共查询到20条相似文献,搜索用时 15 毫秒
1.
Isothermal titration calorimetry (ITC) was used to test the hypothesis that the relatively small enthalpy change (DeltaHobs) and large negative heat capacity change (DeltaCp,obs) observed for the binding of the Escherichia coli SSB protein to single-stranded (ss) oligodeoxyadenylates result from the temperature-dependent adenine base unstacking equilibrium that is thermodynamically coupled to binding. We have determined DeltaH1,obs for the binding of 1 mole of each of dT(pT)34, dC(pC)34, and dA(pA)34 to the SSB tetramer (20 mM NaCl at pH 8.1). For dT(pT)34 and dC(pC)34, we found large, negative values for DeltaH1,obs of -75 +/- 1 and -85 +/- 2 kcal/mol at 25 degrees C, with DeltaCp,obs values of -540 +/- 20 and -570 +/- 30 cal mol-1 K-1 (7-50 degrees C), respectively. However, for SSB-dA(pA)34 binding, DeltaH1,obs is considerably less negative (-14 +/- 1 kcal/mol at 25 degrees C), even becoming positive at temperatures below 13 degrees C, and DeltaCp,obs is nearly twice as large in magnitude (-1180 +/- 40 cal mol-1 K-1). These very different thermodynamic properties for SSB-dA(pA)34 binding appear to result from the fact that the bases in dA(pA)34 are more stacked at any temperature than are the bases in dC(pC)34 or dT(pT)34 and that the bases become unstacked within the SSB-ssDNA complexes. Therefore, the DeltaCp,obs for SSB-ssDNA binding has multiple contributions, a major one being the coupling to binding of a temperature-dependent conformational change in the ssDNA, although SSB binding to unstacked ssDNA still has an "intrinsic" negative DeltaCp,0. In general, such temperature-dependent changes in the conformational "end states" of interacting macromolecules can contribute significantly to both DeltaCp,obs and DeltaHobs. 相似文献
2.
Applications of isothermal titration calorimetry – the research and technical developments from 2011 to 2015
下载免费PDF全文
![点击此处可从《Journal of molecular recognition : JMR》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Robert J. Falconer 《Journal of molecular recognition : JMR》2016,29(10):504-515
Isothermal titration calorimetry is a widely used biophysical technique for studying the formation or dissociation of molecular complexes. Over the last 5 years, much work has been published on the interpretation of isothermal titration calorimetry (ITC) data for single binding and multiple binding sites. As over 80% of ITC papers are on macromolecules of biological origin, this interpretation is challenging. Some researchers have attempted to link the thermodynamics constants to events at the molecular level. This review highlights work carried out using binding sites characterized using x‐ray crystallography techniques that allow speculation about individual bond formation and the displacement of individual water molecules during ligand binding and link these events to the thermodynamic constants for binding. The review also considers research conducted with synthetic binding partners where specific binding events like anion‐π and π‐π interactions were studied. The revival of assays that enable both thermodynamic and kinetic information to be collected from ITC data is highlighted. Lastly, published criticism of ITC research from a physical chemistry perspective is appraised and practical advice provided for researchers unfamiliar with thermodynamics and its interpretation. Copyright © 2016 John Wiley & Sons, Ltd. 相似文献
3.
Freyer MW Buscaglia R Hollingsworth A Ramos J Blynn M Pratt R Wilson WD Lewis EA 《Biophysical journal》2007,92(7):2516-2522
Studies performed in our laboratory demonstrated the formation of two thermodynamically distinct complexes on binding of netropsin to a number of hairpin-forming DNA sequences containing AATT-binding regions. These two complexes were proposed to differ only by a bridging water molecule between the drug and the DNA in the lower affinity complex. A temperature-dependent isothermal titration calorimetry (ITC)-binding study was performed using one of these constructs (a 20-mer hairpin of sequence 5'-CGAATTCGTCTCCGAATTCG) and netropsin. This study demonstrated a break in the heat capacity change for the formation of the complex containing the bridging water molecule at approximately 303 K. In the plot of the binding enthalpy change versus temperature, the slope (DeltaCp) was -0.67 kcal mol-1 K-1 steeper after the break at 303 K. Because of the relatively low melting temperature of the 20-mer hairpin (341 K (68 degrees C)), the enthalpy change for complex formation might have included some energy of refolding of the partially denatured hairpin, giving the suggestion of a larger DeltaCp. Studies done on the binding of netropsin to similar constructs, a 24-mer and a 28-mer, with added GC basepairs in the hairpin stem to increase thermal stability, exhibit the same nonlinearity in DeltaCp over the temperature range of from 275 to 333 K. The slopes (DeltaCp) were -0.69 and -0.64 kcal mol-1 K-1 steeper after 303 K for the 24-mer and 28-mer, respectively. This observation strengthens the argument regarding the presence of a bridging water molecule in the lower affinity netropsin/DNA complex. The DeltaCp data seem to infer that because the break in the heat capacity change function for the lower affinity binding occurs at the isoequilibrium temperature for water, water may be included or trapped in the complex. The fact that this break does not occur in the heat capacity change function for formation of the higher affinity complex can similarly be taken as evidence that water is not included in the higher affinity complex. 相似文献
4.
