Production of a novel dimeric metabolite of primaquine by Streptomyces rimosus.

Primaquine, an 8-amino-6-methoxyquinoline antimalarial agent, was subjected to metabolic studies with microorganisms. Streptomyces rimosus converted primaquine to the previously reported N-acetyl derivative. Continued incubation of S. rimosus resulted in the formation of a minor dimeric metabolite. The structure of the minor dimeric metabolite was proposed based primarily on its spectral data (1H and 13C nuclear magnetic resonance spectra and mass spectrum). The proposed structure of the metabolite was confirmed by synthesis of the dimer by treatment of primaquine-N-acetate with potassium ferricyanide in a biphasic chloroform-aqueous sodium bicarbonate system with a phase-transfer catalyst. Since (+/-)-primaquine was used for both the microbial transformation and synthesis, a diastereomeric mixture of symmetrical dimers was formed in each case. The metabolite sample was identical to the synthetic sample, as shown by direct comparison (thin-layer chromatography, co-thin-layer chromatography, high-pressure liquid chromatography, co-high-pressure liquid chromatography, 1H nuclear magnetic resonance spectra, and mass spectrum).     

Microbial transformation of primaquine by Candida tropicalis.

The microbial metabolism of primaquine, a 6-methoxy-8-aminoquinoline antimalarial agent, was investigated. The yeast Candida tropicalis was found to convert primaquine to the previously reported N-acetylated derivative. On continued incubation of C. tropicalis in the presence of the N-acetylated derivative, a minor dimeric metabolite was formed. The proposed structure of the metabolite was based primarily on the analysis of its spectroscopic properties (1H and 13C nuclear magnetic resonance spectra and field-desorption mass spectrum). The structure of the metabolite was proven by direct comparison with an authentic sample of the minor dimeric metabolite prepared by treatment of the N-acetylated derivative with formaldehyde in the presence of formic acid in methanol.     

Microbial transformation of primaquine by Candida tropicalis

The microbial metabolism of primaquine, a 6-methoxy-8-aminoquinoline antimalarial agent, was investigated. The yeast Candida tropicalis was found to convert primaquine to the previously reported N-acetylated derivative. On continued incubation of C. tropicalis in the presence of the N-acetylated derivative, a minor dimeric metabolite was formed. The proposed structure of the metabolite was based primarily on the analysis of its spectroscopic properties (1H and 13C nuclear magnetic resonance spectra and field-desorption mass spectrum). The structure of the metabolite was proven by direct comparison with an authentic sample of the minor dimeric metabolite prepared by treatment of the N-acetylated derivative with formaldehyde in the presence of formic acid in methanol.     

Novel urinary metabolite of d-delta-tocopherol in rats

A novel metabolite of d-delta-tocopherol was isolated from the urine of rats given d-3,4-[3H2]-delta-tocopherol intravenously. The metabolite was collected from the urine of rats given d-delta-tocopherol in the same manner as that of the labeled compound. It was found that the metabolites consisted of sulfate conjugates. The portion of the major metabolite released with sulfatase was determined to be 2,8-dimethyl-2-(2'-carboxyethyl)-6-chromanol by infrared spectra, nuclear magnetic resonance spectra, and mass spectra. The proposed structure was confirmed by comparing the analytical results with those of a synthetically derived compound. As a result of the structural elucidation of this novel metabolite, a pathway for the biological transformation of delta-tocopherol is proposed which is different from that of alpha-tocopherol. A characteristic feature of the pathway is the absence of any opening of the chroman ring throughout the sequence.     

Transformation of cinoxacin by Beauveria bassiana

The ability of the fungus Beauveria bassiana ATCC 7159 to transform the antibacterial agent cinoxacin was investigated. Cultures in sucrose-peptone broth were dosed with cinoxacin, grown for 20 days, and then extracted with ethyl acetate. Two metabolites were detected and purified by high-performance liquid chromatography. The major metabolite was identified by mass and proton nuclear magnetic resonance spectra as 1-ethyl-1,4-dihydro-3-(hydroxymethyl)[1,3]dioxolo[4,5-g]cinnolin-4-one and the minor metabolite was identified as 1-ethyl-1,4-dihydro-6,7-dihydroxy-3-(hydroxymethyl)cinnolin-4-one. B. bassiana also reduced quinoline-3-carboxylic acid to 3-(hydroxymethyl)quinoline.     

Biological synthesis of the analgesic hydromorphone, an intermediate in the metabolism of morphine, by Pseudomonas putida M10.

The morphine alkaloid hydromorphone (dihydromorphinone) was identified as an intermediary metabolite in the degradation of morphine by Pseudomonas putida M10. A constitutive NADH-dependent morphinone reductase capable of catalyzing the reduction of the 7,8-unsaturated bond of morphinone and codeinone, yielding hydromorphone and hydrocodone, respectively, was shown to be present in cell extracts. The structures have been identified by 1H nuclear magnetic resonance and mass spectrometry. Morphinone reductase has been partially purified by anion-exchange and gel filtration chromatography. This enzyme has potential applications as a biocatalyst for the synthesis of the highly potent analgesic hydromorphone and the antitussive hydrocodone.     

