Interaction of poly(rC)-binding protein 2 domains KH1 and KH3 with coxsackievirus RNA

Recombinant hnRNP K-homology (KH) domains 1 and 3 of the poly(rC)-binding protein (PCBP) 2 were purified and assayed for interaction with coxsackievirus B3 RNA in electrophoretic mobility shift assays using in vitro transcribed RNAs which represent signal structures of the 5′-nontranslated region. KH domains 1 and 3 interact with the extended cloverleaf RNA and domain IV RNA of the internal ribosome entry site (IRES). KH1 but not KH3 interacts with subdomain IV/C RNA, whereas KH3 interacts with subdomain IV/B. All in vitro results are consistent with yeast three-hybrid experiments performed in parallel. The data demonstrate interaction of isolated PCBP2 KH1 and KH3 domains to four distinct target sites within the 5′-nontranslated region of the CVB3 genomic RNA.     

Distinct poly(rC) binding protein KH domain determinants for poliovirus translation initiation and viral RNA replication

The limited coding capacity of picornavirus genomic RNAs necessitates utilization of host cell factors in the completion of an infectious cycle. One host protein that plays a role in both translation initiation and viral RNA synthesis is poly(rC) binding protein 2 (PCBP2). For picornavirus RNAs containing type I internal ribosome entry site (IRES) elements, PCBP2 binds the major stem-loop structure (stem-loop IV) in the IRES and is essential for translation initiation. Additionally, the binding of PCBP2 to the 5'-terminal stem-loop structure (stem-loop I or cloverleaf) in concert with viral protein 3CD is required for initiation of RNA synthesis directed by poliovirus replication complexes. PCBP1, a highly homologous isoform of PCBP2, binds to poliovirus stem-loop I with an affinity similar to that of PCBP2; however, PCBP1 has reduced affinity for stem-loop IV. Using a dicistronic poliovirus RNA, we were able to functionally uncouple translation and RNA replication in PCBP-depleted extracts. Our results demonstrate that PCBP1 rescues RNA replication but is not able to rescue translation initiation. We have also generated mutated versions of PCBP2 containing site-directed lesions in each of the three RNA-binding domains. Specific defects in RNA binding to either stem-loop I and/or stem-loop IV suggest that these domains may have differential functions in translation and RNA replication. These predictions were confirmed in functional assays that allow separation of RNA replication activities from translation. Our data have implications for differential picornavirus template utilization during viral translation and RNA replication and suggest that specific PCBP2 domains may have distinct roles in these activities.     

The RNA binding domains of the nuclear poly(A)-binding protein

The nuclear poly(A)-binding protein (PABPN1) is involved in the synthesis of the mRNA poly(A) tails in most eukaryotes. We report that the protein contains two RNA binding domains, a ribonucleoprotein-type RNA binding domain (RNP domain) located approximately in the middle of the protein sequence and an arginine-rich C-terminal domain. The C-terminal domain also promotes self-association of PABPN1 and moderately cooperative binding to RNA. Whereas the isolated RNP domain binds specifically to poly(A), the isolated C-terminal domain binds non-specifically to RNA and other polyanions. Despite this nonspecific RNA binding by the C-terminal domain, selection experiments show that adenosine residues throughout the entire minimal binding site of approximately 11 nucleotides are recognized specifically. UV-induced cross-links with oligo(A) carrying photoactivatable nucleotides at different positions all map to the RNP domain, suggesting that most or all of the base-specific contacts are made by the RNP domain, whereas the C-terminal domain may contribute nonspecific contacts, conceivably to the same nucleotides. Asymmetric dimethylation of 13 arginine residues in the C-terminal domain has no detectable influence on the interaction of the protein with RNA. The N-terminal domain of PABPN1 is not required for RNA binding but is essential for the stimulation of poly(A) polymerase.     

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.     

A single domain of yeast poly(A)-binding protein is necessary and sufficient for RNA binding and cell viability.

The poly(A)-binding protein (PAB) gene of Saccharomyces cerevisiae is essential for cell growth. A 66-amino acid polypeptide containing half of a repeated N-terminal domain can replace the entire protein in vivo. Neither an octapeptide sequence conserved among eucaryotic RNA-binding proteins nor the C-terminal domain of PAB is required for function in vivo. A single N-terminal domain is nearly identical to the entire protein in the number of high-affinity sites for poly(A) binding in vitro (one site with an association constant of approximately 2 X 10(7) M-1) and in the size of the binding site (12 A residues). Multiple N-terminal domains afford a mechanism of PAB transfer between poly(A) strands.     

Localized Bicaudal-C RNA encodes a protein containing a KH domain, the RNA binding motif of FMR1.

