The complete nucleotide sequence of the group II RNA coliphage GA

The complete nucleotide sequence of the RNA coliphage GA, a group II phage, is presented. The entire genome comprises 3466 bases. Three large open reading frames were identified, which correspond to the maturation protein gene (390 amino acids), the coat protein gene (129 amino acids) and the replicase beta-subunit protein gene (531 amino acids). In addition, untranslated regions occur at the 5' (135 bases) and 3' (122 bases) ends of the molecule. Two intercistronic untranslated regions occur between the cistrons for the maturation and coat proteins, and between the coat and beta-subunit proteins. We have compared the nucleotide sequence of GA RNA with the published sequence of MS2 RNA, and show that they are related. The comparative structures of two important regulatory regions are presented; the coat protein binding site which is involved in translational repression of the replicase beta-subunit protein gene, and a hairpin in a region proximal to the lysis protein gene.     

RNA binding properties of the coat protein from bacteriophage GA.

The coat protein of bacteriophage GA, a group II RNA phage, binds to a small RNA hairpin corresponding to its replicase operator. Binding is specific, with a Ka of 71 microM -1. This interaction differs kinetically from the analogous coat protein-RNA hairpin interactions of other RNA phage and also deviates somewhat in its pH and salt dependence. Despite 46 of 129 amino acid differences between the GA and group I phage R17 coat proteins, the binding sites are fairly similar. The essential features of the GA coat protein binding site are a based-paired stem with an unpaired purine and a four nucleotide loop having an A at position -4 and a purine at -7. Unlike the group I phage proteins, the GA coat protein does not distinguish between two alternate positions for the unpaired purine and does not show high specificity for a pyrimidine at position -5 of the loop.     

Crystal structure of the coat protein from the GA bacteriophage: model of the unassembled dimer.

There are four groups of RNA bacteriophages with distinct antigenic and physicochemical properties due to differences in surface residues of the viral coat proteins. Coat proteins also play a role as translational repressor during the viral life cycle, binding an RNA hairpin within the genome. In this study, the first crystal structure of the coat protein from a Group II phage GA is reported and compared to the Group I MS2 coat protein. The structure of the GA dimer was determined at 2.8 A resolution (R-factor = 0.20). The overall folding pattern of the coat protein is similar to the Group I MS2 coat protein in the intact virus (Golmohammadi R, Valegård K, Fridborg K, Liljas L. 1993, J Mol Biol 234:620-639) or as an unassembled dimer (Ni Cz, Syed R, Kodandapani R. Wickersham J, Peabody DS, Ely KR, 1995, Structure 3:255-263). The structures differ in the FG loops and in the first turn of the alpha A helix. GA and MS2 coat proteins differ in sequence at 49 of 129 amino acid residues. Sequence differences that contribute to distinct immunological and physical properties of the proteins are found at the surface of the intact virus in the AB and FG loops. There are six differences in potential RNA contact residues within the RNA-binding site located in an antiparallel beta-sheet across the dimer interface. Three differences involve residues in the center of this concave site: Lys/Arg 83, Ser/Asn 87, and Asp/Glu 89. Residue 87 was shown by molecular genetics to define RNA-binding specificity by GA or MS2 coat protein (Lim F. Spingola M, Peabody DS, 1994, J Biol Chem 269:9006-9010). This sequence difference reflects recognition of the nucleotide at position -5 in the unpaired loop of the translational operators bound by these coat proteins. In GA, the nucleotide at this position is a purine whereas in MS2, it is a pyrimidine.     

Synthesis and functional activity of translation initiation regions in mRNA. 20-base polyribonucleotides from the replicase gene of phage MS2 and fr

Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.     

The RNA binding site of bacteriophage MS2 coat protein.

