共查询到20条相似文献,搜索用时 359 毫秒
1.
Boraston AB Creagh AL Alam MM Kormos JM Tomme P Haynes CA Warren RA Kilburn DG 《Biochemistry》2001,40(21):6240-6247
The C-terminal family 9 carbohydrate-binding module of xylanase 10A from Thermotoga maritima (CBM9-2) binds to amorphous cellulose, crystalline cellulose, and the insoluble fraction of oat spelt xylan. The association constants (K(a)) for adsorption to insoluble polysaccharides are 1 x 10(5) to 3 x 10(5) M(-1). Of the soluble polysaccharides tested, CBM9-2 binds to barley beta-glucan, xyloglucan, and xylan. CBM9-2 binds specifically to the reducing ends of cellulose and soluble polysaccharides, a property that is currently unique to this CBM. CBM9-2 also binds glucose, xylose, galactose, arabinose, cellooligosaccharides, xylooligosaccharides, maltose, and lactose, with affinities ranging from 10(3) M(-1) for monosaccharides to 10(6) M(-1) for disaccharides and oligosaccharides. Cellooligosaccharides longer than two glucose units do not bind with improved affinity, indicating that cellobiose is sufficient to occupy the entire binding site. In general, the binding reaction is dominated by favorable changes in enthalpy, which are partially compensated by unfavorable entropy changes. 相似文献
2.
Boraston AB Kwan E Chiu P Warren RA Kilburn DG 《The Journal of biological chemistry》2003,278(8):6120-6127
Cellulase Cel5A from alkalophilic Bacillus sp. 1139 contains a family 17 carbohydrate-binding module (BspCBM17) and a family 28 CBM (BspCBM28) in tandem. The two modules have significantly similar amino acid sequences, but amino acid residues essential for binding are not conserved. BspCBM28 was obtained as a discrete polypeptide by engineering the cel5A gene. BspCBM17 could not be obtained as a discrete polypeptide, so a family 17 CBM from endoglucanase Cel5A of Clostridium cellulovorans, CcCBM17, was used to compare the binding characteristics of the two families of CBM. Both CcCBM17 and BspCBM28 recognized two classes of binding sites on amorphous cellulose: a high affinity site (K(a) approximately 1 x 10(6) M(-1)) and a low affinity site (K(a) approximately 2 x 10(4) M(-1)). They did not compete for binding to the high affinity sites, suggesting that they bound at different sites on the cellulose. A polypeptide, BspCBM17/CBM28, comprising the tandem CBMs from Cel5A, bound to amorphous cellulose with a significantly higher affinity than the sum of the affinities of CcCBM17 and BspCBM28, indicating cooperativity between the linked CBMs. Cel5A mutants were constructed that were defective in one or both of the CBMs. The mutants differed from the wild-type enzyme in the amounts and sizes of the soluble products produced from amorphous cellulose. This suggests that either the CBMs can modify the action of the catalytic module of Cel5A or that they target the enzyme to areas of the cellulose that differ in susceptibility to hydrolysis. 相似文献
3.
Characterization of a cellulase containing a family 30 carbohydrate-binding module (CBM) derived from Clostridium thermocellum CelJ: importance of the CBM to cellulose hydrolysis
下载免费PDF全文
![点击此处可从《Journal of bacteriology》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Arai T Araki R Tanaka A Karita S Kimura T Sakka K Ohmiya K 《Journal of bacteriology》2003,185(2):504-512
Clostridium thermocellum CelJ is a modular enzyme containing a family 30 carbohydrate-binding module (CBM) and a family 9 catalytic module at its N-terminal moiety. To investigate the functions of the CBM and the catalytic module, truncated derivatives of CelJ were constructed and characterized. Isothermal titration calorimetric studies showed that the association constants (K(a)) of the CBM polypeptide (CBM30) for the binding of cellopentaose and cellohexaose were 1.2 x 10(4) and 6.4 x 10(4) M(-1), respectively, and that the binding of CBM30 to these ligands is enthalpically driven. Qualitative analyses showed that CBM30 had strong affinity for cellulose and beta-1,3-1,4-mixed glucan such as barley beta-glucan and lichenan. Analyses of the hydrolytic action of the enzyme comprising the CBM and the catalytic module showed that the enzyme is a processive endoglucanse with strong activity towards carboxymethylcellulose, barley beta-glucan and lichenan. By contrast, the catalytic module polypeptide devoid of the CBM showed negligible activity toward these substrates. These observations suggest that the CBM is extremely important not only because it mediates the binding of the enzyme to the substrates but also because it participates in the catalytic function of the enzyme or contributes to maintaining the correct tertiary structure of the family 9 catalytic module for expressing enzyme activity. 相似文献
4.