The Bicaudal-C (Bic-C) gene of Drosophila melanogaster is required for correct targeting of the migrating anterior follicle cells and for specifying anterior position. Females lacking any wild type copies of Bic-C produce only eggshells open at the anterior end, because of the failure of the columnar follicle cells to migrate in the correct position at the nurse cell--oocyte boundary. Embryos which develop from eggs produced in females with only one wild type copy of Bic-C show defects in anterior patterning and an abnormal persistence of oskar RNA in anterior regions. We cloned Bic-C and found that, in ovaries, Bic-C RNA is expressed only in germline cells. Bic-C RNA is localized to the oocyte in early oogenesis, and later concentrates at its anterior cortex. The Bic-C protein includes five KH domains similar to those found in the human fragile-X protein FMR1. Alteration of a highly conserved KH domain codon by mutation abrogates in vivo Bic-C function. These results suggest roles for the Bic-C protein in localizing RNAs and in intercellular signaling.     

Crystal structure of the middle domain of human poly(A)-binding protein-interacting protein 1

In eukaryotes, the poly(A)-binding protein (PABP) is one of the important factors for initiation of messenger RNA translation. PABP activity is regulated by the PABP-interacting proteins (Paips), which include Paip1, Paip2A, and Paip2B. Human Paip1 has three different isoforms. Here, we report the crystal structure of the middle domain of Paip1 isoform 2 (Paip1M) as determined by single-wavelength anomalous dispersion phasing. The structure reveals a crescent-shaped domain consisting of 10 α-helices and two antiparallel β-strands forming a β-hairpin. The 10 α-helices are arranged as five HEAT repeats which form a double layer of α helices with a convex and a concave surface. Despite low sequence identity, the overall fold of Paip1M is similar to the middle domain of human eIF4GII and yeast eIF4GI. Moreover, the amino-acid sequence motif and the local structure of eIF4G involved in binding of eIF4A, are conserved in Paip1. The structure reported here is the first of a member of the Paip family, thereby filling a gap in our understanding of initiation of eukaryotic mRNA translation in three dimensions.     

Crystal structure of the middle domain of human poly(A)-binding protein-interacting protein 1

This communication describes SAXS data based global structures of tetravalent antibody CD4–IgG2 and its dimeric to pentameric complexes with gp120s. Comparison of models brought forth that while the two CD4s grafted on each arm remain tightly packed in the unliganded antibody, they enable binding of first two gp120s preferentially to the same Fab arm in an asymmetric manner. Retention of residues in the CD4–Fab linker earlier reasoned to enable bi-fold collapse of gp120-bound soluble CD4, and observed asymmetry of the (CD4–IgG2)/(gp120)₂ complex suggest that encoded flexibility in CD4–Fab linker is a critical structure–function factor for this broad spectrum neutralizing antibody.     

Structure of a construct of a human poly(C)-binding protein containing the first and second KH domains reveals insights into its regulatory mechanisms

Poly(C)-binding proteins (PCBPs) are important regulatory proteins that contain three KH (hnRNP K homology) domains. Binding poly(C) D/RNA sequences via KH domains is essential for multiple PCBP functions. To reveal the basis for PCBP-D/RNA interactions and function, we determined the structure of a construct containing the first two domains (KH1-KH2) of human PCBP2 by NMR. KH1 and KH2 form an intramolecular pseudodimer. The large hydrophobic dimerization surface of each KH domain is on the side opposite the D/RNA binding interface. Chemical shift mapping indicates both domains bind poly(C) DNA motifs without disrupting the KH1-KH2 interaction. Spectral comparison of KH1-KH2, KH3, and full-length PCBP2 constructs suggests that the KH1-KH2 pseudodimer forms, but KH3 does not interact with other parts of the protein. From NMR studies and modeling, we propose possible modes of cooperative binding tandem poly(C) motifs by the KH domains. D/RNA binding may induce pseudodimer dissociation or stabilize dissociated KH1 and KH2, making protein interaction surfaces available to PCBP-binding partners. This conformational change may represent a regulatory mechanism linking D/RNA binding to PCBP functions.     

Specific recognition of the C-rich strand of human telomeric DNA and the RNA template of human telomerase by the first KH domain of human poly(C)-binding protein-2

Poly(C)-binding proteins (PCBPs) constitute a family of nucleic acid-binding proteins that play important roles in a wide spectrum of regulatory mechanisms. The diverse functions of PCBPs are dependent on the ability of the PCBPs to recognize poly(C) sequences with high affinity and specificity. PCBPs contain three copies of KH (hnRNP K homology) domains, which are responsible for binding nucleic acids. We have determined the NMR structure of the first KH domain (KH1) from PCBP2. The PCBP2 KH1 domain adopts a structure with three alpha-helices packed against one side of a three-stranded antiparallel beta-sheet. Specific binding of PCBP2 KH1 to a number of poly(C) RNA and DNA sequences, including the C-rich strand of the human telomeric DNA repeat, the RNA template region of human telomerase, and regulatory recognition motifs in the poliovirus-1 5'-untranslated region, was established by monitoring chemical shift changes in protein (15)N-HSQC spectra. The nucleic acid binding groove was further mapped by chemical shift perturbation upon binding to a six-nucleotide human telomeric DNA. The binding groove is an alpha/beta platform formed by the juxtaposition of two alpha-helices, one beta-strand, and two flanking loops. Whereas there is a groove in common with all of the DNA and RNA binders with a hydrophobic floor accommodating a three-residue stretch of C residues, nuances in recognizing flanking residues are provided by hydrogen bonding partners in the KH domain. Specific interactions of PCBP2 KH1 with telomeric DNA and telomerase RNA suggest that PCBPs may participate in mechanisms involved in the regulation of telomere/telomerase functions.     