Ayse Ozdemir Refiye Tekiner Gursaclı Turgay Tekinay 《Biological trace element research》2014,158(2):268-274
The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV–Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid–DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54?×?104 M?1. FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations. 相似文献
5.
Dean E. Wilcox Author Vitae 《Inorganica chimica acta》2008,361(4):857-867
Isothermal titration calorimetry (ITC) is a technique that is capable of quantifying the stoichiometry, equilibrium constants and thermodynamics of molecular binding events. Thus, important information about the interaction of metal ions with biological macromolecules can be obtained with ITC measurements. This review highlights many of the recent studies of metal ions binding to proteins that have used ITC to quantify the thermodynamics of metal-protein interactions. 相似文献
6.
Isothermal titration calorimetry (ITC) is widely employed to measure thermodynamic properties of binding interactions between two macromolecules or a macromolecule and a small ligand. No labeling of interacting species is required for ITC, but this advantage is offset by potentially material-consuming experimental optimization complicated by an indirect readout of an ITC titration. Here we present a simple, practical, and portable spreadsheet-based tool for planning and modeling an ITC titration experiment accompanied by basic guidelines. 相似文献
7.
Pérez-Hernández G García-Hernández E Zubillaga RA de Gómez-Puyou MT 《Archives of biochemistry and biophysics》2002,408(2):177-183
The energetics of binding of MgADP to the isolated beta subunit of F(1)-ATPase from thermophilic Bacillus (Tbeta) was characterized by high-precision isothermal titration calorimetry. The reaction was enthalpically driven, with a DeltaCp of -36cal(molK)(-1). To gain insight into the molecular basis of this small DeltaCp, we analyzed the changes in accessible surface areas (DeltaASA) between the structures of empty and MgADP-filled beta subunits, extracted from the crystal structure of bovine heart F(1). Consistent with the experimental DeltaCp, the DeltaASA was small (-775A(2)). We used a reported surface area model developed for protein reactions to calculate DeltaCp and DeltaH from DeltaASA, obtaining good agreement with the experimental values. Conversely, using the same model, a DeltaASA of -770A(2) was estimated from experimental DeltaCp and DeltaH for the Tbeta-MgADP complex. Our structural-energetic study indicates that on MgADP binding the isolated Tbeta subunit exhibits intrinsic structural changes similar to those observed in F(1). 相似文献
8.
Isothermal titration calorimetry (ITC) profiles of berenil bound to different DNAs show that, despite the strong preference of berenil for AT-rich regions in DNA, it can bind to other DNA sequences significantly. The ITC results were used to quantify the binding of berenil, and the thermodynamic profiles were obtained using natural DNAs as well as synthetic polynucleotides. ITC binding isotherms cannot be simply described when a single set of identical binding sites is considered, except for poly[d(A-T)2]. Ultraviolet melting of DNA and differential scanning calorimetry were also used to quantify several aspects of the binding of berenil to salmon testes DNA. We present evidence for secondary binding sites for berenil in DNA, corresponding to G+C rich sites. Berenil binding to poly[d(G-C)2] is also observed. Circular dichroism experiments showed that binding to GC-rich sites involves drug intercalation. Using a molecular modeling approach we demonstrate that intercalation of berenil into CpG steps is sterically feasible. 相似文献
9.
