Plant small nuclear RNAs. Nucleolar U3 snRNA is present in plants: partial characterization

Nuclei, isolated from a number of plant species by either of two independent, newly developed methods, regularly contained a common set of low-molecular-mass RNAs. Partial characterization of these RNAs, based on cell fractionation, polyacrylamide gel electrophoretic and chemical sequencing techniques, as well as comparison with literature data, revealed that, in addition to tRNA, 5S RNA and 5.8S RNA, plant nuclei contain two families of low-molecular-mass RNAs, that are counterparts of vertebrate U1 and U5 RNAs respectively, and three individual low-molecular-mass RNA species. One of these may be related to vertebrate U6 RNA. The two others are true eukaryotic U2 and U3 RNAs, respectively, on the basis of the following lines of evidence obtained from analyses of broad bean nuclear RNAs. The 3'-end portion (121 nucleotides sequenced) of broad bean U2 RNA shows a nearly perfect sequence homology with that of authentic pea U2 RNA. Broad bean U3 RNA is localized in the nucleolus and its 3'-end portion (164 nucleotides sequenced) (a) shows sequence homology with that of both rat U3 RNA (48%) and Dictyostelium D2 RNA (39%), (b) has a secondary structure which fits perfectly that proposed for both rat U3 RNA and Dictyostelium D2 RNA, and (c) contains the specific sequence which, in a model based on the primary structure of rat U3 RNA, is supposed to be involved in the processing of eukaryotic 32S pre-ribosomal RNA. This is the first report on the occurrence in plants of nucleolar U3 RNA.     

Nucleotide sequence relationships between vertebrate 5.8 S ribosomal RNAs.

Nucleotide sequences of the 5.8 S ribosomal RNAs from HeLa cells, Xenopus laevis and chick embryo fibroblasts were compared. Xenopus laevis 5.8 S RNA differs from that of HeLa cells in four internal positions and at the 3' end of the molecule. Chick 5.8 S RNA differs from that of HeLa cells in two positions. Six out of the seven interspecies differences are due to base substitutions. The other difference is due to the presence of an extra nucleotide, internally located, within the Xenopus 5.8 S sequence.     

Analysis of large specific T1 oligonucleotides of 17S and 25S ribosomal RNAs from Saccharomyces cerevisiae.

The primary structure of 17S and 25S ribosomal RNAs from Saccharomyces cerevisiae has been analysed by two-dimensional fractionation of T1 oligonucleotides. This method consists of an electrophoresis at pH 3.5 followed by a homochromatography on DEAE-cellulose plates. After the second dimension, the large T1 oligonucleotides were hydrolyzed by pancreatic RNAse, followed by alkaline hydrolysis of the pancreatic products. By fractionating a mixture of tritiated HeLa cell ribosomal RNAs and 32 P yeast cell ribosomal RNAs, two autoradiographs were obtained; one corresponding to the 32P labelled material and the other to the tritiated labelled material. By superposition of the two autoradiographs, the mobility of the various T1 oligonucleotides can be accurately compared and it is shown that yeast 17S rRNA and human 18S rRNA have in common 5 large oligonucleotides and that yeast 25S rRNA and human 28S rRNA have 4 identical oligonucleotides.     

High evolutionary conservation of the secondary structure and of certain nucleotide sequences of U5 RNA.

The nucleotide sequence of chicken, pheasant, duck and Tetrahymena pyriformis U5 RNAs as well as that of new mammalian variant U5 RNAs was determined and compared to that of rat and HeLa cells U5 RNAs. Primary structure conservation is about 95% between rat and human cells, 82% between mammals and birds and 57% between the Protozoan and mammals. The same model of secondary structure, a free single-stranded region flanked by two hairpins can be constructed from all RNAs and is identical to the model previously proposed for mammalian U5 RNA on an experimental basis (1). Thus, this model is confirmed and is likely to be that of an ancestor U5 RNA. The 3' region of the U5 RNA molecule constitutes domain A, and is common to U1, U2, U4 and U5 RNAs (2). The characteristic nucleotide sequences of domain A are highly conserved throughout the phylogenetic evolution of U5 RNA suggesting that they are important elements in the function of the four small RNAs. Another region of high evolutionary conservation is the top part of the 5' side hairpin whose conserved sequence is specific to U5 RNA. It might participate in the particular function of U5 RNA.     

Herpesvirus saimiri U RNAs are expressed and assembled into ribonucleoprotein particles in the absence of other viral genes.