The coat protein of the RNA bacteriophage MS2 binds a specific stem-loop structure in viral RNA to accomplish encapsidation of the genome and translational repression of replicase synthesis. In order to identify the structural components of coat protein required for its RNA binding function, a series of repressor-defective mutants has been isolated. To ensure that the repressor defects were due to substitution of binding site residues, the mutant coat proteins were screened for retention of the ability to form virus-like particles. Since virus assembly presumably requires native structure, this approach eliminated mutants whose repressor defects were secondary consequences of protein folding or stability defects. Each of the variant coat proteins was purified and its ability to bind operator RNA in vitro was measured. DNA sequence analysis identified the nucleotide and amino acid substitutions responsible for reduced RNA binding affinity. Localization of the substituted sites in the three-dimensional structure of coat protein reveals that amino acid residues on three adjacent strands of the coat protein beta-sheet are required for translational repression and RNA binding. The sidechains of the affected residues form a contiguous patch on the interior surface of the viral coat.     

Analysis of the complete nucleotide sequence of the group IV RNA coliphage SP.

We report the nucleotide sequence of the Group IV RNA bacteriophage SP. The entire sequence is 4276 nucleotides long. Four cistrons have been identified by comparison with the related Group III phage Q beta. The maturation protein contains 449 amino acids, the coat protein contains 131 amino acids, the read-through protein contains 330 amino acids and the replicase beta-subunit contains 575 amino acids. SP is 59 nucleotides longer than Q beta. We have analyzed both sequence and structural conservation between SP and Q beta and shown that the sequences for the coat and central region of the replicase are strongly conserved between the two genomes. We also show that the S and M replicase binding sites of Q beta are strongly conserved in SP. Interestingly, the base composition of SP and Q beta differ significantly from one another, and most of the differences can be accounted for by a strong preponderance of U in the third position of each codon of Q beta relative to SP. We also compare conserved hairpins associated with potential coat protein and replicase binding sites.     

The primary structure of the coat protein of the broad-host-range RNA bacteriophage PRR1.

The complete amino acid sequence of the coat protein of RNA bacteriophage PRR1 is presented. After thermolysin digestion, 26 peptides were isolated, covering the complete coat protein chain. Their alignment was established in part using automated Edman degradation on the intact protein, in part with overlapping peptides obtained by enzymic hydrolysis with trypsin, pepsin, subtilisin and Staphylococcus aureus protease, and by chemical cleavage with cyanogen bromide and N-bromosuccinimide. To obtain the final overlaps, a highly hydrophobic, insoluble tryptic peptide was sequenced for seven steps by the currently used manual dansyl-Edman degradation procedure, which was slightly modified for application on insoluble peptides. PRR1 coat protein contains 131 amino acids, corresponding to a molecular weight of 14534. It is highly hydrophobic, and the residues with ionizable side chains are distributed unevenly: acidic residues are absent in the middle third of the sequence, whereas a clustering of basic residues occurs between positions 44 and 62. PRR1 coat protein was compared with the coat proteins of RNA coliphages MS2 and Q beta, and the minimum mutation distance was calculated for both comparisons. It is highly probable that PRR1. Q beta and MS2 share a common ancestor. The basic region present in the three coat proteins is recognized as an essential structural feature of RNA phage coat proteins.     

The ratio of coat protein to bacteriophage f2 RNA in the translational repressor complex]

One of the mechanisms underlying the regulation of the bacteriophage f2 RNA translation is the repression of the phage RNA-replicase formation by coat protein. This repression is due to the formation of a complex between f2 RNA and coat protein (complex I). In this work the mechanism of complex I formation as well as the effect of this complex on the f2 RNA-replicase formation was followed by inhibition of alanine incorporation into RNA-replicase polypeptide which was separated by polyacrylamide gel electrophoresis. The molar ratios of protein to f2 RNA in complex I were analyzed by sucrose gradient sedimentation. It was been found that complex I consists of six molecules of coat protein bound per one molecule of RNA. Ribonuclease digestion of the glutaraldehyde-fixed complex resulted in a mixture of products in which the hexamers of coat protein molecules were predominant. This indicates that the six molecules of coat protein bound to f2 RNA are neighbouring. It has been also shown that under conditions required for phage protein synthesis, coat protein occurs in solution is dimer. The results show that the translational repression of the RNA-replicase cistron is due to the cooperative attachment of three dimers of coat protein to phage template, forming a hexameric cluster on the RNA strand. The proposed mechanism of the complex I formation seems to be in good agreement with the sequence of events in the phage F2 life cycle. It is known that shortly after infection of the host cell the coat protein and phage RNA-replicase begin to be synthesised. According to our findings, the first portions of coat protein do not affect the translation of the RNA-replicase gene since at low concentration the coat protein occure in the form of monomers. At a later period of phage development, when the concentration of coat protein is sufficiently high to promote the formation of protein dimers, the translational repressor complex is formed and the RNA-replicase gene becomes inoperative.     

