A second locus for familial high myopia maps to chromosome 12q.

Myopia, or nearsightedness, is the most common eye disorder worldwide. "Pathologic" high myopia, or myopia of <=-6.00 diopters, predisposes individuals to retinal detachment, macular degeneration, cataract, or glaucoma. A locus for autosomal dominant pathologic high myopia has been mapped to 18p11.31. We now report significant linkage of high myopia to a second locus at the 12q21-23 region in a large German/Italian family. The family had no clinical evidence of connective-tissue abnormalities or glaucoma. The average age at diagnosis of myopia was 5.9 years. The average spherical-component refractive error for the affected individuals was -9.47 diopters. Markers flanking or intragenic to the genes for the 18p locus, Stickler syndromes type I and II (12q13.1-q13.3 and 6p21.3), Marfan syndrome (15q21.1), and juvenile glaucoma (chromosome 1q21-q31) showed no linkage to the myopia in this family. The maximum LOD score with two-point linkage analysis in this pedigree was 3.85 at a recombination fraction of .0010, for markers D12S1706 and D12S327. Recombination events identified markers D12S1684 and D12S1605 as flanking markers that define a 30.1-cM interval on chromosome 12q21-23, for the second myopia gene. These results confirm genetic heterogeneity of myopia. The identification of this gene may provide insight into the pathophysiology of myopia and eye development.     

Linkage studies with 17q and 18q markers in a breast/ovarian cancer family.

Genes on chromosomes 17q and 18q have been shown to code for putative tumor suppressors. By a combination of allele-loss studies on sporadic ovarian carcinomas and linkage analysis on a breast/ovarian cancer family, we have investigated the involvement of such genes in these diseases. Allele loss occurred in sporadic tumors from both chromosome 17p, in 18/26 (69%) cases, and chromosome 17q, in 15/22 (68%) cases. In the three familial tumors studied, allele loss also occurred on chromosome 17 (in 2/3 cases for 17p markers and in 2/2 cases for a 17q allele). Allele loss on chromosome 18q, at the DCC (deleted in colorectal carcinomas) locus, was not as common (6/16 cases [38%]) in sporadic ovarian tumors but had occurred in all three familial tumors. The results of linkage analysis on the breast/ovarian cancer family suggested linkage between the disease locus and 17q markers, with a maximum lod score of 1.507 obtained with Mfd188 (D17S579) polymorphism at 5% recombination. The maximum lod score for DCC was 0.323 at 0.1% recombination. In this family our results are consistent with a predisposing gene for breast/ovarian cancer being located at chromosome 17q21.     

Evidence that a locus for familial high myopia maps to chromosome 18p.

Myopia, or nearsightedness, is the most common human eye disorder. A genomewide screen was conducted to map the gene(s) associated with high, early-onset, autosomal dominant myopia. Eight families that each included two or more individuals with >=-6.00 diopters (D) myopia, in two or more successive generations, were identified. Myopic individuals had no clinical evidence of connective-tissue abnormalities, and the average age at diagnosis of myopia was 6.8 years. The average spherical component refractive error for the affected individuals was -9.48 D. The families contained 82 individuals; of these, DNA was available for 71 (37 affected). Markers flanking or intragenic to the genes for Stickler syndrome types 1 and 2 (chromosomes 12q13.1-q13.3 and 6p21.3, respectively), Marfan syndrome (chromosome 15q21.1), and juvenile glaucoma (chromosome 1q21-q31) were also analyzed. No evidence of linkage was found for markers for the Stickler syndrome types 1 and 2, the Marfan syndrome, or the juvenile glaucoma loci. After a genomewide search, evidence of significant linkage was found on chromosome 18p. The maximum LOD score was 9.59, with marker D18S481, at a recombination fraction of .0010. Haplotype analysis further refined this myopia locus to a 7.6-cM interval between markers D18S59 and D18S1138 on 18p11.31.     