Dexamethasone metabolism in the horse

Dexamethasone and a metabolite, 9-fluoro-16α-methyl-6β, 11β, 16β-trihydroxy-1, 4-androstadiene-3, 17-dione, were detected in the urine of horses injected parenterally with the parent drug. The structure of the metabolite was elucidated by thin-layer chromatography, infrared spectroscopy, mass spectroscopy and nuclear magnetic resonance spectroscopy.     

Purification and chemical characterization of staphyloferrin B,a hydrophilic siderophore from staphylococci

This paper describes the chemical characterization of staphyloferrin B, a new complexone type siderophore isolated from low iron cultures of Staphylococcus hyicus DSM 20459. Purification of the very hydrophilic metabolite was achieved by anion exchange high performance liquid chromatography HPLC. Mass spectrometry showed a molecular mass of 448 amu. Hydrolysis with 8 mHCl revealed the presence of l-2,3-diaminopropionic acid, citrate, ethylenediamine and succinic semialdehyde. The connections between the four building blocks were determined by two-dimensional nuclear magnetic resonance measurements. UV/Vis and circular dichroism spectra are consistent with the proposed structure, which could also be confirmed by precursor feeding. The siderophore activity of staphyloferrin B was demonstrated by iron transport measurements.     

Cytokinin-like active principle associated with rice necrosis mosaic virus induced growth promotion in jute (Corchorus olitorius L.)

Rice necrosis mosaic virus-inoculated jute plants looked more juvenile with enhanced leaf size than control ones. Such enlarged leaves and those from control ones were collected separately and extracted in chilled methanol. The crude tissue extract in case of inoculated ones showed three times higher activity in bioassay for cytokinin over control. Biological assay with fractions of crude extract separated by thin layer chromatography (TLC) and high performance liquid chromatography (HPLC) was ascertained, and one fraction from inoculated sample showing higher activity in terms of growth over respective control was selected. Ultraviolet/visible absorbance spectra of TLC-separated fractions revealed the presence of different quantities of similar kind of compounds in both control and inoculated samples. A major compound with same m/z value of 217.1 was found in both cases as revealed through electrospray ionisation mass spectrophotometry analysis along with some other minor compounds. Different proton–proton coupling and a molecular structure of the highly substituted aliphatic groups were found in the material from inoculated sample having higher cytokinin-like activity than the control one, which was noticed through ¹H one-dimensional nuclear magnetic resonance analysis.     

Mg-2,4-divinyl pheoporphyrin a5: the product of a reaction catalyzed in vitro by developing chloroplasts

The major product of an aerobic reaction mixture containing developing chloroplasts, Mg-protoporphyrin IX, S-adenosylmethionine, and other cofactors was isolated and purified. Structural studies using nuclear magnetic resonance confirmed earlier reports, based on fluorescence and absorption spectra, that this compound is Mg-2,4-divinyl pheoporphyrin a5. The molecular weight determined by secondary-ion mass spectroscopy further confirmed the assigned structure. Absorption and fluorescence spectra indicate that this compound is identical to that reported previously by various workers in less-purified biological extracts. The nuclear magnetic resonance spectrum of the Mg-free base also supports the assigned structure.     

Conformation of an RNA pseudoknot.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.     

Microbial transformations of natural antitumor agents: conversion of lapachol to dehydro-alpha-lapachone by Curvularia lunata

Microbial transformation of lapachol, a naturally occurring naphthoquinone, was carried out by Curvularia lunata (NRRL 2178). The fungus brings about oxidative cyclization of the substrate to dehydro-alpha-lapachone, which was isolated and characterized by nuclear magnetic resonance and mass spectral analyses; its structure was verified by chemical synthesis. The metabolite is a naturally occurring chromene possessing antibacterial and antitumor activities.     

Microbial transformations of natural antitumor agents: conversion of lapachol to dehydro-alpha-lapachone by Curvularia lunata.

Microbial transformation of lapachol, a naturally occurring naphthoquinone, was carried out by Curvularia lunata (NRRL 2178). The fungus brings about oxidative cyclization of the substrate to dehydro-alpha-lapachone, which was isolated and characterized by nuclear magnetic resonance and mass spectral analyses; its structure was verified by chemical synthesis. The metabolite is a naturally occurring chromene possessing antibacterial and antitumor activities.     

Long-range (1)H-(15)N heteronuclear shift correlation at natural abundance: a tool to study benzothiazole biodegradation by two rhodococcus strains

The biodegradation of benzothiazole and 2-hydroxybenzothiazole by two strains of Rhodococcus was monitored by reversed phase high-pressure liquid chromatography and by (1)H nuclear magnetic resonance (NMR). Both xenobiotics were biotransformed into a hydroxylated derivative of 2-hydroxybenzothiazole by these two strains. The chemical structure of this metabolite was determined by a new NMR methodology: long-range (1)H-(15)N heteronuclear shift correlation without any previous (15)N enrichment of the compound. This powerful NMR tool allowed us to assign the metabolite structure to 2,6-dihydroxybenzothiazole.     

