Synthesis and preliminary evaluation of curcumin analogues as cytotoxic agents

A series of curcumin analogues with different substituents at the 4-position of the phenyl group were synthesized and screened for in vitro cytotoxicity against a panel of human cancer cell lines. Several novel curcumin analogues, especially 32 and 34, exhibited selective and potent cytotoxic activity against human epidermoid carcinoma cell line A-431 and human glioblastoma cell line U-251, implying their specific potential in the chemoprevention and chemotherapy of skin cancer and glioma. The preliminary SAR information extracted from the results suggested that introduction of appropriate substituents to the 4′-positions could be a promising approach for the development of new cytotoxic curcumin analogues with special selectivity for A-431 and U-251 cell lines.     

C-aryl glucosides substituted at the 4'-position as potent and selective renal sodium-dependent glucose co-transporter 2 (SGLT2) inhibitors for the treatment of type 2 diabetes

A series of C-aryl glucosides with various substituents at the 4′-position of the distal aryl ring have been synthesized and evaluated for inhibition of hSGLT1 and hSGLT2. Introduction of alkyl or alkoxy substituents at the 4′-position was found to improve SGLT2 potency, whereas introduction of a hydrophilic group at this position was deleterious. Compounds with alkoxy-, cycloalkoxy- or cycloalkenyloxy-ethoxy scaffolds exhibited good inhibitory activity and high selectivity toward SGLT2. Selected compounds were investigated for in vivo efficacy.     

Molecular docking and QSAR analyses of aromatic heterocycle thiosemicarbazone analogues for finding novel tyrosinase inhibitors

A collection of 36 thiosemicarbazone analogues possessed a broad span of tyrosinase inhibitory activities was designed and obtained. Robust and reliable CoMFA and CoMSIA models were gained to predict the structure–activity relationship and the new modifier direction. Inhibitory activities of the compounds were found to greatly depend upon molecular shape, size, and charge. The sterically bulky group at the C-4 position of the thiophene ring contributed a high capacity for biological activity. Some bulky substituents at the C1-position and C12-position, and electron-negative groups at the C3-position, helped to improve the activity of these analogues. The molecular docking results provided visual evidence for QSAR analysis and detailed information about binding mode, affinity, and the principal mechanism between the ligands and tyrosinase. Based on these, a prospective structure modification and optimization of the most potent compound, T32, was suggested for further research.     

Structure-activity analysis of 2′-modified cinnamaldehyde analogues as potential anticancer agents

The natural product 2′-hydroxycinnamaldehyde (HCA) and its analogue, 2′-benzoyloxycinnamaldehyde (BCA), have been previously shown to have antiproliferative and proapoptotic effects in vitro and inhibit tumor growth in vivo. In this study, we use structure-activity analysis to define structural features that are important for the activity of cinnamaldehyde analogues. Our results emphasize an important role for both the propenal group as well as the modification at the 2′-position. Further studies were aimed to characterize the mechanism of action of BCA. Exposure to BCA induced cell death via caspase-dependent and -independent pathways. Cell death was not due to autophagy or necrosis as a result of energy depletion or induction of reactive oxygen species. Our findings have important implications for future drug design and highlight the importance of defining molecular drug targets for this promising class of potential anticancer agents.     

Biodegradation of bisphenol A and its halogenated analogues by <Emphasis Type="Italic">Cunninghamella elegans</Emphasis> ATCC36112

Bisphenol A and its halogenated analogues are commonly used industrial chemicals with strong toxicological effects over many organisms. In this study, metabolic fate of bisphenol A and its halogenated analogues were evaluated with Cunninghamella elegans ATCC36112. Bisphenol A and related analogues were rapidly transformed into several metabolites by C. elegans within 2–4 days. Detailed analysis of metabolites reveals that both phase I and II metabolism occurred in C. elegans. Cytochrome P450-dependent hydroxylation was observed in BPA. However, major reaction with bisphenol A and analogues with 1-2 halogen atoms were the formation of glucose-conjugate, not being inhibited by cytochrome P450 inhibitor. Overall metabolic rates decreased with increasing number of substitution at 2- and 6-position of BPA structures, which may be consequences of limited bioavailability or steric hindrance to conjugate-forming reaction. Information from the current study will provide detailed insights over the fungal metabolism of BPA and analogues.     