A locus for familial generalized lentiginosis without systemic involvement maps to chromosome 4q21.1–q22.3

Generalized lentiginosis (GL) is characterized by widespread lentigines without associated noncutaneous abnormalities. In this study we performed a genome-wide linkage search in a Chinese family with GL and localized the familial GL locus to chromosome 4q21.1–q22.3, with a maximum two-point LOD score of 3.01 for D4S395 and D4S423 at a recombination fraction of 0. Multipoint analysis (maximum LOD score of 5.08 between markers D4S395 and D4S1563) and haplotype construction showed strong evidence of linkage in a region of 20 Mb flanked by markers D4S2915 and D4S1560 on chromosome 4q21.1–q22.3. This is the first report of linkage for GL, and it will provide further insight into the controversy of whether GL is an entity distinct from LEOPARD syndrome.Qinghe Xing and Xiangdong Chen contributed equally to this work     

Inactivation of both alleles of the DPC4/SMAD4 gene in advanced colorectal cancers: identification of seven novel somatic mutations in tumors from Japanese patients.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4/SMAD4 gene, lying in close proximity to the DCC gene at 18q21.1, was recently identified as a candidate tumor suppressor for the genesis of pancreatic cancer as well as a predisposing gene for Juvenile Polyposis Syndrome (JPS). The gene product functions as a cytoplasmic mediator in the signaling pathway of transforming growth factor beta (TGF-beta). To investigate the potential role of DPC4/SMAD4 gene in colorectal cancers, we examined 73 tumors of clinical stages II or III from Japanese patients, for LOH at 18q21 and also for subtle mutations anywhere within the coding region of DPC4/SMAD4. LOH was identified in 50 (78%) of the 64 tumors that were informative for polymorphic markers in the region. Somatic mutations were identified in seven of those tumors: two frameshift mutations, a 1-bp deletion (326 del T) in exon 8 and a 1-bp insertion (50-51 ins A) in exon 1; two nonsense mutations, Arg445Ter in exon 10 and Glu538Ter in exon 11; and three missense mutations, Asn129Lys in exon 2, Tyr95Asn in exon 2, and Asp355Glu in exon 8. Three of the seven mutations were observed in the mad homology 1 (MH1) domain encoded by exons 1 and 2. In all of the tumors carrying intragenic mutations of one allele, LOH analysis had shown that the other allele was missing. The results demonstrated that inactivation of both alleles of the DPC4/SMAD4 gene occurs in a substantial proportion of advanced colorectal cancers, and that the DPC4/SMAD4 gene probably exerts a tumor-suppressor effect for colorectal carcinogenesis that fulfills the criterion of the two-hit concept proposed by Knudson [A.G. Knudson, Hereditary cancer, oncogenes, and anti-oncogenes, Cancer Res. 45 (1985) 1437-1443.].     

Connexin 50 mutation in a family with congenital "zonular nuclear" pulverulent cataract of Pakistani origin

Inherited cataract is a clinically and genetically heterogeneous disease that most often presents as a congenital autosomal dominant trait. Here we report linkage of a three-generation family of Pakistani origin with autosomal dominant cataract "zonular nuclear" pulverulent type (CZNP) on chromosome 1q21.1. Genome wide-linkage analysis excluded all the known cataract loci except on chromosome 1q. Significantly positive 2-point lod score values (Z=3.01 at θ=0) were obtained for markers D1S305 and D1S2721, which are known to flank the gene for connexin 50 (Cx50) or gap junction protein alpha-8 (Gja8). Previously a mutation in this gene has been reported in a British family with zonular pulverulent cataract (CZP).Here we describe a second mutation (E48K) in connexin 50 that confirms the involvement of this gene in cataractogenesis. Electronic Publication     

A Bedouin kindred with infantile nephronophthisis demonstrates linkage to chromosome 9 by homozygosity mapping.

A novel type of infantile nephronophthisis was identified in an extended Bedouin family from Israel. This disease has an autosomal recessive mode of inheritance, with the phenotypic presentation ranging from a Potter-like syndrome to hyperechogenic kidneys, renal insufficiency, hypertension, and hyperkalemia. Affected individuals show rapid deterioration of kidney function, leading to end-stage renal failure within 3 years. Histopathologic examination of renal tissue revealed variable findings, ranging from infantile polycystic kidneys to chronic tubulointerstitial nephritis, fibrosis, and cortical microcysts. A known familial juvenile nephronophthisis locus on chromosome 2q13 and autosomal recessive polycystic kidney disease on chromosome 6p21.1-p12 were excluded by genetic linkage analysis. A genomewide screen for linkage was conducted by searching for a locus inherited by descent in all affected individuals. Pooled DNA samples from parents and unaffected siblings and individual DNA samples from four affected individuals were used as PCR templates with trinucleotide- and tetranucleotide-repeat polymorphic markers. Using this approach, we identified linkage to infantile nephronophthisis for markers on chromosome 9q22-31. The disorder maps to a 12.9-cM region flanked by markers D9S280 and GGAT3G09.     