The interaction of biologicalmacromolecules, whether protein-DNA, antibody-antigen, hormone-receptor, etc., illustrates the complexity and diversity of molecular recognition. The importance of such interactions in the immune response, signal transduction cascades, and gene expression cannot be overstated. It is of great interest to determine the nature of the forces that stabilize the interaction. The thermodynamics of association are characterized by the stoichiometry of the interaction (n), the association constant (K(a)), the free energy (DeltaG(b)), enthalpy (DeltaH(b)), entropy (DeltaS(b)), and heat capacity of binding (DeltaC(p)). In combination with structural information, the energetics of binding can provide a complete dissection of the interaction and aid in identifying the most important regions of the interface and the energetic contributions. Various indirect methods (ELISA, RIA, surface plasmon resonance, etc.) are routinely used to characterize biologically important interactions. Here we describe the use of isothermal titration calorimetry (ITC) in the study of protein-protein interactions. ITC is the most quantitative means available for measuring the thermodynamic properties of a protein-protein interaction. ITC measures the binding equilibrium directly by determining the heat evolved on association of a ligand with its binding partner. In a single experiment, the values of the binding constant (K(a)), the stoichiometry (n), and the enthalpy of binding (DeltaH(b)) are determined. The free energy and entropy of binding are determined from the association constant. The temperature dependence of the DeltaH(b) parameter, measured by performing the titration at varying temperatures, describes the DeltaC(p) term. As a practical application of the method, we describe the use of ITC to study the interaction between cytochrome c and two monoclonal antibodies. 相似文献
10.
Michael R. Duff Jr. Jordan Grubbs Elizabeth E. Howell 《Journal of visualized experiments : JoVE》2011,(55)
Isothermal titration calorimetry (ITC) is a useful tool for understanding the complete thermodynamic picture of a binding reaction. In biological sciences, macromolecular interactions are essential in understanding the machinery of the cell. Experimental conditions, such as buffer and temperature, can be tailored to the particular binding system being studied. However, careful planning is needed since certain ligand and macromolecule concentration ranges are necessary to obtain useful data. Concentrations of the macromolecule and ligand need to be accurately determined for reliable results. Care also needs to be taken when preparing the samples as impurities can significantly affect the experiment. When ITC experiments, along with controls, are performed properly, useful binding information, such as the stoichiometry, affinity and enthalpy, are obtained. By running additional experiments under different buffer or temperature conditions, more detailed information can be obtained about the system. A protocol for the basic setup of an ITC experiment is given. 相似文献
11.
Cysteine biosynthesis in plants is partly regulated by the physical association of O-acetylserine sulfhydrylase (OASS) and serine acetyltransferase (SAT). Interaction of OASS and SAT requires only the 10 C-terminal residues of SAT. Here we analyze the thermodynamics of formation of a complex of Arabidopsis thaliana OASS (AtOASS) and the C-terminal ligand of AtSAT (C10 peptide) as a function of temperature and salt concentration using fluorescence spectroscopy and isothermal titration calorimetry (ITC). Our results suggest that the C-terminus of AtSAT provides the major contribution to the total binding energy in the plant cysteine synthase complex. The C10 peptide binds to the AtOASS homodimer in a 2:1 complex. Interaction between AtOASS and the C10 peptide is tight (Kd = 5-100 nM) over a range of temperatures (10-35 degrees C) and NaCl concentrations (0.02-1.3 M). AtOASS binding of the C10 peptide displays negative cooperativity at higher temperatures. ITC studies reveal compensating changes in the enthalpy and entropy of binding that also depend on temperature. The enthalpy of interaction has a significant temperature dependence (DeltaCp = -401 cal mol-1 K-1). The heat capacity change and salt dependence studies suggest that hydrophobic interactions drive formation of the AtOASS.C10 peptide complex. The potential regulatory effect of temperature on the plant cysteine synthase complex is discussed. 相似文献
12.
Pagano B Mattia CA Virno A Randazzo A Mayol L Giancola C 《Nucleosides, nucleotides & nucleic acids》2007,26(6-7):761-765
This work studies the binding properties of distamycin and its carbamoyl analog, containing four pyrrole units, with the [d(TGGGGT)](4) quadruplex by means of isothermal titration calorimetry (ITC). Analysis of the ITC data reveals that drug/quadruplex binding stoichiometry is 1:1 for both interactions and that distamycin analog gives approximately a 10-fold increase in the quadruplex affinity. 相似文献
13.