Isolation and structural characterization of a new crosslinking amino acid, cyclopentenosine, from the acid hydrolysate of elastin.

A novel polyfunctional crosslinking amino acid, which was developed slower than lysinonorleucine and faster than desmosine on thin layer chromatography, was isolated from the hydrolysate of bovine aorta elastin. Its proposed structure was verified by ultraviolet spectroscopy, fast atom bombardment mass spectroscopy, and nuclear magnetic resonance spectroscopy. The data indicated it to be a trifunctional amino acid with a cyclopentene structure. The mass spectral analysis indicated a parent compound with a mass of 381 (C18H27N3O6). The proposed structure is one derived from the condensation of three allysine residues. Based on the names of other crosslinking amino acids found in elastin, the trivial name of cyclopentenosine is given to this compound.     

Biosynthesis of the dimeric ellagitannin,cornusiin E,in Tellima grandiflora

First evidence for the in vitro synthesis of a dimeric ellagitannin has been obtained with cell-free extracts from the weed Tellima grandiflora (fringe cups, Saxifragaceae). Partially purified enzyme preparations from leaves of this plant catalyzed the oxidation of 1,2,3,4,6-pentagalloyl-beta-D-glucose to the monomeric ellagitannin, tellimagrandin II, followed by oxidative coupling of two units of this intermediate to yield a dimeric derivative. Chemical degradation, MALDI-TOF mass spectrometry, 1H and 13C nuclear magnetic resonance, and CD spectroscopy were employed to identify this enzyme reaction product as cornusiin E which is characterized by a (S)-valoneoyl bridge between glucose-positions 2, 4' and 6'. This result was supported by comparison with data obtained for cornusiin E that had been isolated from leaves of intact T. grandiflora plants. No indication for the earlier proposed existence of rugosin D (an isomer with a 1,4',6'-bound valoneoyl unit) in T. grandiflora has been obtained in this investigation.     

Metabolite fingerprinting and profiling in plants using NMR

Although less sensitive than mass spectrometry (MS), nuclear magnetic resonance (NMR) spectroscopy provides a powerful complementary technique for the identification and quantitative analysis of plant metabolites either in vivo or in tissue extracts. In one approach, metabolite fingerprinting, multivariate analysis of unassigned 1H NMR spectra is used to compare the overall metabolic composition of wild-type, mutant, and transgenic plant material, and to assess the impact of stress conditions on the plant metabolome. Metabolite fingerprinting by NMR is a fast, convenient, and effective tool for discriminating between groups of related samples and it identifies the most important regions of the spectrum for further analysis. In a second approach, metabolite profiling, the 1H NMR spectra of tissue extracts are assigned, a process that typically identifies 20-40 metabolites in an unfractionated extract. These profiles may also be used to compare groups of samples, and significant differences in metabolite concentrations provide the basis for hypotheses on the underlying causes for the observed segregation of the groups. Both approaches generate a metabolic phenotype for a plant, based on a system-wide but incomplete analysis of the plant metabolome. However, a review of the literature suggests that the emphasis so far has been on the accumulation of analytical data and sample classification, and that the potential of 1H NMR spectroscopy as a tool for probing the operation of metabolic networks, or as a functional genomics tool for identifying gene function, is largely untapped.     

S-adenosylhomocysteine metabolism in Streptomyces flocculus.

S-Adenosylhomocysteine metabolism was studied in cell extracts of streptonigrin-producing Streptomyces flocculus. The major route of metabolism was found to be deamination to form S-inosylhomocysteine. The metabolite was purified by high-performance liquid chromatography and identified by its UV and nuclear magnetic resonance spectra and by its chemical degradation to hypoxanthine.     

Identification of a novel metabolite in phenanthrene metabolism by the fungus Cunninghamella elegans

The metabolism of phenanthrene by the fungus Cunninghamella elegans was investigated. Kinetic experiments using [9-14C]phenanthrene showed that after 72 h, 53% of the total radioactivity was associated with a glucoside conjugate of 1-hydroxyphenanthrene (phenanthrene 1-O-beta-glucose). This metabolite was isolated by reversed-phase high-performance liquid chromatography and characterized by the application of UV absorption, 1H nuclear magnetic resonance, and mass spectral techniques. The results show that aromatic ring oxidation followed by glucosylation is a predominant pathway in the metabolism of the polycyclic aromatic hydrocarbon phenanthrene by C. elegans.     

1H nuclear magnetic resonance assignments and secondary structure of porcine C5ades Arg

Sequence-specific assignments of the 1H nuclear magnetic resonance spectrum of porcine C5ades Arg are described. Assignments were facilitated by comparison of spectra obtained in H2O with partially exchanged spectra obtained in 2H2O. The sequence-specific assignments thus obtained were used to characterized the regular secondary structure in the protein, which is helical in the regions 2 to 11, 16 to 27, 35 to 41 and 45 to 64. The structure is very similar to that of human and bovine C5a.