Search for a founder mutation in idiopathic focal dystonia from Northern Germany.

Both the discovery of the DYT1 gene on chromosome 9q34 in autosomal dominant early-onset torsion dystonia and the detection of linkage for one form of adult-onset focal dystonia to chromosome 18p (DYT7) in a family from northern Germany provide the opportunity to further investigate genetic factors in the focal dystonias. Additionally, reports of linkage disequilibrium between several chromosome 18 markers and focal dystonia, both in sporadic patients from northern Germany and in members of affected families from central Europe suggest the existence of a founder mutation underlying focal dystonia in this population. To evaluate the role of these loci in focal dystonia, we tested 85 patients from northern Germany who had primary focal dystonia, both for the GAG deletion in the DYT1 gene on chromosome 9q34 and for linkage disequilibrium at the chromosome 18p markers D18S1105, D18S1098, D18S481, and D18S54. None of these patients had the GAG deletion in the DYT1 gene. Furthermore, Hardy-Weinberg analysis of markers on 18p in our patient population and in 85 control subjects from the same region did not support linkage disequilibrium. Taken together, these results suggest that most cases of focal dystonia in patients of northern German or central European origin are due neither to the GAG deletion in DYT1 nor to a proposed founder mutation on chromosome 18p but must be caused by other genetic or environmental factors.     

Role of Smad4 (DPC4) inactivation in human cancer

The tumor suppressor gene Smad4 (DPC4) at chromosome 18q21.1 belongs to the Smad family, which mediates the TGFbeta signaling pathway suppressing epithelial cell growth. This review summarizes the mutational events of the Smad4 gene in human cancer. The Smad4 gene is genetically responsible for familial juvenile polyposis, an autosomal dominant disease characterized by predisposition to gastrointestinal polyps and cancer. In this syndrome, polyps are formed by inactivation of the Smad4 gene through germline mutation and loss of the unaffected wild-type allele. In pancreatic and colorectal cancer, inactivation of the Smad4 gene through homozygous deletion or intragenic mutation occurs frequently in association with malignant progression. However, mutation of this gene is seen only occasionally in the rest of human cancers. The majority of Smad4 gene mutations in human cancer are missense, nonsense, and frameshift mutations at the mad homology 2 region (MH2), which interfere with the homo-oligomer formation of Smad4 protein and the hetero-oligomer formation between Smad4 and Smad2 proteins, resulting in disruption of TGFbeta signaling. Supporting evidence for the above observation was provided by genetically manipulated mice carrying either a heterozygote of the Smad4 gene or a compound heterozygote of the Smad4 and APC genes, which develop either gastrointestinal polyps/cancer mimicking familial juvenile polyposis or progressed colorectal cancer, respectively.     

Localization of the mutation in an extended family with Charcot-Marie-Tooth neuropathy (HMSN I).

Hereditary motor and sensory neuropathy type I (HMSN I) or Charcot-Marie-Tooth (CMT) disease is an autosomal dominant peripheral neuropathy. In some CMT families linkage has been reported with either the Duffy blood group or the APOA2 gene, both located on chromosome 1q. More recently, linkage has been found in six CMT families with two chromosome 17p markers. We extensively analyzed a multi-generation Charcot-Marie-Tooth family by using molecular genetic techniques in order to localize the CMT gene defect. First, we constructed a continuous linkage group of 11 chromosome 1 markers and definitely excluded chromosome 1 as the site of mutation. Second, we analyzed the family for linkage with chromosome 17. The two-point lod scores obtained with D17S58 and D17S71 proved that this Charcot-Marie-Tooth family is linked to chromosome 17. Moreover, multipoint linkage results indicated that the mutation is most likely located on the chromosome 17p arm, distal of D17S71.     

A major locus for myoclonus-dystonia maps to chromosome 7q in eight families

Myoclonus-dystonia (M-D) is an autosomal dominant disorder characterized by myoclonic and dystonic muscle contractions that are often responsive to alcohol. The dopamine D2 receptor gene (DRD2) on chromosome 11q has been implicated in one family with this syndrome, and linkage to a 28-cM region on 7q has been reported in another. We performed genetic studies, using eight additional families with M-D, to assess these two loci. No evidence for linkage was found for 11q markers. However, all eight of these families showed linkage to chromosome 7 markers, with a combined multipoint LOD score of 11.71. Recombination events in the families define the disease gene within a 14-cM interval flanked by D7S2212 and D7S821. These data provide evidence for a major locus for M-D on chromosome 7q21.     