The third albumin binding domain of streptococcal protein G strain 148 (G148-GA3) belongs to a novel class of prokaryotic albumin binding modules that is thought to support virulence in several bacterial species. Here, we characterize G148-GA3 folding and albumin binding by using differential scanning calorimetry and isothermal titration calorimetry to obtain the most complete set of thermodynamic state functions for any member of this medically significant module. When buffered at pH 7.0 the 46-amino acid alpha-helical domain melts at 72 degrees C and exhibits marginal stability (15 kJ/mol) at 37 degrees C. G148-GA3 unfolding is characterized by small contributions to entropy from non-hydrophobic forces and a low DeltaCp (1.1 kJ/(deg mol)). Isothermal titration calorimetry reveals that the domain has evolved to optimally bind human serum albumin near 37 degrees C with a binding constant of 1.4 x 10 7 M(-1). Analysis of G148-GA3 thermodynamics suggests that the domain experiences atypically small per residue changes in structural dynamics and heat capacity while transiting between folded and unfolded states. 相似文献
14.
Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies. 相似文献
15.
A continuous isothermal titration calorimetry (cITC) method for microcalorimeters has been developed. The method is based on continuous slow injection of a titrant into the calorimetric vessel. The experimental time for a cITC binding experiment is 12-20 min and the number of data points obtained is on the order of 1000. This gives an advantage over classical isothermal titration calorimetry (ITC) binding experiments that need 60-180 min to generate 20-30 data points. The method was validated using two types of calorimeters, which differ in calorimetric principle, geometry, stirring, and way of delivering the titrant into the calorimetric vessel. Two different experimental systems were used to validate the method: the binding of Ba(2+) to 18-crown-6 and the binding of cytidine 2'-monophosphate to RNAse A. Both systems are used as standard test systems for titration calorimetry. Computer simulations show that the dynamic range for determination of equilibrium constants can be increased by three orders of magnitude compared to that of classical ITC, making it possible to determine high affinities. Simulations also show an improved possibility to elucidate the actual binding model from cITC data. The simulated data demonstrate that cITC makes it easier to discriminate between different thermodynamic binding models due to the higher density of data points obtained from one experiment. 相似文献
16.
Lewis EA Munde M Wang S Rettig M Le V Machha V Wilson WD 《Nucleic acids research》2011,39(22):9649-9658
Structural results with minor groove binding agents, such as netropsin, have provided detailed, atomic level views of DNA molecular recognition. Solution studies, however, indicate that there is complexity in the binding of minor groove agents to a single site. Netropsin, for example, has two DNA binding enthalpies in isothermal titration calorimetry (ITC) experiments that indicate the compound simultaneously forms two thermodynamically different complexes at a single AATT site. Two proposals for the origin of this unusual observation have been developed: (i) two different bound species of netropsin at single binding sites and (ii) a netropsin induced DNA hairpin to duplex transition. To develop a better understanding of DNA recognition complexity, the two proposals have been tested with several DNAs and the methods of mass spectrometry (MS), polyacrylamide gel electrophoresis (PAGE) and nuclear magnetic resonance spectroscopy in addition to ITC. All of the methods with all of the DNAs investigated clearly shows that netropsin forms two different complexes at AATT sites, and that the proposal for an induced hairpin to duplex transition in this system is incorrect. 相似文献
17.
Isothermal titration calorimetry (ITC) is one of the most robust label- and immobilization-free techniques used to measure protein – small molecule interactions in drug design for the simultaneous determination of the binding affinity (ΔG) and the enthalpy (ΔH), both of which are important parameters for structure-thermodynamics correlations. It is important to evaluate the precision of the method and of various ITC instrument models by performing a single well-characterized reaction. The binding between carbonic anhydrase II and acetazolamide was measured by four ITC instruments – PEAQ-ITC, iTC200, VP-ITC, and MCS-ITC and the standard deviation of ΔG and ΔH was determined. Furthermore, the limit of an approach to reduce the protein concentration was studied for a high-affinity reaction (Kd = 0.3 nM), too tight to be measured by direct (non-displacement) ITC. Chemical validation of the enthalpy measurements is discussed. 相似文献
18.
