The complete nucleotide sequence of a 16S ribosomal RNA gene from tobacco chloroplasts: Recombinant plasmid; sequence homology; stem and loop structure

The complete nucleotide sequence of a 16S ribosomal RNA gene from tobacco chloroplasts has been determined. This nucleotide sequence has 96% homology with that of maize chloroplast 16S rRNA gene and 74% homology with that of Escherichia coli16S gene.The 3′ terminal region of this gene contains the sequence ACCTCC which is complementary to sequences found at the 5′ termini of prokaryotic mRNAs.The large stem and loop structure can be constructed from the sequences surrounding the 5′ and 3′ ends of the 16S gene. These observations demonstrate the prokaryotic nature of chloroplast 16S rRNA.     

Role of the constant uridine in binding of yeast tRNAPhe anticodon arm to 30S ribosomes.

Twenty-two anticodon arm analogues were prepared by joining different tetra, penta, and hexaribonucleotides to a nine nucleotide fragment of yeast tRNAPhe with T4 RNA ligase. The oligomer with the same sequence as the anticodon arm of tRNAPhe bind poly U programmed 30S ribosomes with affinity similar to intact tRNAPhe. Analogues with an additional nucleotide in the loop bind ribosomes with a weaker affinity whereas analogues with one less nucleotide in the loop do not bind ribosomes at all. Reasonably tight binding of anticodon arms with different nucleotides on the 5' side of the anticodon suggest that positions 32 and 33 in the tRNAPhe sequence are not essential for ribosome binding. However, differences in the binding constants for anticodon arms containing modified uridine residues in the "constant uridine" position suggest that both of the internal "U turn" hydrogen bonds predicted by the X-ray crystal structure are necessary for maximal ribosome binding.     

A phenylalanine tRNA gene from Neurospora crassa: conservation of secondary structure involving an intervening sequence.

We have isolated and sequenced a tRNAPhe gene from Neurospora crassa. Hybridization analyses suggest that trnaPhe is the only tRNA encoded on the cloned 5 kb DNA fragment. The tRNAPhe gene contains an intervening sequence 16 nucleotides in length located one nucleotide 3' to the anticodon position. The tRNAPhe coding region of Neurospora and yeast are 91% conserved, whereas their intervening sequences are only 50% identical. The pattern of sequence conservation is consistent with a proposed secondary structure for the tRNA precursor in which the anticodon is base paired with the middle of the intervening sequence and the splice points are located in adjacent single-stranded loops. The DNA sequence following the tRNAPhe coding region is similar to sequences following other genes transcribed by RNA polymerase III in that it is AT-rich and includes a tract of A residues in the coding strand. In contrast, the sequence preceding the Neurospora tRNAPhe coding region does not resemble sequences preceding other sequenced tRNA genes.     

Nucleotide sequence of Halobacterium cutirubrum ribosomal 5 S ribonucleic acid. An altered secondary structure in halophilic organisms

The nucleotide sequence of ribosomal 5 S RNA from a halophilic bacterium, Halobacterium cutirubrum, grown in 4 M sodium chloride is U-U-A-A-G-G-C-G-G-C-C-A-U-A-G-C-G-G-U-G-G-G-G-U-U-A-C-U-C-C-C-G-U-A-C-C-C-A-U-C-C-C-G-A-A-C-A-C-G-G-A-A-G-A-U-A-A-G-C-C-C-G-C-C-U-G-C-G-U-U-C-C-G-G-U-C-A-G-U-A-C-U-G-G-A-G-U-G-C-G-A-G-C-C-U-C-U-G-G-G-A-A-A-U-C-C-G-G-U-U-C-G-C-C-G-C-C-U-A-C-U. This nucleotide sequence is the longest prokaryotic 5 S rRNA to be reported and unlike other 5 S species does not contain a terminal mononucleoside diphosphate residue at its 5'-end. When compared to other 5 S rRNA's, the sequence homology is greatest (about 68%) with Bacillus subtilis; there is a lower but similar degree of homology (about 58%) with either Escherichia coli or human 5 S RNA. The comparisons further indicate that among 5 S RNA's, eleven of the nucleotide residues are unique to H. cutirubrum. Estimates of the secondary structure of the H. cutirubrum 5 S RNA molecule contain one additional stable hairpin loop which is not found in other 5 S rRNA species; this unusual structure is probably an adaptation to the high salt environment within H. cutirubrum cells.     

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.     

Highly conserved 5S ribosomal RNA sequences in four rust fungi and atypical 5S rRNA secondary structure in Microstroma juglandis.