McLean BW Bray MR Boraston AB Gilkes NR Haynes CA Kilburn DG 《Protein engineering》2000,13(11):801-809
The family 2a carbohydrate-binding module (CBM2a) of xylanase 10A from Cellulomonas fimi binds to the crystalline regions of cellulose. It does not share binding sites with the N-terminal family 4 binding module (CBM4-1) from the cellulase 9B from C.fimi, a module that binds strictly to soluble sugars and amorphous cellulose. The binding of CBM2a to crystalline matrices is mediated by several residues on the binding face, including three prominent, solvent-exposed tryptophan residues. Binding to crystalline cellulose was analyzed by making a series of conservative (phenylalanine and tyrosine) and non-conservative substitutions (alanine) of each solvent-exposed tryptophan (W17, W54 and W72). Other residues on the binding face with hydrogen bonding potential were substituted with alanine. Each tryptophan plays a different role in binding; a tryptophan is essential at position 54, a tyrosine or tryptophan at position 17 and any aromatic residue at position 72. Other residues on the binding face, with the exception of N15, are not essential determinants of binding affinity. Given the specificity of CBM2a, the structure of crystalline cellulose and the dynamic nature of the binding of CBM2a, we propose a model for the interaction between the polypeptide and the crystalline surface. 相似文献
5.
Selvaraj T Kim SK Kim YH Jeong YS Kim YJ Phuong ND Jung KH Kim J Yun HD Kim H 《Journal of microbiology (Seoul, Korea)》2010,48(6):856-861
A non-cellulosomal xylanase from Clostridium thermocellum, XynX, consists of a family-22 carbohydratebinding module (CBM22), a family-10 glycoside hydrolase (GH10) catalytic module, two family-9 carbohydrate-binding modules (CBM9-I and CBM9-II), and an S-layer homology (SLH) module. E. coli BL21(DE3) (pKM29), a transformant carrying xynX', produced several truncated forms of the enzyme. Among them, three major active species were purified by SDS-PAGE, activity staining, gel-slicing, and diffusion from the gel. The truncated xylanases were different from each other only in their C-terminal regions. In addition to the CBM22 and GH10 catalytic modules, XynX(1) had the CBM9-I and most of the CBM9-II, XynX(2) had the CBM9-I and about 40% of the CBM9-II, and XynX(3) had about 75% of the CBM9-I. The truncated xylanases showed higher binding capacities toward Avicel than those toward insoluble xylan. XynX(1) showed a higher affinity toward Avicel (70.5%) than XynX(2) (46.0%) and XynX(3) (42.1%); however, there were no significant differences in the affinities toward insoluble xylan. It is suggested that the CBM9 repeat, especially CBM9-II, of XynX plays a role in xylan degradation in nature by strengthening cellulose binding rather than by enhancing xylan binding. 相似文献
6.
