Binding of Bis-linked Netropsin Derivatives in the Parallel-Stranded Hairpin Form to DNA

Abstract

Cis-diammine Pt(II)- bridged bis-netropsin and oligomethylene-bridged bis-netropsin in which two monomers are linked in a tail-to-tail manner bind to the DNA oligomer with the sequence 5′-CCTATATCC-3′ in a parallel-stranded hairpin form with a stoichiometry 1:1. The difference circular dichroism (CD) spectra characteristic of binding of these ligands in the hairpin form are similar. They differ from CD patterns obtained for binding to the same duplex of another bis-netropsin in which two netropsin moieties were linked in a head-to-tail manner. This reflects the fact that tail-to-tail and head-to-tail bis-netropsins use parallel and antiparallel side-by-side motifs, respectively, for binding to DNA in the hairpin forms. The binding affinity of cis -diammine Pt(II)- bridged bis-netropsin in the hairpin form to DNA oligomers with nucleotide sequences 5′-CCTATATCC-3′ (I), 5′-CCTTAATCC-3′ (II), 5′-CCTTATTCC-3′ (III), 5′-CCTTTTTCC-3′ (IV) and 5′-CCAATTTCC-3′ (V) decreases in the order I = II > III > IV> V. The binding of oligomethylene-bridged bis-netropsin in the hairpin form follows a similar hierarchy. An opposite order of sequence preferences is observed for partially bonded monodentate binding mode of the synthetic ligand.     

Effect of DNA local conformation on the affinity and binding specificity of bis-netropsins to DNA

The interaction of short nucleotide duplexes with bis-netropsins, in which netropsin fragments are linked in the tail-to-tail orientation via cis-diammineplatinum group (<--Nt-Pt(NH3)-Nt-->) or aliphatic pentamethylene chain (<--Nt-(CH2)5-Nt-->), has been studied. Both the bis-netropsins have been shown to bind to DNA oligomer 5'-CCTATATCC-3' (I) as a hairpin with parallel orientation of netropsin fragments in 1:1 stoichiometry. Monodentate binding has been detected upon binding of bis-netropsins to other duplexes of sequences 5'-CCXCC-3'--where X = TTATT (II), TTAAT (III), TTTTT (IV), and AATTT (V)--along with the binding of bis-netropsins as a hairpin. The formation of dimeric antiparallel motif between the halves of two bound bis-netropsin molecules has been observed in the complexes of <--Nt-(CH2)5-Nt--> with DNA oligomers IV and V. The ratio of binding constant of bis-netropsin as a hairpin (K2) to monodentate binding constant (K1) has been shown to correlate with the width and/or conformational lability of DNA in the binding site. The share of bis-netropsin bound as a hairpin decreases in the order: TATAT > TTATT > TTAAT > TTTTT > AATTT, whereas the contribution of monodentate binding rises. The minimal strong binding site for <--Nt-Pt(NH3)-Nt--> and <--Nt-(CH2)5-Nt--> binding as a hairpin has been found to be DNA duplex 5'-CGTATACG-3'.     

Hairpin Polyamides That use Parallel and Antiparallel Side-by-Side Peptide Motifs in Binding to DNA

Abstract

Pt-bis-netropsin is a synthetic sequence-specific DNA-binding ligand comprizing two netropsin-like fragments which are linked in a tail-to-tail manner via a cis-diammineplat-inum (II) residue. The CD studies and thermodynamic characterization of the DNA-binding properties exhibited by this compound reveal that it forms two types of complexes with poly[d(AT)]?poly[d(AT)] and DNA oligomers containing nucleotide sequences 5′-CC (TA)_nCC-3′, with n = 4, 5 and 6. The first type corresponds to the binding of Pt-bis-netropsin in the extended conformation and is characterized by the saturating ratio of one bound Pt-bis-netropsin molecule per 9 AT-base pairs. The second type of the complex corresponds to the binding of Pt-bis-netropsin to DNA in the folded hairpin form. The binding approaches saturation level when one Pt-bis-netropsin molecule is bound per four or five AT-base pairs. The hairpin form of Pt-bis-netropsin complex is built on the basis of parallel side-by-side peptide motif which is inserted in the minor DNA groove. The CD spectral profiles reflecting the binding of Pt-bis-netropsin in the hairpin form are different from those observed for binding of another bis-netropsin with the sequence Lys-Gly-Py-Py-Gly-Gly-Gly-Py-Py-Dp, where Py is a N-propylpyrrole amino acid residue and Dp is a dimethylaminopropylamino residue. The hairpin form of this bis-netropsin is formed on the basis of antiparallel side- by-side peptide motif. The CD spectra obtained for complexes of this polyamide in the hairpin form with poly[dAT)]?poly[d(AT)] exhibit positive CD band with a peak at 325 nm, whereas the CD spectral profiles for the second complex of Pt-bis-Nt with poly[d(AT)] ?poly[d(AT)] and short DNA oligomers have two intense positive CD bands near 290 nm and 328 nm. This reflects the fact that two bis-netropsins use different structural motifs on binding to DNA in the hairpin form.     