The 5S ribosomal RNA nucleotide sequences of five basidiomycetous fungi, Coleosporium tussilaginis , Gymnosporangium clavariaeforme , Puccinia poarum , Endophyllum sempervivi and Microstroma juglandis were determined. Despite high differentiation in their host spectra the four rust species are highly conserved with respect to their 5S rRna sequences, which fit with the basidiomycete cluster 5 described by Walker and Doolittle (1). The sequences obtained from the first three rust fungi were proven to be identical while the sequence from Endophyllum sempervivi showed two base substitutions compared with the other rust fungi. The Microstroma juglandis 5S rRNA sequence differs from all other basidiomycete 5S rRNA sequences published so far in respect to its secondary structure which shows an atypical 'CCA' loop in helix D, but it reveals typical basidiomycetous signature nucleotides. Therefore Microstroma juglandis represents a cluster of its own within the Basidiomycetes. A dendrogram was constructed based on Kimura's "Neutral Theory of Molecular Evolution".     

The nucleotide sequence of 5.8S rRNA from the posterior silk gland of the silkworm Philosamia cynthia ricini.

The nucleotide sequence of 5.8S rRNA from the Chinese silkworm Philosamia cynthia ricini has been determined by gel sequencing and mobility shift methods. The complete primary structure is (sequence in text). This is one of the largest known 5.8S rRNAs. As compared to Bombyx 5.8S rRNA, it is two nucleotides longer; two nucleotides near the 5'end and two nucleotides near the 3'end are different, and psi 61 of the Bombyx RNA sequence is an unmodified U in Philosamia RNA. The secondary structure of Philosamia 5.8S rRNA may differ from the Bombyx RNA structure by three additional base pairs at the 5'/3' ends.     

Generalized structures of the 5S ribosomal RNAs.

The sequences of 5S ribosomal RNAs from a wide-range of organisms have been compared. All sequences fit a generalized 5S RNA secondary structural model. Twenty-three nucleotide positions are found universally, i.e., in 5S RNAs of eukaryotes, prokaryotes, archaebacteria, chloroplasts and mitochondria. One major distinguishing feature between the prokaryotic and eukaryotic 5S RNAs is the number of nucleotide positions between certain universal positions, e.g., prokaryotic 5S RNAs have three positions between the universal positions PuU40 and G44 (using the E. coli numbering system) and eukaryotic 5S RNAs have two. The archaebacterial 5S RNAs appear to resemble the eukaryotic 5S RNAs to varying degrees depending on the species of archaebacteria although all the RNAs conform with the prokaryotic "rule" of chain length between PuU40 and G44. The green plant chloroplast and wheat mitochondrial 5S RNAs appear prokaryotic-like when comparing the number of positions between universal nucleotides. Nucleotide positions common to eukaryotic 5S RNAs have been mapped; in addition, nucleotide sequences, helix lengths and looped-out residues specific to phyla are proposed. Several of the common nucleotides found in the 5S RNAs of metazoan somatic tissue differ in the 5S RNAs of oocytes. These changes may indicate an important functional role of the 5S RNA during oocyte maturation.     

Nucleotide sequence of nuclear 5S RNA of mouse cells

The nucleotide sequence of nuclear 5S RNA of mouse cells was determined. The 5S RNA is 117 nucleotides long with one mole each of m₃^2,2,7G, Gm, Am and Cm, two moles of Um, and three moles of ψ as modified nucleosides, and it is rich in uridylate residues (about 36 %). The 5′-terminal hexanucleotide-containing cap structure, m₃^2,2,7GpppAm-Um-A-C-U-, is identical with that of U1 RNA. This RNA contains sequences complementary to the terminal sequences of the introns of heterogeneous nuclear RNAs.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Nucleotide sequence of Lactobacillus viridescens 5S RNA

The nucleotide sequence of Lactobacillus viridescens ATCC 12706 5S RNA was determined to be pU-G-U-U-G-U-G-A-U-G-A-U-G-G-C-A-U-U-G-A-G-G-U-C-A-C-A-C C-U-G-U-U-C-C-C-A-U-A-C-C-G-A-A-C-A-C-A-G-A-A-G-U-U-A-A-G-C-U-C-A-A-U-A-G-C-G C-C-G-A-A-A-G-U-A-G-U-U-G-G-A-G-G-A-U-C-U-C-U-U-C-C-U-G-C-G-A-G-G-A-U-A-G-G-A C-G-U-C-G-C-A-A-U-G-COH. When compared with other published sequences of prokaryotic 5S RNA species, this sequence shows as much homology with that from B. substilis (80% homology when all variations included) and B. megaterium (77% homology) as with the 5S RNA from another member of Lactobacillaceae family (L. brevis, 79% homology). The sequence contains the proposed tRNA binding site (CGAAC, positions 41-45) and can accomodate most, but not all, of the more recently proposed helical regions of secondary structure.     

The nucleotide sequences of 5S rRNAs from two red algae, Gracilaria compressa and Porphyra tenera

The nucleotide sequences of 5S rRNA from two red algae, Gracilaria compressa and Porphyra tenera have been determined. The two 5S rRNAs are fairly dissimilar to each other in their sequences (65% identity), although they are both composed of 121 nucleotides. Their secondary structures are generally of the eukaryotic with a prokaryotic characteristic. Judged from the 5S rRNA sequence data, the red algae are phylogenically distinct from green and brown algae, and they, Porphyra in particular, are evolutionally most ancient among the eukaryotes of which 5S rRNA sequence has been determined.