Defective lysis of streptomycin-resistant escherichia coli cells infected with bacteriophage f2

A lysis defect was found to account for the failure of a streptomycin-resistant strain of Escherichia coli to form plaques when infected with the male-specific bacteriophage f2. The lysis defect was associated with the mutation to streptomycin resistance. Large amounts of apparently normal bacteriophage accumulated in these cells. Cell-free extracts from both the parental and mutant strains synthesized a potential lysis protein in considerable amounts in response to formaldehyde-treated f2 RNA but not in response to untreated RNA. As predicted from the nucleotide sequence of the analogous MS2 phage, the protein synthesized in vitro had the expected molecular weight and lacked glycine. The cistron for the lysis protein overlapped portions of the coat and replicase cistrons and was translated in the +1 reading frame. Initiation at the lysis protein cistron may be favored by translation errors that expose the normally masked initiation site, and streptomycin-resistant ribosomes, known to have more faithful translation properties, may be unable to efficiently synthesize the lysis protein.     

Exchange of the basic domain of human immunodeficiency virus type 1 Rev for a polyarginine stretch expands the RNA binding specificity, and a minimal arginine cluster is required for optimal RRE RNA binding affinity, nuclear accumulation, and trans-activation

The Rev regulatory protein of human immunodeficiency virus (HIV) facilitates the nuclear export of unspliced and partially spliced HIV RNAs. Using a Rev:MS2 phage coat protein fusion that could be targeted to bind and activate the Rev-responsive element (RRE) RNA or heterologous MS2 phage operator RNA, we analyzed the role(s) of the arginine-rich RNA binding domain in RNA binding and transactivation. The arginine-rich domain could be functionally replaced by a stretch of nine arginines. However, polyarginine substitutions expanded the RNA binding specificity of the resultant mutant Rev protein. Polyarginine insertions in place of residues 24 to 60 that excised the RNA binding and oligomerization domains of Rev preserved the activation for MS2 RNA, but not for the RRE. A nine-arginine insertion outside of the natural context of the Rev nuclear localization signal domain was incompatible with activation of either RNA target. Insertions of fewer than eight arginines impaired RRE activation. Interrupted lysine clusters and disruption of the arginine stretch with lysine or neutral residues resulted in a similar phenotype. Some of these mutants with a null phenotype for RRE activated the heterologous MS2 RNA target. Under steady-state conditions, mutants that preserved the Rev response for RRE RNA localized to the nuclei; those with poor or no Rev response accumulated mostly in the cytoplasm. Many of the cytoplasmically resident derivatives became nuclear when leptomycin B (LMB) treatment inhibited nuclear export of nuclear export signal-containing proteins. Mutants that had a null activation potential for either RNA target were particularly resistant to LMB treatment. Abbreviated nuclear residence times and differences in RRE binding affinity may have compromised their activation potential for RRE. High-affinity binding to MS2 RNA through the intact coat protein was sufficient to overcome the short nuclear residence times and to facilitate MS2 activation by some derivatives.     