Kormos J Johnson PE Brun E Tomme P McIntosh LP Haynes CA Kilburn DG 《Biochemistry》2000,39(30):8844-8852
Endoglucanase C (CenC), a beta1,4 glucanase from the soil bacterium Cellulomonas fimi, binds to amorphous cellulose via two homologous cellulose binding domains, termed CBD(N1) and CBD(N2). In this work, the contributions of 10 amino acids within the binding cleft of CBD(N1) were evaluated by single site-directed mutations to alanine residues. Each isolated domain containing a single mutation was analyzed for binding to an insoluble amorphous preparation of cellulose, phosphoric acid swollen Avicel (PASA), and to a soluble glucopyranoside polymer, barley beta-glucan. The effect of any given mutation on CBD binding was similar for both substrates, suggesting that the mechanism of binding to soluble and insoluble substrates is the same. Tyrosines 19 and 85 were essential for tight binding by CBD(N1) as their replacement by alanine results in affinity decrements of approximately 100-fold on PASA, barley beta-glucan, and soluble cellooligosaccharides. The tertiary structures of unbound Y19A and Y85A were assessed by heteronuclear single quantum coherence (HSQC) spectroscopy. These studies indicated that the structures of both mutants were perturbed but that all perturbations are very near to the site of mutation. 相似文献
7.
Bolam DN Xie H White P Simpson PJ Hancock SM Williamson MP Gilbert HJ 《Biochemistry》2001,40(8):2468-2477
Glycoside hydrolases often contain multiple copies of noncatalytic carbohydrate binding modules (CBMs) from the same or different families. Currently, the functional importance of this complex molecular architecture is unclear. To investigate the role of multiple CBMs in plant cell wall hydrolases, we have determined the polysaccharide binding properties of wild type and various derivatives of Cellulomonas fimi xylanase 11A (Cf Xyn11A). This protein, which binds to both cellulose and xylan, contains two family 2b CBMs that exhibit 70% sequence identity, one internal (CBM2b-1), which has previously been shown to bind specifically to xylan and the other at the C-terminus (CBM2b-2). Biochemical characterization of CBM2b-2 showed that the module bound to insoluble and soluble oat spelt xylan and xylohexaose with K(a) values of 5.6 x 10(4), 1.2 x 10(4), and 4.8 x 10(3) M(-1), respectively, but exhibited extremely weak affinity for cellohexaose (<10(2) M(-1)), and its interaction with insoluble cellulose was too weak to quantify. The CBM did not interact with soluble forms of other plant cell wall polysaccharides. The three-dimensional structure of CBM2b-2 was determined by NMR spectroscopy. The module has a twisted "beta-sandwich" architecture, and the two surface exposed tryptophans, Trp 570 and Trp 602, which are in a perpendicular orientation with each other, were shown to be essential for ligand binding. In addition, changing Arg 573 to glycine altered the polysaccharide binding specificity of the module from xylan to cellulose. These data demonstrate that the biochemical properties and tertiary structure of CBM2b-2 and CBM2b-1 are extremely similar. When CBM2b-1 and CBM2b-2 were incorporated into a single polypeptide chain, either in the full-length enzyme or an artificial construct comprising both CBM2bs covalently joined via a flexible linker, there was an approximate 18-20-fold increase in the affinity of the protein for soluble and insoluble xylan, as compared to the individual modules, and a measurable interaction with insoluble acid-swollen cellulose, although the K(a) (approximately 6.0 x 10(4) M(-1)) was still much lower than for insoluble xylan (K(a) = approximately 1.0 x 10(6) M(-1)). These data demonstrate that the two family 2b CBMs of Cf Xyn11A act in synergy to bind acid swollen cellulose and xylan. We propose that the increased affinity of glycoside hydrolases for polysaccharides, through the synergistic interactions of CBMs, provides an explanation for the duplication of CBMs from the same family in some prokaryotic cellulases and xylanases. 相似文献
8.
The C-terminal 155 amino acids of the putative laminarinase, Lam16A, from T. maritima comprise a highly thermostable family 4 CBM that binds beta-1,3- and beta-(1,3)(1,4)-glucans. Laminarin, a beta-1,3-glucan, presented two classes of binding sites for TmCBM4-2, one with a very high affinity (3.5 x 10(7) M(-1)) and one with a 100-fold lower affinity (2.4 x 10(5) M(-1)). The affinities for laminarioligosaccharides and beta-(1,3)(1,4)-glucans ranged from approximately 2 x 10(5) to approximately 2.5 x 10(6) M(-1). Cellooligosaccharides and laminariobiose were bound only very weakly (K(a)s approximately 5 x 10(3) M(-1)). Spectroscopic and mutagenic studies implicated the involvement of three tryptophan residues (W28, W58, and W99) and one tyrosine residue (Y23) in ligand binding. Binding was enthalpically driven and associated with large negative changes in heat capacity. Temperature and osmotic conditions profoundly influenced binding. For the first time in solution, the direct uptake and release of water in CBM binding are demonstrated. 相似文献
9.