Synthesis and inhibitory activity of thymidine analogues targeting Mycobacterium tuberculosis thymidine monophosphate kinase

We report on Mycobacterium tuberculosis thymidine monophosphate kinase (TMPKmt) inhibitory activities of a series of new 3′- and 5′-modified thymidine analogues including α- and β-derivatives. In addition, several analogues were synthesized in which the 4-oxygen was replaced by a more lipophilic sulfur atom to probe the influence of this modification on TMPKmt inhibitory activity. Several compounds showed an inhibitory potency in the low micromolar range, with the 5′-arylthiourea 4-thio-α-thymidine analogue being the most active one (K_i = 0.17 μM). This compound was capable of inhibiting mycobacteria growth at a concentration of 25 μg/mL.     

Keto-fluorothiopyranosyl nucleosides: a convenient synthesis of 2- and 4-keto-3-fluoro-5-thioxylopyranosyl thymine analogs

A novel series of fluorinated keto-β-d-5-thioxylopyranonucleosides bearing thymine as the heterocyclic base have been designed and synthesized. Deprotection of 3-deoxy-3-fluoro-5-S-acetyl-5-thio-d-xylofuranose (1) and selective acetalation gave the desired isopropylidene 5-thioxylopyranose precursor 3. Acetylation and isopropylidene removal followed by benzoylation led to 3-deoxy-3-fluoro-1,2-di-Ο-benzoyl-4-O-acetyl-5′-thio-d-xylopyranose (6). This was condensed with silylated thymine and selectively deacetylated to afford 1-(2′-Ο-benzoyl-3′-deoxy-3′-fluoro-5′-thio-β-d-xylopyranosyl)thymine (8). Oxidation of the free hydroxyl group in the 4′-position of the sugar led to the formation of the target 4′-keto compound together with the concomitant displacement of the benzoyl group by an acetyl affording, 1-(2′-O-acetyl-3′-deoxy-3′-fluoro-β-d-xylopyranosyl-4′-ulose)thymine (9). Benzoylation of 3 and removal of the isopropylidene group followed by acetylation, furnished 3-deoxy-3-fluoro-1,2-di-Ο-acetyl-4-O-benzoyl-5′-thio-d-xylopyranose (12). Condensation of thiosugar 12 with silylated thymine followed by selective deacetylation led to the 1-(4′-Ο-benzoyl-3′-fluoro-5′-thio-β-d-xylopyranosyl)thymine (14). Oxidation of the free hydroxyl group in the 2′-position and concomitant displacement of the benzoyl group by an acetyl gave target 1-(4′-O-acetyl-3′-deoxy-3′-fluoro-β-d-xylopyranosyl-2′-ulose)thymine (15).     

Preparation of 4'-benzenesulfonyl-3'-deoxythymidine and its reaction with organoaluminum and organosilicon reagents

The 4′-benzenesulfonyl derivative of 3′-deoxythymidine was prepared from 3′-deoxythymidine-5′-aldehyde. The 4′-benzenesulfonyl leaving group undergoes a nucleophilic substitution with organoaluminum and organosilicon reagents to furnish a variety of 4′-substituted (Me, Et, i-Bu, trimethylsilylethynyl, CH₂CHCH₂, CN, N₃) analogues.     

NMR structure of 2′-O-(2-methoxyethyl) modified and C5-methylated RNA dodecamer duplex

The solution-state structure of 2′-O-(2-methoxyethly) substituted dodecamer r(*CG*CGAA*U*U*CG*C)d(G), 2′-MOE RNA, with all cytosines and uracils methylated at the C5-position has been determined by NMR spectroscopy. The chemical modifications were used to improve the oligonucleotide's drug-like properties. The 2′-MOE group drives pseudorotational equilibrium of the ribofuranose moiety to the N-type conformation and supposedly results in structural preorganization leading to high affinity of a modified oligonucleotide towards its complementary biological target, improved pharmacokinetic and toxicological properties. The high melting temperature of the antiparallel duplex structure adopted by 2′-MOE RNA was explained through the formation of a stable A-form RNA consistent with effective base-pairing and stacking interactions. The comparison of the solution-state structure with the crystal structure of a non-methylated analogue shows an increase in the stacking at the base pair steps for the C5-methylated 2′-MOE RNA duplex. The MOE substituents adopt a well-defined structure in the minor groove with the predominant gauche conformations around the ethylene bond.     