Bacteriophages of l-Glutamic Acid-Producing Bacteria

Several new phages were obtained from the abnormally fermented broths and from the air in l-glutamic acid fermentation factory using Br. lactofermentum. These twenty-one phages were classified into five serological groups on the basis of cross-neutralization tests with homologous and heterologous antisera. Group I contained ten phages, i.e., P61, P114, P401, P465, P468I, P508, P650, P204, Ap615 and L2. Group II contained five phages, i.e., P468II, Ap85II, Ap62, Ap72 and SI. Group III contained P468III, Ap85III, Ap93 and Ap518, and groups IV and V one phage each, P4 and L1, respectively.

In view of serological similarities and of differences in the host specificity, the phages of group I are considered as host range mutants derived from a plaque type mutant, P114, of original phage P61.     

The lysis function of RNA bacteriophage Qbeta is mediated by the maturation (A2) protein

Complete or partial cDNA sequences of the RNA bacteriophage Qbeta were cloned in plasmids under the control of the lambdaP(L) promoter to allow regulated expression in Escherichia coli harbouring the gene for the temperature-sensitive lambdaCI857 repressor. Induction of the complete Qbeta sequence leads to a 100-fold increase in phage production, accompanied by cell lysis. Induction of the 5'-terminal sequence containing the intact maturation protein (A2) cistron also causes cell lysis. Alterations of the A2 cistron, leading to proteins either devoid of approximately 20% of the C-terminal region or of six internal amino acids, abolish the lysis function. Expression of other cistrons in addition to the A2 cistron does not enhance host lysis. Thus, in Qbeta, the A2 protein, in addition to its functions as maturation protein, appears to trigger cell lysis. This contrasts with the situation in the distantly related group I RNA phages such as f2 and MS2 where a small lysis polypeptide is coded for by a region overlapping the end of the coat gene and the beginning of the replicase gene.     

Mutual influence of the secondary structure and information content of a messenger RNA

The presence of secondary structure in a messenger RNA suggests that natural selection has moulded the nucleotide sequence to meet the demands of base-pairing as well as those of the encoded amino acid sequence. Despite the degeneracy of the genetic code, neither requirement can be fulfilled independently of the other, so the evolved RNA and protein structures must represent a compromise. One feature of this compromise is illustrated by the structure of the coat protein gene of bacteriophage MS2. Those amino acid residues which, when represented by base-paired codons, impose the most severe limitations on the overall protein sequence, show a clear tendency to avoid being encoded in base-paired regions of the messenger RNA.     

Specificity of Formation of Complexes Between Coat Protein and Bacteriophage f2 RNA

The specificity of formation of phage f2 RNA-protein complexes was studied. Complex I contains up to 8 mol of coat protein per 1 mol of RNA. Its formation proceeds equally well in medium (i) without magnesium ions, (ii) containing magnesium ions, (iii) containing 4 mM EDTA, and (iv) at temperatures from 0 to 45 C. Complex II contains up to 200 mol of coat protein per 1 mol of RNA. Its formation is inhibited by the presence of magnesium ions in medium. Formaldehyde- or methoxyamine-treated f2 RNA in which only exposed bases were modified showed a normal pattern of complex II formation, whereas formation of complex I was inhibited or abolished. We conclude that complex I formation involves the interaction between coat protein and specific region of exposed bases in RNA. A possible site of attachment of coat protein is discussed.     

Escherichia coli traD(Ts) mutant temperature sensitive for assembly of RNA bacteriophage MS2.

We report here a study on the temperature-sensitive conjugational transfer-deficient mutant Escherichia coli JCFL39, carrying a traD(Ts) mutation, which is also temperature sensitive for group I RNA phages (MS2, f2, and R17). It is shown that, when the mutant was infected with MS2 at 42 degrees C, phage RNA replicated; a 27S MS2 RNA and phage proteins were synthesized. However, neither PFU nor physical MS2 particles were formed, showing that phage assembly was inhibited. In addition, the high temperature affected the membranes of the host mutant: the mutant was hypersensitive to chemicals, and the electrophoretic pattern of the membranal proteins was modified. We suggest that the pleiotropic effects of the traD mutation on MS2 assembly and DNA transfer during conjugation were a result of the changes in the membrane of the mutant.     