Zinc binding to the two Cys(4) sites present in the DNA-binding domain (DBD) of nuclear hormone receptor proteins is required for proper folding of the domain and for protein activity. By utilizing Co(2+) as a spectroscopic probe, we have characterized the metal-binding properties of the two Cys(4) structural zinc-binding sites found in the DBD of human estrogen receptor alpha (hERalpha-DBD) and rat glucocorticoid receptor (GR-DBD). The binding affinity of Co(2+) to the two proteins was determined relative to the binding affinity of Co(2+) to the zinc finger consensus peptide, CP-1. Using the known dissociation constant of Co(2+) from CP-1, the dissociation constants of cobalt from hERalpha-DBD were calculated: K(d1)(Co) = 2.2 (+/- 1.0) x 10(-7) M and K(d2)(Co) = 6.1 (+/- 1.5) x 10(-7) M. Similarly, the dissociation constants of Co(2+) from GR-DBD were calculated: K(d1)(Co) = 4.1 (+/- 0.6) x 10(-7) M and K(d2)(Co) = 1.7 (+/- 0.3) x 10(-7) M. Metal-binding studies conducted in which Zn(2+) displaces Co(2+) from the metal-binding sites of hERalpha-DBD and GR-DBD indicate that Zn(2+) binds to each of the Cys(4) metal-binding sites approximately 3 orders of magnitude more tightly than Co(2+) does: the stoichiometric dissociation constants are K(d1)(Zn) = 1 (+/- 1) x 10(-10) M and K(d2)(Zn) = 5 (+/- 1) x 10(-10) M for hERalpha-DBD and K(d1)(Zn) = 2 (+/- 1) x 10(-10) M and K(d2)(Zn) = 3 (+/- 1) x 10(-10) M for GR-DBD. These affinities are comparable to those observed for most other naturally occurring structural zinc-binding sites. In contrast to the recent prediction by Low et. al. that zinc binding in these systems should be cooperative [Low, L. Y., Hernández, H., Robinson, C. V., O'Brien, R., Grossmann, J. G., Ladbury, J. E., and Luisi, B. (2002) J. Mol. Biol. 319, 87-106], these data suggest that the zincs that bind to the two sites in the DBDs of hERalpha-DBD and GR-DBD do not interact. 相似文献
10.
The role of a miniscaffolding protein, miniCipC1, forming part of Clostridium cellulolyticum scaffolding protein CipC in insoluble cellulose degradation was investigated. The parameters of the binding of miniCipC1, which contains a family III cellulose-binding domain (CBD), a hydrophilic domain, and a cohesin domain, to four insoluble celluloses were determined. At saturating concentrations, about 8.2 micromol of protein was bound per g of bacterial microcrystalline cellulose, while Avicel, colloidal Avicel, and phosphoric acid-swollen cellulose bound 0.28, 0.38, and 0.55 micromol of miniCipC1 per g, respectively. The dissociation constants measured varied between 1.3 x 10(-7) and 1.5 x 10(-8) M. These results are discussed with regard to the properties of the various substrates. The synergistic action of miniCipC1 and two forms of endoglucanase CelA (with and without the dockerin domain [CelA2 and CelA3, respectively]) in cellulose degradation was also studied. Although only CelA2 interacted with miniCipC1 (K(d), 7 x 10(-9) M), nonhydrolytic miniCipC1 enhanced the activities of endoglucanases CelA2 and CelA3 with all of the insoluble substrates tested. This finding shows that miniCipC1 plays two roles: it increases the enzyme concentration on the cellulose surface and enhances the accessibility of the enzyme to the substrate by modifying the structure of the cellulose, leading to an increased available cellulose surface area. In addition, the data obtained with a hybrid protein, CelA3-CBD(CipC), which was more active towards all of the insoluble substrates tested confirm that the CBD of the scaffolding protein plays an essential role in cellulose degradation. 相似文献
11.
