mechanism that contributes to high temperature stabilization of proteins.     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence. Correspondence to: A. N. Lane     

Characterization of the backbone dynamics of an anti-digoxin antibody VL domain by inverse detected 1H–15N NMR: Comparisons with X-ray data for the Fab

The dynamic behavior of the polypeptide backbone of a recombinant anti-digoxin antibody V_L domain has been characterized by measurements of ¹⁵N T₁ and T₂ relaxation times, ¹H–¹⁵N NOE values, and ¹H–²H exchange rates. These data were acquired with 2D inverse detected heteronuclear ¹H–¹⁵N NMR methods. The relaxation data are interpreted in terms of model free spectral density functions and exchange contributions to transverse relaxation rates R₂ (= 1/T₂). All characterized residues display low-amplitude picosecond timescale librational motions. Fifteen residues undergo conformational changes on the nanosecond timescale, and 24 residues have significant R₂ exchange contributions, which reflect motions on the microsecond to millisecond timescale. For several residues, microsecond to millisecond motions of nearby aromatic rings are postulated to account for some or all of their observed R₂ exchange contributions. The measured ¹H–²H exchange rates are correlated with hydrogen bonding patterns and distances from the solvent accessible surface. The degree of local flexibility indicated by the NMR measurements is compared to crystallographic B-factors derived from X-ray analyses of the native Fab and the Fab/digoxin complex. In general, both the NMR and X-ray data indicate enhanced flexibility in the turns, hypervariable loops, and portions of β-strands A, B, and G. However, on a residue-specific level, correlations among the various NMR data, and between the NMR and X-ray data, are often absent. This is attributed to the different dynamic processes and environments that influence the various observables. The combined data indicate that certain regions of the V_L domain, including the three hypervariable loops, undergo dynamic changes upon V_L:V_H association and/ or complexation with digoxin. Overall, the 26–10 V_L domain exhibits relatively low flexibility on the ps–ns timescale. The possible functional consequences of this result are considered. © 1993 Wiley-Liss, Inc.     

Comparison of backbone dynamics of monomeric and domain-swapped stefin A

Three-dimensional domain swapping has been observed in increasing number of proteins and has been implicated in the initial stages of protein aggregation, including that of the cystatins. Stefin A folds as a monomer under native conditions, while under some denaturing conditions domain-swapped dimer is formed. We have determined the backbone dynamics of the monomeric and domain-swapped dimeric forms of stefin A by (15)N relaxation using a model-free approach. The overall correlation times of the molecules were determined to be 4.6 +/- 0.1 ns and 9.2 +/- 0.2 ns for the monomer and the dimer, respectively. In the monomer, decreased order parameters indicate an increased mobility for the N-terminal trunk, the first and the second binding loops. At the opposite side of the molecule, the loop connecting the alpha-helix with strand B, the beginning of strand B and the loop connecting strands C and D show increased localized mobility. In the domain-swapped dimer, a distinctive feature of the structure is the concatenation of strands B and C into a single long beta-strand. The newly formed linker region between strands B and C, which substitutes for the first binding loop in the monomer, has order parameters typical for the remainder of the beta-strands. Thus, the interaction between subunits that occurs on domain-swapping has consequences for the dynamics of the protein at long-range from the site of conformational change, where an increased rigidity in the newly formed linker region is accompanied by an increased mobility of loops remote from that site.     

Early formation of a beta hairpin during folding of staphylococcal nuclease H124L as detected by pulsed hydrogen exchange

Pulsed hydrogen exchange methods were used to follow the formation of structure during the refolding of acid-denatured staphylococcal nuclease containing a stabilizing Leu substitution at position 124 (H124L SNase). The protection of more than 60 backbone amide protons in uniformly (15)N-labeled H124L SNase was monitored as a function of refolding time by heteronuclear two-dimensional NMR spectroscopy. As found in previous studies of staphylococcal nuclease, partial protection was observed for a subset of amide protons even at the earliest folding time point (10 msec). Protection indicative of marginally stable hydrogen-bonded structure in an early folding intermediate was observed at over 30 amide positions located primarily in the beta-barrel and to a lesser degree in the alpha-helical domain of H124L SNase. To further characterize the folding intermediate, protection factors for individual amide sites were measured by varying the pH of the labeling pulse at a fixed refolding time of 16 msec. Protection factors >5.0 were observed only for amide positions in a beta-hairpin formed by strands 2 and 3 of the beta-barrel domain and a single site near the C-terminus. The results indicate that formation of stable hydrogen-bonded structure in a core region of the beta-sheet is among the earliest structural events in the folding of SNase and may serve as a nucleation site for further structure formation.     