Secondary structure of the central region of bacteriophage MS2 RNA. Conservation and biological significance

The RNA of the Escherichia coli RNA phages is highly structured with 75% of the nucleotides estimated to take part in base-pairing. We have used enzymatic and chemical sensitivity of nucleotides, phylogenetic sequence comparison and the phenotypes of constructed mutants to develop a secondary structure model for the central region (900 nucleotides) of the group I phage MS2. The RNA folds into a number of, mostly irregular, helices and is further condensed by several long-distance interactions. There is substantial conservation of helices between the related groups I and II, attesting to the relevance of discrete RNA folding. In general, the secondary structure is thought to be needed to prevent annealing of plus and minus strand and to confer protection against RNase. Superimposed, however, are features required to regulate translation and replication. The MS2 RNA section studied here contains three translational start sites, as well as the binding sites for the coat protein and the replicase enzyme. Considering the density of helices along the RNA, it is not unexpected to find that all these sites lie in helical regions. This fact, however, does not mean that these sites are recognized as secondary structure elements by their interaction partners. This holds true only for the coat protein binding site. The other four sites function in the unfolded state and the stability of the helix in which they are contained serves to negatively control their accessibility. Mutations that stabilize helices containing ribosomal binding sites reduce their efficiency and vice versa. Comparison of homologous helices in different phage RNAs indicates that base substitutions have occurred in such a way that the thermodynamic stability of the helix is maintained. The evolution of individual helices shows several distinct size-reduction patterns. We have observed codon deletions from loop areas and shortening of hairpins by base-pair deletions from either the bottom, the middle or the top of stem structures. Evidence for the coaxial stacking of some helical segments is discussed.     

Rearrangements in the 5′ Nontranslated Region and Phylogenetic Analyses of Cucumber Mosaic Virus RNA 3 Indicate Radial Evolution of Three Subgroups

Cucumber mosaic virus (CMV) has been divided into two subgroups based on serological data, peptide mapping of the coat protein, nucleic acid hybridization, and nucleotide sequence similarity. Analyses of a number of recently isolated strains suggest a further division of the subgroup I strains. Alignment of the 5' nontranslated regions of RNA 3 for 26 strains of CMV suggests the division of CMV into subgroups IA, IB, and II and suggests that rearrangements, deletions, and insertions in this region may have been the precursors of the subsequent radiation of each subgroup. Phylogeny analyses of CMV using the coat protein open reading frame of 53 strains strongly support the further division of subgroup I into IA and IB. In addition, strains within each subgroup radiate from a single point of origin, indicating that they have evolved from a single common ancestor for each subgroup.     

Control of translational repression by protein-protein interactions.

The coat protein of the RNA bacteriophage MS2 is a translational repressor and interacts with a specific RNA stem-loop to inhibit translation of the viral replicase gene. As part of an effort to dissect genetically its RNA binding function, mutations were identified in the coat protein sequence that suppress mutational defects in the translational operator. Each of the mutants displayed a super-repressor phenotype, repressing translation from the wild-type and a variety of mutant operators better than did the wild-type coat protein. At least one mutant probably binds RNA more tightly than wild-type. The other mutants, however, were defective for assembly of virus-like particles, and self-associated predominantly as dimers. It is proposed that this assembly defect accounts for their super-repressor characteristics, since failure to assemble into virus-like particles elevates the effective concentration of repressor dimers. This hypothesis is supported by the observation that deletion of thirteen amino acids known to be important for assembly of dimers into capsids also resulted in the same assembly defect and in super-repressor activity. A second class of assembly defects is also described. Deletion of two amino acids from the C-terminus of coat protein resulted in failure to form capsids, most of the coat protein having the apparent molecular weight expected of trimers. This mutant (dl-8) was completely defective for repressor activity, probably because of an inability to form dimers. These results point out the inter-dependence of the structural and regulatory functions of coat protein.