Levasseur A Navarro D Punt PJ Belaïch JP Asther M Record E 《Applied and environmental microbiology》2005,71(12):8132-8140
Two chimeric enzymes, FLX and FLXLC, were designed and successfully overproduced in Aspergillus niger. FLX construct is composed of the sequences encoding the feruloyl esterase A (FAEA) fused to the endoxylanase B (XYNB) of A. niger. A C-terminal carbohydrate-binding module (CBM family 1) was grafted to FLX, generating the second hybrid enzyme, FLXLC. Between each partner, a hyperglycosylated linker was included to stabilize the constructs. Hybrid proteins were purified to homogeneity, and molecular masses were estimated to be 72 and 97 kDa for FLX and FLXLC, respectively. Integrity of hybrid enzymes was checked by immunodetection that showed a single form by using antibodies raised against FAEA and polyhistidine tag. Physicochemical properties of each catalytic module of the bifunctional enzymes corresponded to those of the free enzymes. In addition, we verified that FLXLC exhibited an affinity for microcrystalline cellulose (Avicel) with binding parameters corresponding to a Kd of 9.9 x 10(-8) M for the dissociation constant and 0.98 micromol/g Avicel for the binding capacity. Both bifunctional enzymes were investigated for their capacity to release ferulic acid from natural substrates: corn and wheat brans. Compared to free enzymes FAEA and XYNB, a higher synergistic effect was obtained by using FLX and FLXLC for both substrates. Moreover, the release of ferulic acid from corn bran was increased by using FLXLC rather than FLX. This result confirms a positive role of the CBM. In conclusion, these results demonstrated that the fusion of naturally free cell wall hydrolases and an A. niger-derived CBM onto bifunctional enzymes enables the increase of the synergistic effect on the degradation of complex substrates. 相似文献
12.
V Notenboom A B Boraston P Chiu A C Freelove D G Kilburn D R Rose 《Journal of molecular biology》2001,314(4):797-806
The crystal structure of the Clostridium cellulovorans carbohydrate-binding module (CBM) belonging to family 17 has been solved to 1.7 A resolution by multiple anomalous dispersion methods. CBM17 binds to non-crystalline cellulose and soluble beta-1,4-glucans, with a minimal binding requirement of cellotriose and optimal affinity for cellohexaose. The crystal structure of CBM17 complexed with cellotetraose solved at 2.0 A resolution revealed that binding occurs in a cleft on the surface of the molecule involving two tryptophan residues and several charged amino acids. Thermodynamic binding studies and alanine scanning mutagenesis in combination with the cellotetraose complex structure allowed the mapping of the CBM17 binding cleft. In contrast to the binding groove characteristic of family 4 CBMs, family 17 CBMs appear to have a very shallow binding cleft that may be more accessible to cellulose chains in non-crystalline cellulose than the deeper binding clefts of family 4 CBMs. The structural differences in these two modules may reflect non-overlapping binding niches on cellulose surfaces. 相似文献
13.
Ali E Araki R Zhao G Sakka M Karita S Kimura T Sakka K 《Bioscience, biotechnology, and biochemistry》2005,69(12):2389-2394
Clostridium josui xylanase Xyn10A is a modular enzyme comprising two family-22 carbohydrate-binding modules (CBMs), a family-10 catalytic module (CM), a family-9 CBM, and two S-layer homologous modules, consecutively from the N-terminus. To study the functions of the family-22 CBMs, truncated derivatives of Xyn10A were constructed: a recombinant CM polypeptide (rCM), a family-22 CBM polypeptide (rCBM), and a polypeptide composed of the family-22 CBMs and CM (rCBM-CM). Recombinant proteins were characterized by enzyme and binding assays. rCBM-CM showed the highest activity toward xylan and weak activity toward some polysaccharides such as barley beta-glucan and carboxymethyl-cellulose. Although rCBM showed an affinity for insoluble and soluble xylan as well as barley beta-glucan and Avicel in qualitative binding assays, removal of the CBMs negligibly affected the catalytic activity and thermostability of the CM. 相似文献
14.