The two Ni2+ ions in the urease active site are delivered by the metallochaperone UreE, whose metal binding properties are central to the assembly of this metallocenter. Isothermal titration calorimetry (ITC) has been used to quantify the stoichiometry, affinity, and thermodynamics of Ni2+, Cu2+, and Zn2+ binding to the well-studied C-terminal truncated H144*UreE from Klebsiella aerogenes, Ni2+ binding to the wild-type K. aerogenes UreE protein, and Ni2+ and Zn2+ binding to the wild-type UreE protein from Bacillus pasteurii. The stoichiometries and affinities obtained by ITC are in good agreement with previous equilibrium dialysis results, after differences in pH and buffer competition are considered, but the concentration of H144*UreE was found to have a significant effect on metal binding stoichiometry. While two metal ions bind to the H144*UreE dimer at concentrations <10 microM, three Ni2+ or Cu2+ ions bind to 25 microM dimeric protein with ITC data indicating sequential formation of Ni/Cu(H144*UreE)4 and then (Ni/Cu)2(H144*UreE)4, or Ni/Cu(H144*UreE)2, followed by the binding of four additional metal ions per tetramer, or two per dimer. The thermodynamics indicate that the latter two metal ions bind at sites corresponding to the two binding sites observed at lower protein concentrations. Ni2+ binding to UreE from K. aerogenes is an enthalpically favored process but an entropically driven process for the B. pasteurii protein, indicating chemically different Ni2+ coordination to the two proteins. A relatively small negative value of DeltaCp is associated with Ni2+ and Cu2+ binding to H144*UreE at low protein concentrations, consistent with binding to surface sites and small changes in the protein structure. 相似文献
19.
PDZ10 is the 10th of 13 PDZ domains found within MUPP1, a cytoplasmic scaffolding protein first identified as an endogenous binding partner of serotonin receptor type 2c (5HT2c). This association, as with those of several other interacting proteins that have subsequently been identified, is mediated through the C-terminal tail of the PDZ domain partner. Using isothermal titration calorimetry (ITC), we measured the thermodynamic binding parameters [changes in Gibbs free energy (DeltaG), enthalpy (DeltaH) and entropy (TDeltaS)] of the isolated PDZ10 domain for variable-length N-acetylated peptides from the 5HT2c serotonin receptor C-terminal sequence, as well as for octapeptides of eight other putative partner proteins of PDZ10 (5HT2a, hc-kit, hTapp1, mTapp2, TARP, NG2, claudin-1, and HPV-18 E6). In length dependence studies of the 5HT2c sequence, the maximal affinity of the peptides leveled off rapidly and further elongation did not significantly improve the dissociation constant (Kd) of 11 microM observed with the pentapeptide. Among the native partners of PDZ10, octapeptides derived from the hc-kit and 5HT2c proteins were the strongest binders, with Kd values of 5.2 and 8.5 microM, respectively. The heat capacity change (DeltaCp) for the 5HT2c octapeptide was determined to be -94 cal/mol, and a calculated estimate indicates burial of polar and apolar surface areas in equal measure upon ligand binding. Peptides with phosphoserine at either the P-1 or P-2 position experienced decreased affinity, which is in accord with the hypothesis that reversible phosphorylation is a possible mechanism for regulating PDZ domain-mediated interactions. Additionally, two conformationally constrained side chain-bridged cyclic peptide ligands were also designed, prepared, evaluated by ITC, and shown to bind PDZ10 primarily through a favorable change in entropy. 相似文献
20.
Isothermal titration calorimetry (ITC) is an important technique used in quantitatively analyzing the global mechanism of protein-protein or protein-ligand interactions through thermodynamic measurements. Among different binding mechanisms, the parallel and ligand induced protein oligomerization mechanisms are technically difficult to analyze compared with a sequential binding mechanism. Here, we present a methodology implemented as a program "Open-ITC" that eliminates the need for exact analytical expressions for free ligand concentrations [L] and mole fractions of bound ligand θ that are required for the thermogram analysis. Adopting a genetic algorithm-based optimization, the thermodynamic parameters are determined, and its standard error is evaluated at the global minimum by calculating the Jacobian matrix. This approach yielded a statistically consistent result for a single-site and a two-site binding protein-ligand system. Further, a comparative simulation of a two-step sequential, a parallel, and a ligand induced oligomerization model revealed that their mechanistic differences are discernable in ITC thermograms, only if the first binding step is weaker compared with the second binding step (K(1) 相似文献