Benign recurrent intrahepatic cholestasis (BRIC): evidence of genetic heterogeneity and delimitation of the BRIC locus to a 7-cM interval between D18S69 and D18S64

Benign recurrent intrahepatic cholestasis (BRIC) is an autosomal recessive liver disease characterized by multiple episodes of cholestasis without progression to chronic liver disease. The gene was previously assigned to chromosome 18q21, using a shared segment analysis in three families from the Netherlands. In the present study we report the linkage analysis of an expanded sample of 14 BRIC families, using 15 microsatellite markers from the 18q21 region. Obligate recombinants in two families place the gene in a 7-cM interval, between markers D18S69 and D18S64. All intervening markers had significant LOD scores in two-point linkage analysis. Moreover, we identified one family in which the BRIC gene seems to be unlinked to the 18q21 region, or that represents incomplete penetrance of the BRIC genotype. Received: 6 March 1997 / Accepted: 26 March 1997     

A common gene for juvenile and adult-onset primary open-angle glaucomas confined on chromosome 1q.

Primary open-angle glaucoma (POAG), which causes progressive loss of the visual fields, was subdivided into two groups according to age at onset: (1) chronic open-angle glaucoma (COAG) diagnosed after age 40 years and (2) juvenile open-angle glaucoma (JOAG) diagnosed between 3 years of age and early adulthood. A JOAG gene (GLC1A) was recently mapped to chromosome 1q. We studied 142 members of a huge multigenerational French Canadian family affected with autosomal dominant POAG. Either JOAG or COAG was diagnosed in 40 patients. Six subjects were also diagnosed with ocular hypertension (OHT), which may lead to POAG. To localize a common disease gene that might be responsible for both glaucoma subsets, we performed linkage analysis considering JOAG and COAG under the same phenotypic category. JOAG/COAG was tightly linked to seven microsatellite markers on chromosome 1q23-q25; a maximum lod score of 6.62 was obtained with AF-M278ye5. To refine the disease locus, we exploited a recombination mapping strategy based on a unique founder effect. The same characteristic haplotype, composed of 14 markers spanning 12 cM between loci D1S196 and D1S212, was recognized in all persons affected by JOAG, COAG, or OHT, but it did not occur in unaffected spouses and in normal family members > 35 years of age, except for three obligatory carriers. Key recombination events confined the disease region within a 9-cM interval between loci D1S445 and D1S416/D1S480. These observations demonstrate that the GLC1A gene is responsible for both adult-onset and juvenile glaucomas and suggest that the JOAG and COAG categories within this family may be part of a clinical continuum artificially divided at age 40 years.     

Linkage of the gene for an autosomal dominant form of juvenile amyotrophic lateral sclerosis to chromosome 9q34.

We performed genetic mapping studies of an 11-generation pedigree with an autosomal dominant, juvenile-onset motor-systems disease. The disorder is characterized by slow progression, distal limb amyotrophy, and pyramidal tract signs associated with severe loss of motor neurons in the brain stem and spinal cord. The gene for this disorder, classified as a form of juvenile amyotrophic lateral sclerosis (ALS), is designated "ALS4." We performed a genomewide search and detected strong evidence for linkage of the ALS4 locus to markers from chromosome 9q34. The highest LOD score (Z) was obtained with D9S1847 (Z=18.8, recombination fraction of .00). An analysis of recombinant events identified D9S1831 and D9S164 as flanking markers, on chromosome 9q34, that define an approximately 5-cM interval that harbors the ALS4 gene. These results extend the degree of heterogeneity within familial ALS syndromes, and they implicate a gene on chromosome 9q34 as critical for motor-neuron function.     