Bai E Rosell FI Lige B Mauk MR Lelj-Garolla B Moore GR Mauk AG 《The Biochemical journal》2006,400(3):385-392
The functional properties of the recombinant C-terminal dimerization domain of the Pseudomonas aeruginosa Fur (ferric uptake regulator) protein expressed in and purified from Escherichia coli have been evaluated. Sedimentation velocity measurements demonstrate that this domain is dimeric, and the UV CD spectrum is consistent with a secondary structure similar to that observed for the corresponding region of the crystallographically characterized wild-type protein. The thermal stability of the domain as determined by CD spectroscopy decreases significantly as pH is increased and increases significantly as metal ions are added. Potentiometric titrations (pH 6.5) establish that the domain possesses a high-affinity and a low-affinity binding site for metal ions. The high-affinity (sensory) binding site demonstrates association constants (K(A)) of 10(+/-7)x10(6), 5.7(+/-3)x10(6), 2.0(+/-2)x10(6) and 2.0(+/-3)x10(4) M(-1) for Ni2+, Zn2+, Co2+ and Mn2+ respectively, while the low-affinity (structural) site exhibits association constants of 1.3(+/-2)x10(6), 3.2(+/-2)x10(4), 1.76(+/-1)x10(5) and 1.5(+/-2)x10(3) M(-1) respectively for the same metal ions (pH 6.5, 300 mM NaCl, 25 degrees C). The stability of metal ion binding to the sensory site follows the Irving-Williams order, while metal ion binding to the partial sensory site present in the domain does not. Fluorescence experiments indicate that the quenching resulting from binding of Co2+ is reversed by subsequent titration with Zn2+. We conclude that the domain is a reasonable model for many properties of the full-length protein and is amenable to some analyses that the limited solubility of the full-length protein prevents. 相似文献
15.
Importance of the carbohydrate-binding module of Clostridium stercorarium Xyn10B to xylan hydrolysis 总被引:2,自引:0,他引:2
Ali MK Hayashi H Karita S Goto M Kimura T Sakka K Ohmiya K 《Bioscience, biotechnology, and biochemistry》2001,65(1):41-47
The Clostridium stercorarium xylanase Xyn10B is a modular enzyme comprising two thermostabilizing domains, a family 10 catalytic domain of glycosyl hydrolases, a family 9 carbohydrate-binding module (CBM), and two S-layer homologous (SLH) domains [Biosci. Biotechnol. Biochem., 63, 1596-1604 (1999)]. To investigate the role of this CBM, we constructed two derivatives of Xyn10B and compared their hydrolytic activity toward xylan and some preparations of plant cell walls; Xyn10BdeltaCBM consists of a catalytic domain only, and Xyn10B-CBM comprises a catalytic domain and a CBM. Xyn10B-CBM bound to various insoluble polysaccharides including Avicel, acid-swollen cellulose, ball-milled chitin, Sephadex G-25, and amylose-resin. A cellulose binding assay in the presence of soluble saccharides suggested that the CBM of Xyn10B had an affinity for even monosaccharides such as glucose, galactose, xylose, mannose and ribose. Removal of the CBM from the enzyme negated its cellulose- and xylan-binding abilities and severely reduced its enzyme activity toward insoluble xylan and plant cell walls but not soluble xylan. These findings clearly indicated that the CBM of Xyn10B is important in the hydrolysis of insoluble xylan. This is the first report of a family 9 CBM with an affinity for insoluble xylan in addition to crystalline cellulose and the ability to increase hydrolytic activity toward insoluble xylan. 相似文献
16.