Recognition of polyadenylate RNA by the poly(A)-binding protein.

The cocrystal structure of human poly(A)-binding protein (PABP) has been determined at 2.6 A resolution. PABP recognizes the 3' mRNA poly(A) tail and plays critical roles in eukaryotic translation initiation and mRNA stabilization/degradation. The minimal PABP used in this study consists of the N-terminal two RRM-type RNA-binding domains connected by a short linker (RRM1/2). These two RRMs form a continuous RNA-binding trough, lined by an antiparallel beta sheet backed by four alpha helices. The polyadenylate RNA adopts an extended conformation running the length of the molecular trough. Adenine recognition is primarily mediated by contacts with conserved residues found in the RNP motifs of the two RRMs. The convex dorsum of RRM1/2 displays a phylogenetically conserved hydrophobic/acidic portion, which may interact with translation initiation factors and regulatory proteins.     

Poly(A) nuclease interacts with the C-terminal domain of polyadenylate-binding protein domain from poly(A)-binding protein

The poly(A)-binding protein (PABP) is an essential protein found in all eukaryotes and is involved in an extensive range of cellular functions, including translation, mRNA metabolism, and mRNA export. Its C-terminal region contains a peptide-interacting PABC domain that recruits proteins containing a highly specific PAM-2 sequence motif to the messenger ribonucleoprotein complex. In humans, these proteins, including Paip1, Paip2, eRF3 (eukaryotic release factor 3), Ataxin-2, and Tob2, are all found to regulate translation through varying mechanisms. The following reports poly(A) nuclease (PAN) as a PABC-interacting partner in both yeast and humans. Their interaction is mediated by a PAM-2 motif identified within the PAN3 subunit. This site was identified in various fungal and animal species suggesting that the interaction is conserved throughout evolution. Our results indicate that PABP is directly involved in recruiting a deadenylase to the messenger ribonucleoprotein complex. This demonstrates a novel role for the PABC domain in mRNA metabolic processes and gives further insight into the function of PABP in mRNA maturation, export, and turnover.     

Disulfide bond formation between RNA binding domains is used to regulate mRNA binding activity of the chloroplast poly(A)-binding protein

Binding of the chloroplast poly(A)-binding protein, RB47, to the psbA mRNA is regulated in response to light and is required for translation of this mRNA in chloroplasts. The RNA binding activity of RB47 can be modulated in vitro by oxidation and reduction. Site-directed mutations to individual cysteine residues in each of the four RNA binding domains of RB47 showed that changing single cysteines to serines in domains 2 or 3 reduced, but did not eliminate, the ability of RB47 to be redox-regulated. Simultaneously changing cysteines to serines in both domains 2 and 3 resulted in the production of RB47 protein that was insensitive to redox regulation but retained the ability to bind the psbA mRNA at high affinity. The poly(A)-binding protein from Saccharomyces cerevisiae lacks cysteine residues in RNA binding domains 2 and 3, and this poly(A)-binding protein lacks the ability to be regulated by oxidation or reduction. These data show that disulfide bond formation between RNA binding domains in a poly(A)-binding protein can be used to regulate the ability of this protein to bind mRNA and suggest that redox regulation of RNA binding activity may be used to regulate translation in organisms whose poly(A)-binding proteins contain these critical cysteine residues.     

Solution structure of the orphan PABC domain from Saccharomyces cerevisiae poly(A)-binding protein

We have determined the solution structure of the PABC domain from Saccharomyces cerevisiae Pab1p and mapped its peptide-binding site. PABC domains are peptide binding domains found in poly(A)-binding proteins (PABP) and are a subset of HECT-family E3 ubiquitin ligases (also known as hyperplastic discs proteins (HYDs)). In mammals, the PABC domain of PABP functions to recruit several different translation factors to the mRNA poly(A) tail. PABC domains are highly conserved, with high specificity for peptide sequences of roughly 12 residues with conserved alanine, phenylalanine, and proline residues at positions 7, 10, and 12. Compared with human PABP, the yeast PABC domain is missing the first alpha helix, contains two extra amino acids between helices 2 and 3, and has a strongly bent C-terminal helix. These give rise to unique peptide binding specificity wherein yeast PABC binds peptides from Paip2 and RF3 but not Paip1. Mapping of the peptide-binding site reveals that the bend in the C-terminal helix disrupts binding interactions with the N terminus of peptide ligands and leads to greatly reduced binding affinity for the peptides tested. No high affinity or natural binding partners from S. cerevisiae could be identified by sequence analysis of known PABC ligands. Comparison of the three known PABC structures shows that the features responsible for peptide binding are highly conserved and responsible for the distinct but overlapping binding specificities.