Linkage of Bipolar Affective Disorder to Chromosome 18 Markers in a New Pedigree Series

Several groups have reported evidence suggesting linkage of bipolar affective disorder (BPAD) to chromosome 18. We have reported data from 28 pedigrees that showed linkage to marker loci on 18p and to loci 40 cM distant on 18q. Most of the linkage evidence derived from families with affected phenotypes in only the paternal lineage and from marker alleles transmitted on the paternal chromosome. We now report results from a series of 30 new pedigrees (259 individuals) genotyped for 13 polymorphic markers spanning chromosome 18. Subjects were interviewed by a psychiatrist and were diagnosed by highly reliable methods. Genotypes were generated with automated technology and were scored blind to phenotype. Affected sib pairs showed excess allele sharing at the 18q markers D18S541 and D18S38. A parent-of-origin effect was observed, but it was not consistently paternal. No robust evidence of linkage was detected for markers elsewhere on chromosome 18. Multipoint nonparametric linkage analysis in the new sample combined with the original sample of families supports linkage on chromosome 18q, but the susceptibility gene is not well localized.     

Two families with familial amyotrophic lateral sclerosis are linked to a novel locus on chromosome 16q

Amyotrophic lateral sclerosis (ALS) is a fatal adult-onset disease in which motor neurons in the brain and spinal cord degenerate by largely unknown mechanisms. ALS is familial (FALS) in 10% of cases, and the inheritance is usually dominant, with variable penetrance. Mutations in copper/zinc super oxide dismutase (SOD1) are found in 20% of familial and 3% of sporadic ALS cases. Five families with ALS and frontotemporal dementia (ALS-FTD) are linked to 9q21, whereas one family with pure ALS is linked to 18q21. We identified two large European families with ALS without SOD1 mutations or linkage to known FALS loci and conducted a genomewide linkage screen using 400 microsatellite markers. In both families, two-point LOD scores >1 and a haplotype segregating with disease were demonstrated only across regions of chromosome 16. Subsequent fine mapping in family 1 gave a maximum two-point LOD score of 3.62 at D16S3137 and a three-point LOD score of 3.85 for markers D16S415 and D16S3137. Haplotype analysis revealed no recombination > approximately 30 cM, (flanking markers at D16S3075 and D16S3112). The maximum two-point LOD score for family 2 was 1.84 at D16S415, and the three-point LOD score was 2.10 for markers D16S419 and D16S415. Definite recombination occurred in several individuals, which narrowed the shared haplotype in affected individuals to a 10.1-cM region (flanking markers: D16S3396 and D16S3112). The region shared by both families on chromosome 16q12 corresponds to approximately 4.5 Mb on the Marshfield map. Bioinformatic analysis of the region has identified 18 known genes and 70 predicted genes in this region, and sequencing of candidate genes has now begun.     

Genetic mapping of hereditary mixed polyposis syndrome to chromosome 6q.

Hereditary mixed polyposis syndrome (HMPS) is characterized by atypical juvenile polyps, colonic adenomas, and colorectal carcinomas. HMPS appears to be inherited in an autosomal dominant manner. Genetic linkage analysis has been performed on a large family with HMPS. Data did not support linkage to the APC locus or to any of the loci for hereditary nonpolyposis colorectal cancer. Evidence that the HMPS locus lies on chromosome 6q was, however, provided by significant two-point LOD scores for linkage between HMPS and the D6S283 locus. Analysis of recombinants and multipoint linkage analysis suggested that the HMPS locus lies in a 4-cM interval containing the D6S283 locus and flanked by markers D6S468 and D6S301.     

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.     

Further localization of a gene for paroxysmal dystonic choreoathetosis to a 5-cM region on chromosome 2q34

Paroxysmal dystonic choreoathetosis (PDC) is a rare neurological disorder characterized by episodes of involuntary movement, involving the extremities and face, which may occur spontaneously or be precipitated by caffeine, alcohol, anxiety, and fatigue. PDC is transmitted as an autosomal dominant trait with incomplete penetrance. A gene implicated in this paroxysmal disorder has been mapped to a 10–15 cM region on chromosome 2q31–36 in two families. We describe a third family with PDC. Two-point linkage analyses with markers linked to the candidate PDC locus were performed. A maximum two-point LOD score of 4.20 at a recombination fraction of zero was obtained for marker D2S120, confirming linkage to the distal portion of chromosome 2q. The anion exchanger gene, SLC2C, maps to this region, but the family was poorly informative for polymorphic markers within and flanking this candidate gene. Haplotype analysis revealed a critical recombination event that confines the PDC gene to a 5-cM region bounded by the markers D2S164 and D2S377. We compared the haplotype in our family with that in another chromosome 2-linked PDC family, but did not detect a region of shared genotypes. However, identifying a third family whose disease maps to the same region and narrowing the critical region will facilitate identification of the 2q-linked PDC gene. Received: 10 June 1997 / Accepted: 17 September 1997