Sakka K Nakanishi M Sogabe M Arai T Ohara H Tanaka A Kimura T Ohmiya K 《Bioscience, biotechnology, and biochemistry》2003,67(2):406-409
The family 6 carbohydrate-binding module (CBM) of Clostridium thermocellum XynA was expressed, and the binding equilibria of the CBM with xylooligosaccharides (degree of polymerization DP = 2-8) were observed by isothermal titration calorimetry (ITC) at pH 8. The association constant, Ka, increased with increasing DP from 5 x 10(3) M(-1) (DP = 2) to approximately 5 x 10(5) M(-1) (DP = 5-8) at 20 degrees C. The Ka values at 60 degrees C were about 1/10 of those at 20 degrees C. The binding was found to be an enthalpy-driven reaction. The DP dependence of the thermodynamic parameters of the binding reaction suggested the size of the ligand-binding site to be 5 xylose units long. 相似文献
17.
Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies. 相似文献
18.
Arai T Kosugi A Chan H Koukiekolo R Yukawa H Inui M Doi RH 《Applied microbiology and biotechnology》2006,71(5):654-660
The cellulosomal family 9 cellulase genes engH, engK, engL, engM, and engY of Clostridium cellulovorans have been cloned and sequenced. We compared the enzyme activity of family 9 cellulosomal cellulases from C. cellulovorans and their derivatives. EngH has the highest activity toward soluble cellulose derivatives such as carboxymethylcellulose (CMC) as well as insoluble cellulose such as acid-swollen cellulose (ASC). EngK has high activity toward insoluble cellulose such as ASC and Avicel. The results of thin-layer chromatography showed that the cleavage products of family 9 cellulases were varied. These results indicated that family 9 endoglucanases possess different modes of attacking substrates and produce varied products. To investigate the functions of the carbohydrate-binding module (CBM) and the catalytic module, truncated derivatives of EngK, EngH, and EngY were constructed and characterized. EngHΔCBM and EngYΔCBM devoid of the CBM lost activity toward all substrates including CMC. EngKΔCBM and EngMΔCBM did not lose activity toward CMC but lost activity toward Avicel. These observations suggest that the CBM is extremely important not only because it mediates the binding of the enzyme to the substrates but also because it participates in the catalytic function of the enzyme or contributes to maintaining the correct tertiary structure of the family 9 catalytic module for expressing enzyme activity. 相似文献
19.
Jung KC Rhee HS Park CH Yang CH 《Biochemical and biophysical research communications》2005,334(1):269-275
c-Myc, the protein product of protooncogene c-myc, functions in cell proliferation, differentiation, and neoplastic disease. In this study, recombinant c-Myc and Max proteins, encompassing DNA binding (basic region) and dimerization (helix-loop-helix/leucine zipper) domain of human origin, were expressed in bacteria as Myc87 and Max85. Myc87 was purified under denatured conditions and was renatured again. The dissociation constant for the protein dimers and for dimer/DNA complexes were not detectable by isothermal titration calorimetry because of the low degree of solubility of Myc87 and Max85. Therefore, we set up equations which were used to determine the dissociation constants from the proportion of protein-DNA complexes. The dimer dissociation constants in TBS were 5.90(+/-0.54)x10(-7)M for Max85/Max85 homodimer, 6.85(+/-0.25)x10(-3)M for Myc87/Myc87 homodimer, and 2.55(+/-0.29)x10(-8)M for Myc87/Max85 heterodimer, and the DNA-binding dissociation constants in TBS were 1.33(+/-0.21)x10(-9)M for Max85/Max85/DNA, 2.27(+/-0.08)x10(-12)M for Myc87/Myc87/DNA, and 4.43(+/-0.37)x10(-10)M for Myc87/Max85/DNA. In addition, we revealed that linoleic acid which is known as an inhibitor for the formation of Max/Max/DNA complex reduced the affinity of Max homodimer for DNA. This result indicates that linoleic acid may bind to the DNA-binding region of Max homodimer. 相似文献