Marmoset T lymphocytes transformed by herpesvirus saimiri contain a set of five virally encoded U RNAs called HSUR1 through HSUR5. HSUR genes have been individually transfected into a nonlymphoid, nonsimian cell line (HeLa cells) in the absence of any other coding regions of the herpesvirus saimiri genome. The levels of HSUR1 through HSUR4 in HeLa transient-expression systems are comparable to those found in virally transformed T cells (23 to 91%). In contrast, HSUR5 is expressed at ninefold-higher levels in transfected HeLa cells. Immunoprecipitation experiments show that HSURs expressed in transfected cells bind proteins with Sm determinants and acquire a 5' trimethylguanosine cap structure, as they do in transformed T cells. HSUR1 or HSUR4 particles from transfected HeLa cells migrate between 10S and 15S in velocity gradients, identical to the sedimentation of "monoparticles" produced in virally transformed lymphocytes. We conclude from these transfection experiments that no other herpesvirus saimiri or host-cell-specific gene products appear to be required for efficient expression of the HSUR genes or for subsequent assembly of the viral U RNAs into small nuclear ribonucleoprotein particles. In lymphocytes transformed by herpesvirus saimiri, HSUR small nuclear ribonucleoprotein particles are involved in higher-order complexes that sediment between 20S and 25S. HSUR1, HSUR2, and HSUR5 dissociate from such complexes upon incubation at 30 degrees C, whereas the complex containing HSUR4 is stable to incubation.     

Phylogeny of the 5S ribosomal RNA from Synechococcus lividus II: the cyanobacterial/chloroplast 5S RNAs form a common structural class

The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacterium Synechococcus lividus II has been determined. The sequence is (sequence in text) This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA of S. lividus II has 27 base differences compared with the 5S RNA of the related strain S. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs from S. lividus II, S. lividus III, and spinach chloroplasts are identical, but differ considerably from that of Escherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA of E. coli and these cyanobacterial and chloroplast 5S RNAs.     

Isolation and characterization of two linked mouse U1b small nuclear RNA genes.

A 6.9 kilobase Eco R1 fragment containing genes for two U1 RNAs has been isolated from a library of mouse DNA. The two genes code for an RNA which is very similar, if not identical, to mouse U1b RNA as judged by S1 nuclease mapping. This RNA is one base longer than the mouse U1a RNA, human U1 RNA, and rat U1 RNA and differs in six nucleotide substitutions from rat U1 RNA. The two genes are five kilobases apart and the U1 RNAs are coded for on opposite strands of the DNA with the 5' ends juxtaposed. The sequences flanking the genes are identical for 700 bases 5' to the gene and at least 80 bases 3' to the gene.     

Structural studies of 5 S ribosomal RNAs from a thermophilic fungus, Thermomyces lanuginosus. A comparison of generalized models for eukaryotic 5 S RNAs

The cytoplasmic ribosomes of the thermophilic fungus Thermomyces lanuginosus contain two types of 5 S RNA. The nucleotide sequence for approximately 80% of the molecules is (pp)pA-C-A-U-G-C-G-A-C-C-A-U-A-G-G-G-U-G-U-G-G-A-A-A-A-C-A-G-G-G-C-U-U-C-C-C-G-U-C-C-G-C-U-C-A-G-C-C-G-U-A-C-U-U-A-A-G-C-C-A-C-A-C-G-C-C-G-G-C-U-G-G-U-U-A-G-U-A-G-U-U-G-G-G-U-G-G-G-U-G-A-C-C-A-C-C-A-G-C-G-A-A-U-C-C-C-A-G-C-U-G-U-U-G-C-A-U-G-UOH. The remainder contains two nucleotide substitutions, C19 and G60, which preserve base complementarity. The secondary structure was probed using partial T1, pancreatic, and S1 nuclease digestion under a variety of ionic and temperature conditions and fragments were analyzed by rapid gel sequencing techniques. The results support the Y-shaped secondary structure model originally proposed by Nishikawa, K., and Takemura, S. (1974) FEBS Lett. 40, 106-109, for eukaryotic 5 S RNAs. When the thermal denaturation profile was compared with that of the yeast 5 S RNA, the thermophilic RNA exhibited not only a higher Tm but also an unusual decline in absorbency at moderate temperatures. This suggests that a functionally important structure may be maintained only at higher temperatures.     

Prevalence of syn nucleobases in the active sites of functional RNAs

Biological RNAs, like their DNA counterparts, contain helical stretches, which have standard Watson-Crick base pairs in the anti conformation. Most functional RNAs also adopt geometries with far greater complexity such as bulges, loops, and multihelical junctions. Occasionally, nucleobases in these regions populate the syn conformation wherein the base resides close to or over the ribose sugar, which leads to a more compact state. The importance of the syn conformation to RNA function is largely unknown. In this study, we analyze 51 RNAs with tertiary structure, including aptamers, riboswitches, ribozymes, and ribosomal RNAs, for number, location, and properties of syn nucleobases. These RNAs represent the set of nonoverlapping, moderate- to high-resolution structures available at present. We find that syn nucleobases are much more common among purines than pyrimidines, and that they favor C2'-endo-like conformations especially among those nucleobases in the intermediate syn conformation. Strikingly, most syn nucleobases participate in tertiary stacking and base-pairing interactions: Inspection of RNA structures revealed that the majority of the syn nucleobases are in regions assigned to function, with many syn nucleobases interacting directly with a ligand or ribozyme active site. These observations suggest that judicious placement of conformationally restricted nucleotides biased into the syn conformation could enhance RNA folding and catalysis. Such changes could also be useful for locking RNAs into functionally competent folds for use in X-ray crystallography and NMR.     