Synthetic DNA-bindings ligands containing reaction centers specific for AT- and GC-pairs in DNA

In the present communication design, synthesis and DNA binding activities of three bis-netropsins and two netropsin analogs containing two N-propylpyrrolecarboxamide fragments linked covalently to peptides Gly-Gly-(analog I) and Val-Val-Val-Gly-Gly-(analog II) are reported. Each bis-netropsin consists of two netropsin-like fragments attached to peptides -Gly-Cys-Gly-NH2 (compound IIIa), H-Gly-Cys-Gly-Gly-Gly-(compound IV) or Gly-Cys-Sar-NH2 (compound IIIb) which are linked symmetrically via S-S bonds. Physico-chemical studies show that each bis-netropsin carries 6 AT-specific reaction centers and covers approximately 10 base pairs upon binding to poly(dA).poly(dT). This indicates that two netropsin-like fragments of the bis-netropsin molecule are implicated in specific interaction with DNA base pairs. The peptide fragments of bis-netropsins IIIa and IV form small beta-sheets containing two-GC-specific reaction centers. The DNase I cleavage patterns of bis-netropsin-DNA complexes visualized by high resolution gel electrophoresis show that the preferred binding sites for bis-netropsins IIIa and IV are identical and contain two runs of three or more AT pairs separated by two GC pairs. Specificity determinants of netropsin analog II binding in the beta-associated dimeric form are identical to those of bis-netropsin IIIa thereby indicating that there is a similarity in the structure of complexes formed by these ligands with DNA. In the monomeric form analog II exhibits binding specificity identical to that of analog I. Replacement of C-terminal glycine residues by sarcosines in the peptide fragments of bis-netropsin IIIa leads to a decrease in the affinity of ligand for DNA.     

DNA-Binding activity of bis-netropsin containing a cis-diaminoplatinum group between two netropsin fragments

The binding of Pt-bis-Nt and its modified analog Pt*-bis-Nt, which has two additional glycine residues in the linker between two netropsin fragments, to DNA has been studied. The elongation of the linker in the bis-netropsin molecule increases the cytotoxicity and leads to an almost complete loss of the antiherpetic activity of bis-netropsin. The study of the binding of two bis-netropsins to an oligonucleotide duplex containing an AT cluster, which is present at the origin of replication of herpes virus (OriS), revealed significant structural differences between the complexes of bis-netropsins with this DNA oligomer. It was shown by CD spectroscopy that the binding of Pt-bis-Nt in the extended conformation and in hairpin form with the parallel orientation of two bis-netropsin fragments makes a greater contribution to the interaction with the duplex than in the case of Pt*-bis-Nt. At high binding levels, Pt*-bis-Nt binds to the AT cluster in OriS predominantly in the form of associates based on the antiparallel, double-stranded, pyrrolcarboxyamide motif. The interaction of Pt-bis-Nt and Pt*-bis-Nt with a single-stranded oligonuclotide (64 nt) corresponding to the upper strand at the origin of replication of herpes virus (OriS*) was also studied. Substantial differences in the binding of bis-netropsins to OriS* and the thermostability of the resulting complexes were found by CD spectroscopy and UV melting studies.     

DNA-binding activity of bis-netropsins containing a cis-diaminoplatinum group between two netropsin fragments

