trans-acting factors affecting carbon catabolite repression of the hut operon in Bacillus subtilis

In Bacillus subtilis, CcpA-dependent carbon catabolite repression (CCR) mediated at several cis-acting carbon repression elements (cre) requires the seryl-phosphorylated form of both the HPr (ptsH) and Crh (crh) proteins. During growth in minimal medium, the ptsH1 mutation, which prevents seryl phosphorylation of HPr, partially relieves CCR of several genes regulated by CCR. Examination of the CCR of the histidine utilization (hut) enzymes in cells grown in minimal medium showed that neither the ptsH1 nor the crh mutation individually had any affect on hut CCR but that hut CCR was abolished in a ptsH1 crh double mutant. In contrast, the ptsH1 mutation completely relieved hut CCR in cells grown in Luria-Bertani medium. The ptsH1 crh double mutant exhibited several growth defects in glucose minimal medium, including reduced rates of growth and growth inhibition by high levels of glycerol or histidine. CCR is partially relieved in B. subtilis mutants which synthesize low levels of active glutamine synthetase (glnA). In addition, these glnA mutants grow more slowly than wild-type cells in glucose minimal medium. The defects in growth and CCR seen in these mutants are suppressed by mutational inactivation of TnrA, a global nitrogen regulatory protein. The inappropriate expression of TnrA-regulated genes in this class of glnA mutants may deplete intracellular pools of carbon metabolites and thereby result in the reduction of the growth rate and partial relief of CCR.     

Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.     

Role of CodY in regulation of the Bacillus subtilis hut operon.

Bacillus subtilis mutants deficient in amino acid repression of the histidine utilization (hut) operon were isolated by transposon mutagenesis. Genetic characterization of these mutants indicated that they most likely contained transposon insertions within the codVWXY operon. The codY gene is required for nutritional regulation of the dipeptide permease (dpp) operon. An examination of hut expression in a delta codY mutant demonstrated that amino acid repression exerted at the hutOA operator, which lies immediately downstream of the hut promoter, was defective in a delta codY mutant. The codY gene product was not required for amino acid regulation of either hut induction or the expression of proline oxidase, the first enzyme in proline degradation. This indicates that more than one mechanism of amino acid repression is present in B. subtilis. An examination of dpp and hut expression in cells during exponential growth in various media revealed that the level of CodY-dependent regulation appeared to be related to the growth rate of the culture.     

Isolation of super-repressor mutants in the histidine utilization system of Salmonella typhimurium.

Two super-repressor mutations in the histidine utilization (hut) operons of Salmonella typhimurium are described. Cells bearing either of these mutations have levels of hut enzymes that do not increase above the uninduced levels when growth is in the presence of either histidine or the gratuitous inducer imidazole propionate. Both mutations lie in the region of the gene for the hut repressor, hutC, and reverse mutations of both are to the constitutive (repressor-negative) rather than to the inducible (wild type) phenotype. In hybrid merodiploid strains the super-repressor mutations are dominant over either wild-type (hutC+) or repressor-negative (hutC-) alleles. Whereas both super-repressor mutations cause the uninducible synthesis of hut enzymes, the degree of repression is different. One mutation causes repression of enzyme synthesis in one of the two hut operons to a level below the basal, uninduced level of wild-type cells. The other mutation causes repression to a lesser degree than in wild-type cells, so that the hut enzymes are present at a level above the normal basal level; this partially constitutive synthesis is greater for the enzymes of one of the hut operons than for the enzymes of the other. Thus, both mutations apparently result in repressors with altered operator-binding properties, in addition to altered inducer-binding properties.     

Bacillus subtilis glutamine synthetase mutants pleiotropically altered in glucose catabolite repression.

Strain SF22, a glutamine-requiring (Gln-) mutant of Bacillus subtilis SMY, is likely to have a mutation in the structural gene for glutamine synthetase, since this strain synthesized 22 to 55% as much glutamine synthetase antigen as did wild-type cells in a 10-min period but had less than 3% of wild-type glutamine synthetase enzymatic activity. The expression of several genes subject to glucose catabolite repression was altered in the Gln- mutant. The induced levels of alpha-glucosidase, histidase, and aconitase were 3.5- to 4-fold higher in SF22 cells than in wild-type cells grown in glucose-glutamine medium, and citrate synthase levels were 8-fold higher in the Gln- mutant than in wild-type cells. The relief of glucose catabolite repression in the Gln- mutant may result from poor utilization of glucose. Examination of the intracellular metabolite pools of cells grown in glucose-glutamine medium showed that the glucose-6-phosphate pool was 2.5-fold lower, the pyruvate pool was 4-fold lower, and the 2-ketoglutarate pool was 2.5-fold lower in the Gln- cells than they were in wild-type cells. Intracellular levels of glutamine were sixfold higher in the Gln- mutant than in wild-type cells. Measurements of enzymes involved in glutamine transport and utilization showed that the elevated pools of glutamine in the Gln- mutant resulted from a threefold increase in glutamine permease and a fivefold decrease in glutamate synthase. The pleiotropic effect of the gln-22 mutation on the expression of several genes suggests that either the glutamine synthetase protein or its enzymatic product, glutamine, is involved in the regulation of several metabolic pathways in B. subtilis.     