Rapid structural fluctuations of the free HIV protease flaps in solution: Relationship to crystal structures and comparison with predictions of dynamics calculations

Crystal structures have shown that the HIV-1 protease flaps, domains that control access to the active site, are closed when the active site is occupied by a ligand. Although flap structures ranging from closed to semi-open are observed in the free protease, crystal structures reveal that even the semi-open flaps block access to the active site, indicating that the flaps are mobile in solution. The goals of this paper are to characterize the secondary structure and fast (sub-ns) dynamics of the flaps of the free protease in solution, to relate these results to X-ray structures and to compare them with predictions of dynamics calculations. To this end we have obtained nearly complete backbone and many sidechain signal assignments of a fully active free-protease construct that is stabilized against autoproteolysis by three point mutations. The secondary structure of this protein was characterized using the chemical shift index, measurements of (3h)J(NC') couplings across hydrogen bonds, and NOESY connectivities. Analysis of these measurements indicates that the protease secondary structure becomes irregular near the flap tips, residues 49-53. Model-free analysis of (15)N relaxation parameters, T(1), T(2) (T(1rho)) and (15)N-[(1)H] NOE, shows that residues in the flap tips are flexible on the sub-ns time scale, in contrast with previous observations on the inhibitor-bound protease. These results are compared with theoretical predictions of flap dynamics and the possible biological significance of the sub-ns time scale dynamics of the flap tips is discussed.     

Probing the contribution of internal cavities to the volume change of protein unfolding under pressure.

The structural origin of the decrease in system volume upon protein denaturation by pressure has remained a puzzle for decades. This negative volume change upon unfolding is assumed to arise globally from more intimate interactions between the polypeptide chain and water, including electrostriction of buried charges that become exposed upon unfolding, hydration of the polypeptide backbone and amino acid side chains and elimination of packing defects and internal void volumes upon unfolding of the chain. However, the relative signs and magnitudes of each of these contributing factors have not been experimentally determined. Our laboratory has probed the fundamental basis for the volume change upon unfolding of staphylococcal nuclease (Snase) using variable solution conditions and point mutants of Snase (Royer CA et al., 1993, Biochemistry 32:5222-5232; Frye KJ et al., 1996, Biochemistry 35:10234-10239). Our prior results indicate that for Snase, neither electrostriction nor polar or nonpolar hydration contributes significantly to the value of the volume change of unfolding. In the present work, we investigate the pressure induced unfolding of three point mutants of Snase in which internal cavity size is altered. The experimentally determined volume changes of unfolding for the mutants suggest that loss of internal void volume upon unfolding represents the major contributing factor to the value of the volume change of Snase unfolding.     

Measuring the pH dependence of hydrogenase activities

The pH dependences of activities of homogenous hydrogenases of Thiocapsa roseopersicina and Desulfomicrobium baculatum in the reaction of hydrogen uptake in solution in the presence of benzyl viologen and the pH dependences of catalytic currents of hydrogen oxidation by electrodes on which these hydrogenases were immobilized were compared. Maximal activities of the hydrogenases from T. roseopersicina and D. baculatum in the reaction hydrogen uptake in solution were observed at pH 9.5 and 8.5, respectively. However, the steady-state current caused by catalytic uptake of hydrogen was maximal for the T. roseopersicina hydrogenase-containing electrode at pH 5.5-6.5 under overvoltage of 30-60 mV, whereas for electrodes with D. baculatum hydrogenase it was maximal at pH 6.0-6.5. Analysis of these data suggests that pH-dependent changes in the hydrogenase activities in solution during hydrogen uptake are due not only to the effect of proton concentration on the enzyme conformation or protonation of certain groups of the enzyme active center, but they are rather indicative of changes in free energy of the reaction accompanying changes in pH.     