Receptor activity and conformational analysis of 5'-halogenated resiniferatoxin analogs as TRPV1 ligands

A series of 5′-halogenated resiniferatoxin analogs have been investigated in order to examine the effect of halogenation in the A-region on their binding and the functional pattern of agonism/antagonism for rat TRPV1 heterologously expressed in Chinese hamster ovary cells. Halogenation at the 5-position in the A-region of RTX and of 4-amino RTX shifted the agonism of parent compounds toward antagonism. The extent of antagonism was greater as the size of the halogen increased (I > Br > Cl > F) while the binding affinities were similar, as previously observed for our potent agonists. In this series, 5-bromo-4-amino RTX (39) showed very potent antagonism with K_i (ant) = 2.81 nM, which was thus 4.5-fold more potent than 5′-iodo RTX, previously reported as a potent TRPV1 antagonist. Molecular modeling analyses with selected agonists and the corresponding halogenated antagonists revealed a striking conformational difference. The 3-methoxy of the A-region in the agonists remained free to interact with the receptor whereas in the case of the antagonists, the compounds assumed a bent conformation, permitting the 3-methoxy to instead form an internal hydrogen bond with the C4-hydroxyl of the diterpene.     

Discovery of bacterial NAD+-dependent DNA ligase inhibitors: optimization of antibacterial activity

Optimization of adenosine analog inhibitors of bacterial NAD⁺-dependent DNA ligase is discussed. Antibacterial activity against Streptococcus pneumoniae and Staphylococcus aureus was improved by modification of the 2-position substituent on the adenine ring and 3′- and 5′-substituents on the ribose. Compounds with log D values 1.5-2.5 maximized potency and maintained drug-like physical properties.     

Six new flavonoids from Citrus

Valencia orange (C. sinensis) and Robinson tangerine [(C. paradisi × C. reticulata) × (C. reticulata)] were examined for flavonoids. Thirteen flavonoids were isolated, six of which are new constituents of citrus peel. These are: 3,5,6,7,3′,4′-hexamethoxyflavone, 3,5,7,8,3′,4′-hexamethoxyflavone, 5-hydroxy-3,7,8,3′,4′-pentamethoxyflavone, 5-hydroxy-3,6,7,8,3′,4′-hexamethoxyflavone, 5,7,8,4′-tetramethoxyflavone and 5,7,8,3′,4′-pentamethoxyflavone. The latter three flavonoids are reported for the first time as natural products. A method is described for readily obtaining small quantities of 5,7,8,4′-tetramethoxy and 5,7,8,3′,4′-pentamethoxyflavones from their 5,6,7-trimethoxy analogs.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

Flavoenzymes catalyzing oxidative aromatic ring-cleavage reactions

2-Methyl-3-hydroxypyridine-5-carboxylic acid (MHPC) oxygenase (MHPCO) and 5-pyridoxic acid oxygenase are flavoenzymes catalyzing an aromatic hydroxylation and a ring-cleavage reaction. Both enzymes are involved in biodegradation of vitamin B6 in bacteria. Oxygen-tracer experiments have shown that the enzymes are monooxygnases since only one atom of molecular oxygen is incorporated into the products. Kinetics of MHPCO has shown that the enzyme is similar to single-component flavoprotein hydroxylases in that the binding of MHPC is required prior to the flavin reduction by NADH, and C4a-hydroperoxy-FAD and C4a-hydroxy-FAD are found as intermediates. Investigation on the protonation status of the substrate upon binding to the enzyme has shown that only the tri-ionic form of MHPC is bound at the MHPCO active site. Using a series of FAD analogues with substituents at the 8-position of the isoalloxazine ring, the oxygenation of MHPC by the C4a-hydroperoxy-FAD was shown to occur via an electrophilic aromatic substitution mechanism. Recently, the X-ray structures of MHPCO and a complex of MHPC-MHPCO at 2.1 Å have been reported and show the presence of nine water molecules in the enzyme active site. Based on structural data, a few residues, Tyr82, Tyr223, Arg181, were suggested to be important for catalysis of MHPCO.     

Preparation and properties of ruthenium (II) complexes of 2,2′:6′,2″-terpyridines substituted at the 4′-position with heterocyclic groups

Four ligands whose general formula is R-terpy with terpy = 2,2′:6′,2″ terpyridine bearing at the 4′-position a substituent R = 2-furyl, 2-pyrrolyl, 2-thienyl and 5-2,2′bithienyl were synthesised. The absorption spectra and the electrochemical behaviour of the corresponding homoleptic Ru(II) complexes were investigated and compared to those of the parent complex [Ru(terpy)]²⁺. Due to the donor effect of the grafted heterocyclic groups, the absorption and emission maxima are red-shifted and the energy levels of the HOMO Π(t_2g) metal orbitals are slightly higher. The incorporation of these heterocyclic moieties extends the electronic delocalisation over the corresponding ligands, leading to higher emission quantum yields. Cyclic voltammetric studies of pyrrolyl-, thienyl- and bithienyl-functionalised complexes show that an electroactive layer can be deposited on the electrode. Preliminary results point out that an electrodeposited film could be used as a photocathode in an aqueous electrolyte.     