Effects of anaerobiosis and nitrate on the expression of succinate dehydrogenase and enzymes associated with nitrogen metabolism in Klebsiella pneumoniae

We have shown that the low histidase activity found in anaerobic, nitrogen-limited cultures of Klebsiella pneumoniae is due to repression of the right-hand hut operon. In addition, we have examined the effects of NO3- on the aerobic and anaerobic expression of catabolite- and NH4+-repressible enzymes in this organism. NO3- permitted anaerobic growth of K. pneumoniae in minimal medium containing histidine as the sole carbon source, and histidase and succinate dehydrogenase were derepressed during anaerobic growth in histidine/NO3- medium. Use of sucrose rather than histidine as the carbon source reversed the effects of NO3- and repressed histidase and succinate dehydrogenase activities. Anaerobic growth in sucrose/NO3- medium also uncoupled the expression of urease and glutamine synthetase.     

Regulation of hut enzymes and intracellular protease activities in Vibrio alginolyticus hut mutants

The production of alkaline protease, collagenase and histidine utilization (Hut) enzymes by Vibrio alginolyticus wild-type, hutH1 and hutU1 strains was investigated. Alkaline protease synthesis was stimulated by histidine and urocanic acid in the wild-type and hutU1 strains. The hutH1 mutant alkaline protease production was stimulated by urocanic acid and not by histidine. The Hut enzymes in the wild-type strain were coordinately induced by histidine. Urocanase and formimino-hydrolase were induced by histidine in the hutH1 mutant which lacked histidase and was not able to convert histidine to urocanic acid. Collagenase production in peptone medium was inhibited in the hut mutants. It is concluded that in V. alginolyticus urocanic acid regulates alkaline protease synthesis but that the Hut enzymes are induced by histidine. The involvement of the Hut genetic system in the regulation of alkaline protease and collagenase synthesis is discussed.     

2-Ketoglutarate and the regulation of aconitase and histidase formation in Bacillus subtilis.

In contrast to wild-type cells, the Bacillus subtilis mutant SF109 that lacks the active 2-ketoglutarate dehydrogenase enzymatic complex is unable to increase the specific activity of two enzymes subject to glucose catabolite repression, aconitase and histidase, during limitation of growth by glucose. Examination of the intracellular metabolite pools in the mutant and wild-type cells grown in excess and limiting glucose medium showed that the complete derepression of aconitase and histidase could be correlated with the decrease in the intracellular concentration of 2-ketoglutarate. The complete repression of aconitase that occurred in wild-type and mutant cells could be correlated with a high intracellular concentration of 2-ketoglutarate.     

Properties of a Bacillus subtilis mutant able to sporulate continually during growth in synthetic medium

Several mutants of Bacillus subtilis were isolated which sporulate continually during exponential growth in glucose medium. The spdA1 mutation, responsible for the continual sporulation of one of the mutants, mapped near thr. When an exponentially growing culture of a strain containing spdA1 was maintained at essentially constant turbidity, 5% of the viable cells contained heat-resistant spores. The continual sporulation depended on the stringent response since it was absent in spdA relA double mutants. Genetic and biochemical analysis indicated that the continual sporulation of spdA1 strains was associated with a lower specific activity of pyruvate carboxylase, which limited the rate of oxaloacetate synthesis from glucose via pyruvate and thereby the supply of compounds depending on the citrate cycle, especially aspartate. Therefore, the mild stringent response caused by the spdA1 mutation seems to result from a partial deficiency of aspartyl-tRNA which may exert its sporulation-initiating effect during a limited time interval in each growth cycle. A mutant blocked in fumarase activity (citG) behaved similarly. It grew only slowly in glucose medium because much of the limiting oxaloacetate was wasted for the excretion of fumarate. The mutant produced little aspartate and sporulated at a high frequency in glucose medium, even in the presence of glutamate; the sporulation was again prevented by aspartate or malate or by introduction of the relA marker into the strain.     

The effect of nitrogen limitation on catabolite repression of amidase, histidase and urocanase in Pseudomonas aeruginosa.

In Pseudomonas aeruginosa, the synthesis of histidase, urocanase and amidase is severly repressed when succinate is added to a culture growing in pyruvate + ammonium salts medium. When growth is nitrogen-limited, catabolite repression by succinate of histidase and urocanase synthesis does not occur but succinate repression of amidase synthesis persists. Amidase synthesis is not regulated in the same way as histidase synthesis by the availability of other nitrogen compounds for growth. Growth of P. aeruginosa strain PACI in succinate + histidine media is nitrogen-limited since this strain is defective in a histidine transport system. When methyl-ammonium chloride is added to succinate + histidine media, growth inhibition occurs. Mutants isolated from succinate + histidine + methylammonium chloride plates were found to be resistant to catabolite repression by succinate even in ammonium salts media. It is suggested that the hut genes of P. aeruginosa may be regulated in the same way as in Klebsiella aerogenes, by induction by urocanate and activation by either the cyclic AMP-dependent activator protein or by glutamine synthetase.     