Oocyte and somatic 5S ribosomal RNA and 5S RNA encoding genes in Xenopus tropicalis.

We have investigated the structure of oocyte and somatic 5S ribosomal RNA and of 5S RNA encoding genes in Xenopus tropicalis. The sequences of the two 5S RNA families differ in four positions, but only one of these substitutions, a C to U transition in position 79 within the internal control region of the corresponding 5S RNA encoding genes, is a distinguishing characteristic of all Xenopus somatic and oocyte 5S RNAs characterized to date, including those from Xenopus laevis and Xenopus borealis. 5S RNA genes in Xenopus tropicalis are organized in clusters of multiple repeats of a 264 base pair unit; the structural and functional organization of the Xenopus tropicalis oocyte 5S gene is similar to the somatic but distinct from the oocyte 5S DNA in Xenopus laevis and Xenopus borealis. A comparative sequence analysis reveals the presence of a strictly conserved pentamer motif AAAGT in the 5'-flanking region of Xenopus 5S genes which we demonstrate in a separate communication to serve as a binding signal for an upstream stimulatory factor.     

New U1 RNA species found in Friend SFFV (spleen focus forming virus)-transformed mouse cells

The U1 RNA species in 10 mouse cell lines were examined by two-dimensional polyacrylamide gel electrophoresis. Seven cell lines that were not infected by Friend spleen focus forming virus gave only one (I) or two (I and II) U1 RNA-containing spots. However, two Friend cell lines (FVTCT and Friend 745a cells) gave three spots (I, II, and III) and another Friend cell line, K-1 cells, gave four spots (I, II, III, and IV). As a result of further separation and fingerprinting analysis of each spot, FVTCT and Friend 745a cells were found to contain U1a-1, U1b-1, -2, and -6 RNAs whereas K-1 cells were found to contain several U1 RNAs, which we call U1a-1 and -2, U1b-4, -5, and -6 RNAs. We determined the sequences of these seven U1 RNAs and found that mouse U1 RNAs had two basic sequences (U1a and -b). The nucleotide sequence of U1a-1 RNA was identical to that of rat U1a RNA, while U1a-2 RNA was one base different from U1a-1 RNA. Relative to U1a-1 RNA all of the U1b RNAs had five base substitutions and one additional base and were under-methylated in the center. U1b-6 RNA contained two base substitutions and one base addition in the 3'-terminal portion of U1b-1 RNA. U1b-2, -4, and -5 RNAs, which were observed only in Friend cells, each had an additional base substitution in the 5'-half of U1b-1 RNA.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Construction and functional analysis of ribosomal 5S RNA from Escherichia coli with single base changes in the ribosomal protein binding sites

The ribosomal 5S RNA gene from E. coli was altered by oligonucleotide-directed mutagenesis at positions A66 and U103. The mutant genes were cloned into an expression vector and selectively transcribed in an UV-sensitive E. coli strain using a modified maxicell system. The mutant 5S RNA genes were found to be transcribed and processed normally. The 5S RNA molecules were assembled into 50S ribosomal subunits. Under in vitro conditions the stability of the mutant 70S ribosomes seemed, however, to be reduced, since they dissociated into their subunits more easily than those of the wild type. The isolated mutated 5S RNAs with base changes in the ribosomal protein binding sites for L18 and L25, together with a point mutant at G41 (G to C), constructed earlier, were tested for their capacity to bind the 5S RNA binding proteins L5, L18 and L25. The following effects were observed: The base change A66 to C within the L18 binding site did not affect the binding of the ribosomal protein L18 but enhanced the stability of the L25-5S RNA complex considerably. The base changes U103 to G and G41 to C slightly reduced the binding of L5 and L25 whereas the binding of L18 to the mutant 5S RNAs was not altered. In addition 70S ribosomes with the single point mutations in their 5S RNAs were tested in their tRNA binding capacity. Mutants containing a C41 in their 5S RNA showed a reduction in the poly(U)-dependent Phe-tRNA binding, whereas the mutations to C66 and G 103 lead to completely inactive ribosomes in the same assay. Based on previous results a spatial model of the 5S RNA molecule is presented which is consistent with the findings reported in this paper.     

Two 5S genes are expressed in chicken somatic cells.

Two 5S RNA species were detected in chicken cells. 5S I RNA has the nucleotide sequence of chicken 5S RNA previously published by Brownlee et al. (1) and 5S II RNA differs from it by 10 mutations. The secondary structure of both species is compatible with that proposed for other eukaryotic 5S RNAs. 5S II RNA represents 50-60% of 5S I RNA. Both species were found in total chicken liver and brain and were present in polysomes in the same relative proportions. Only one 5S RNA species could be detected in rat liver and HeLa cells. Chicken is the first vertebrate described so far in which two 5S RNA genes are expressed in somatic cells.