7-Substituted 2-phenyl-benzofurans as ER beta selective ligands

A series of 2-(4-hydroxy-phenyl)-benzofuran-5-ols with relatively lipophilic groups in the 7-position of the benzofuran was prepared and the affinity and selectivity for ER beta was measured. Many of the analogues were found to be potent and selective ER beta ligands. Additional modifications at the benzofuran 4-position as well as at the 3'-position of the 2-phenyl group were found to further increase selectivity. Such modifications led to compounds with <10 nM potency and >100-fold selectivity for ER beta.     

Efficient synthesis of exomethylene- and keto-exomethylene-d-glucopyranosyl nucleoside analogs as potential cytotoxic agents

A novel series of exomethylene- and keto-exomethylene-d-glucopyranonucleosides with thymine, uracil, and 5-fluorouracil as heterocyclic bases have been designed and synthesized. Wittig condensation of the 3-keto glucoside 1 gave the corresponding 1,2:5,6-di-O-isopropylidene-3-deoxy-3-methylene-d-glucofuranose (2), which after hydrolysis and acetylation led to the precursor 1,2,4,6-tetra-O-acetyl-3-deoxy-3-methylene-d-glucopyranose (4).Compound 4 was condensed with silylated thymine, uracil, and 5-fluorouracil, respectively, deacetylated and acetalated to afford 1-(3′-deoxy-4′,6′-O-isopropylidene-3′-methylene-β-d-glucopyranosyl)pyrimidines 7a–c. Oxidation of the free hydroxyl group in the 2′-position of the sugar moiety led to the formation of the labile 1-(3′-deoxy-4′,6′-O-isopropylidene-3′-methylene-β-d-glucopyranosyl-2′-ulose)pyrimidines 8a–c. Finally, deisopropylidenation of the resulted derivatives 8a–c afforded the diol nucleosides 9a–c. The target keto-exomethylene analogs 9a–c were more cytostatic against a variety of tumor cell lines than the corresponding saturated-hydroxy-exomethylene derivatives 6. In particular, the 5-fluorouracil derivative 9c was highly cytostatic at an IC₅₀ (50% inhibitory concentration) ranging between 0.56 and 9.4 μg/mL, which was comparable to the free parental 5-fluorouracil base.     

Quantitative Structure–Activity Relationship Study of 5-Iodo- and Diaryl-analogues of Tubercidin: Inhibitors of Adenosine Kinase

The adenosine kinase inhibitory (AKI) activity of 5-iodo and diaryl analogues of tubercidin is quantitatively analyzed using Fujita-Ban and Hansch type analyses. The Fujita-Ban analysis being a non-parametric approach assigned the highest contribution to Cl at the X-position, C6H4-4-Cl, C6H5, 2-furanyl and I at the Y-position and CH2NH2 and CH3 at the Z-position. In addition, a OH substituent at the C-position also emerged as a better choice possibly due to its engagement in hydrogen bonding with some active site function. Thus a compound having Cl, C6H4-4-Cl, CH2NH2 and OH respectively at X-, Y-, Z- and C-positions is predicted to have a potency nearly 1.5 orders of magnitude higher than the most potent compound of the parent data set. The Hansch type analysis, on the other hand, is a parametric approach and is carried out on two sub-sets of original compounds. This sub-division is based on size and nature of the substituents present at the X- and Y-positions. For the compounds in the first sub-set the derived significant correlation equation suggested that the substituent at the Y-position exhibiting a higher field effect and a substituent such as Cl and CH2NH2 at X- and Z-positions, respectively, are important for a compound to show increased AKI activity. Thio/alkylthio at X and CH2OCH3 at Z, on the other hand, lead to a detrimental effect. Similarly for the compounds in the second sub-set, the derived significant correlation equation showed that a substituent at the X-position having a higher negative field effect, a substituent at the Y-position having bulky groups and the C-position occupied by a OH group are essential for enhancement of the activity of a compound.     

Novel Acyclic Derivatives of Aica-Riboside (1-(β-D-Ribopuranosyl)5-Amino-4-Imidazolecarboxamide), Potential Antiviral Agents

Abstract

A synthetic approach is described to obtain from AICA-riboside acyclic analogues of 2′-deoxyribosides in which the C(2′)-C(3′) bond is cleaved and the natural configuration (E) at the anomeric C (1′)-position is retained.