Effect of molecular hydrogen on histidine utilization by Alcaligenes eutrophus

The effect of molecular hydrogen on heterotrophic metabolism of the facultative chemolithoautotrophic bacterium Alcaligenes eutrophus strain H 16 was representatively investigated on histidine utilization. The presence of hydrogen in a histidine or urocanate-containing medium had two effects (i) growth of the cells was inhibited, and (ii) formation of histidase was repressed. Both effects were relieved by supplying the cells with exogenous carbon dioxide. Studies on mutants defective in chemolithoautotrophic metabolism revealed that growth inhibition by hydrogen was exclusively mediated by the catalytic function of the soluble hydrogenase. Mutants containing only particulate hydrogenase activity did not exhibit growth inhibition. Repression of histidase formation, however, was mediated by the catalytic activity of the soluble as well as the particulate hydrogenase. Unexpectedly, mutants defective in autotrophic carbon dioxide fixation but unaffected in hydrogen oxidation showed an inhibition of growth by hydrogen but no repression of histidase synthesis. Mutants which formed histidase constitutively were still sensitive to repression in the presence of hydrogen. The results indicate that repression of enzyme synthesis by hydrogen is dependent on the function of both, the hydrogen-oxidizing and the carbon dioxide-fixing system. It is concluded that the hydrogen effect is a transient regulatory mechanism and only relevant for unbalanced conditions of growth.     

Cascading regulation of histidase activity in Streptomyces griseus.

Mutants of Streptomyces griseus unable to utilize histidine as the sole nitrogen source have been isolated and characterized. Using a mutant defective in the production of histidase, we have demonstrated that urocanate functions as the inducer of the histidine utilization system. Another mutant produced histidase that was locked in an inactive form but could be activated by treatment with an extract from the wild-type strain or the histidase-negative strain. This mutant was deficient in the activity of a protein of Mr ca. 90,000 to 100,000 that is required for the activation of histidase. Histidase was synthesized constitutively but was maintained in an inactive form until after histidine or urocanate was added to the medium. At least four components were implicated in the activation of histidase: histidase, the activation protein, urocanate, and a phosphatase that is apparently inactive in cells grown without inducer. The functions of the last three factors could be supplanted in vitro by incubation of histidase with snake venom phosphodiesterase or 5' nucleotidase. The results suggest that histidine utilization by S. griseus is controlled posttranslationally by an activation cascade that involves at least two regulatory proteins.     

Biosynthesis of prodigiosin by non-proliferating wild-type Serratia marcescens and mutants deficient in catabolism of alanine, histidine, and proline.

Mutants of Serratia marcescens Nima, designated as Aut, Hut, or Put, did not utilize L-alanine, L-histidine, or L-proline, respectively, as a sole carbon source but did utilize other amino acids or glycerol as carbon sources. The bacteria were permeable to alanine, histidine, and proline but lacked the enzymes responsible for degradation of these amino acids. The Aut mutant contained no L-alanine dehydrogenase activity, whereas the Hut and Put mutants contained only 7 and 4% of the histidase and proline oxidase activities, respectively, found in the wild-type strain. Rates of oxygen uptake and protein synthesis were significantly lower when the mutants were incubated in the presence of amino acids they could not degrade. Studies of L-[14C]alanine, L-[14C]histidine, and L-[14C]proline incorporation into prodigiosin synthesized by these mutants and the wild-type strain revealed that proline was incorporated intact, whereas all of alanine except the carboxyl group was incorporated into the pigment molecule. Histidine did not enter prodigiosin directly. These data suggested that the presence of unique biosynthetic pathways, independent of primary metabolism, leads to formation of prodigiosin from specific amino acids.     

A mutation in the 3-phosphoglycerate kinase gene allows anaerobic growth of Bacillus subtilis in the absence of ResE kinase

The Bacillus subtilis ResD-ResE two-component signal transduction system is essential for aerobic and anaerobic respiration. A spontaneous suppressor mutant that expresses ResD-controlled genes and grows anaerobically in the absence of the ResE histidine kinase was isolated. In addition, aerobic expression of ResD-controlled genes in the suppressed strain was constitutive and occurred at a much higher level than that observed in the wild-type strain. The suppressing mutation, which mapped to pgk, the gene encoding 3-phosphoglycerate kinase, failed to suppress a resD mutation, suggesting that the suppressing mutation creates a pathway for phosphorylation of the response regulator, ResD, which is independent of the cognate sensor kinase, ResE. The pgk-1 mutant exhibited very low but measurable 3-phosphoglycerate kinase activity compared to the wild-type strain. The results suggest that accumulation of a glycolytic intermediate, probably 1, 3-diphosphoglycerate, is responsible for the observed effect of the pgk-1 mutation on anaerobiosis of resE mutant cells.