Studying pressure denaturation of a protein by molecular dynamics simulations

Many globular proteins unfold when subjected to several kilobars of hydrostatic pressure. This “unfolding‐up‐on‐squeezing” is counter‐intuitive in that one expects mechanical compression of proteins with increasing pressure. Molecular simulations have the potential to provide fundamental understanding of pressure effects on proteins. However, the slow kinetics of unfolding, especially at high pressures, eliminates the possibility of its direct observation by molecular dynamics (MD) simulations. Motivated by experimental results—that pressure denatured states are water‐swollen, and theoretical results—that water transfer into hydrophobic contacts becomes favorable with increasing pressure, we employ a water insertion method to generate unfolded states of the protein Staphylococcal Nuclease (Snase). Structural characteristics of these unfolded states—their water‐swollen nature, retention of secondary structure, and overall compactness—mimic those observed in experiments. Using conformations of folded and unfolded states, we calculate their partial molar volumes in MD simulations and estimate the pressure‐dependent free energy of unfolding. The volume of unfolding of Snase is negative (approximately ?60 mL/mol at 1 bar) and is relatively insensitive to pressure, leading to its unfolding in the pressure range of 1500–2000 bars. Interestingly, once the protein is sufficiently water swollen, the partial molar volume of the protein appears to be insensitive to further conformational expansion or unfolding. Specifically, water‐swollen structures with relatively low radii of gyration have partial molar volume that are similar to that of significantly more unfolded states. We find that the compressibility change on unfolding is negligible, consistent with experiments. We also analyze hydration shell fluctuations to comment on the hydration contributions to protein compressibility. Our study demonstrates the utility of molecular simulations in estimating volumetric properties and pressure stability of proteins, and can be potentially extended for applications to protein complexes and assemblies. Proteins 2010. © 2009 Wiley‐Liss, Inc.     

pH driven conformational dynamics and dimer-to-monomer transition in DLC8

Dynein light chain protein, a part of the cytoplasmic motor assembly, is a homodimer at physiological pH and dissociates below pH 4.5 to a monomer. The dimer binds to a variety of cargo, whereas the monomer does not bind any of the target proteins. We report here the pH induced stepwise structural and motional changes in the protein, as derived from line broadening and 15N transverse relaxation measurements. At pH 7 and below until 5, partial protonation and consequent interconversion between molecules carrying protonated and neutral histidines, causes conformational dynamics in the dimeric protein and this increases with decreasing pH. Enhanced dynamics in turn leads to partial loosening of the structure. This would have implications for different efficacies of binding by target proteins due to small variations in pH in different parts of the cell, and hence for cargo trafficking from one part to another. Below pH 5, enhanced charge repulsions, partial loss of hydrophobic interactions, and destabilization of H-bonds across the dimer interface cause further loosening of the dimeric structure, leading eventually to the dissociation of the dimer.     

Protein hydrogen exchange: testing current models

To investigate the determinants of protein hydrogen exchange (HX), HX rates of most of the backbone amide hydrogens of Staphylococcal nuclease were measured by NMR methods. A modified analysis was used to improve accuracy for the faster hydrogens. HX rates of both near surface and well buried hydrogens are spread over more than 7 orders of magnitude. These results were compared with previous hypotheses for HX rate determination. Contrary to a common assumption, proximity to the surface of the native protein does not usually produce fast exchange. The slow HX rates for unprotected surface hydrogens are not well explained by local electrostatic field. The ability of buried hydrogens to exchange is not explained by a solvent penetration mechanism. The exchange rates of structurally protected hydrogens are not well predicted by algorithms that depend only on local interactions or only on transient unfolding reactions. These observations identify some of the present difficulties of HX rate prediction and suggest the need for returning to a detailed hydrogen by hydrogen analysis to examine the bases of structure-rate relationships, as described in the companion paper (Skinner et al., Protein Sci 2012;21:996-1005).