The binding to DNA of Pt-bis-Nt and its modified analogue (Pt*-bis-Nt), which differs from Pt-bis-Nt by the fact that the connecting chain between two netropsin fragments contains two additional glycine residues, has been studied. Elongating the chain in the bis-netropsin molecule increases the cytotoxicity and leads to a complete disappearance of the antiherpetic activity of bis-netropsin. A study of the binding of two bis-netropsins with the oligonucleotide duplex containing an AT cluster, which is present at the replication initiation site of herpes virus (OriS), revealed significant structural differences between complexes of bis-netropsins with this DNA oligomer. It was shown by CD spectroscopy that the binding of Pt-bis-Nt in the elongated conformation and in the form of a hair-pin with the parallel orientation of two bis-netropsin fragments makes a greater contribution than it is the case in the complex formation with Pt*-bis-Nt. At high binding rates, Pt*-bis-Nt binds to the AT cluster in OriS predominantly in the form of associates based on the antiparallel double-stranded pyrrolcarboxyamide motif. The interaction of Pt-bis-Nt and Pt*-bis-Nt with the single-stranded oligonucleotide (64 nt), which corresponds to the upper strand at the replication initiation site of herpes virus (OriS*), was also studied. Substantial differences in the binding of bis-netropsins with OriS* and thermostability of the resulting complexes were found by CD spectroscopy and by studying the melting of complexes of bis-netropsins with OriS*.     

Modulation of platinum antitumor drug binding to DNA by linked and free intercalators

We report the DNA binding site preferences of the novel molecule AO-Pt, in which the anticancer drug dichloro(ethylenediamine)platinum(II) is linked by a hexamethylene chain to acridine orange. The sequence specificity of platinum binding was mapped by exonuclease III digestion of 165 and 335 base pair restriction fragments from pBR322 DNA. Parallel studies were carried out with the unmodified anticancer drugs cis-diamminedichloroplatinum(II) (cis-DDP) and dichloro(ethylenediamine)platinum(II), [Pt(en)Cl2]. Oligo(dG) sequences are the most prevalent binding sites for AO-Pt, with secondary binding occurring mainly at d(AG) sites. cis-DDP and [Pt(en)Cl2] bind less readily to the secondary sequences, with cis-DDP showing greater binding site selectivity than [Pt(en)Cl2]. The DNA intercalator ethidium bromide promotes binding of [Pt(en)Cl2] and cis-DDP to many sites containing d(CGG) and, to a lesser extent, d(AG) sequences. AO-Pt exhibits enhanced binding to these sequences without the need for an external intercalator. Unlinked acridine orange, however, does not promote binding of [Pt(en)Cl2] and cis-DDP to d(CGG) and d(AG) sequences. These results are discussed in terms of the sequence preferences, stereochemistry, and relative residence times of the intercalators at their DNA binding sites. By modulating local structure in a sequence-dependent manner, both linked and, in the case of ethidium, free intercalators can influence the regioselectivity of covalent modification of DNA by platinum antitumor drugs.     

Ligands with specific affinity to a specific sequence of DNA base pairs. XI. The synthesis and binding to DNA of bis-netropsins with the C-ends of their netropsin fragments tethered by tetra- or pentamethylene linkers

Bis-Netropsins with the C-ends of their netropsin fragments tethered via tetra- or pentamethylene linkers and with Gly or L-Lys-Gly residues on their N-ends were synthesized. The footprinting technique was used to study the specificity of bis-netropsin binding to the specially constructed DNA fragments containing various clusters of A.T pairs. It was found that the linker length affects the binding of bis-netropsins, with the tetramethylene linker providing better protection than the pentamethylene linker. It was shown that the newly synthesized bis-netropsins bind tighter to the 5'-A4T(4)-3' sequence, whereas the bis-netropsin with a linker between the netropsin N-ends binds better to 5'-T4A(4)-3' sequences. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2002, vol. 28, no. 6; see also http://www.maik.ru.     

DNA microarrays with unimolecular hairpin double-stranded DNA probes: fabrication and exploration of sequence-specific DNA/protein interactions

We have fabricated double-stranded DNA (dsDNA) microarrays containing unimolecular hairpin dsDNA probes immobilized on glass slides. The unimolecular hairpin dsDNA microarrays were manufactured by four steps: Firstly, synthesizing single-stranded DNA (ssDNA) oligonucleotides with two reverse-complementary sequences at 3' hydroxyl end and an overhang sequence at 5' amino end. Secondly, microspotting ssDNA on glutaraldehyde-derived glass slide to form ssDNA microarrays. Thirdly, annealing two reverse-complementary sequences to form hairpin primer at 3' end of immobilized ssDNA and thus to create partial-dsDNA microarray. Fourthly, enzymatically extending hairpin primer to convert partial-dsDNA microarrays into complete-dsDNA microarray. The excellent efficiency and high accuracy of the enzymatic synthesis were demonstrated by incorporation of fluorescently labeled dUTPs in Klenow extension and digestion of dsDNA microarrays with restriction endonuclease. The accessibility and specificity of the DNA-binding proteins binding to dsDNA microarrays were verified by binding Cy3-labeled NF-kappaB to dsDNA microarrays. The dsDNA microarrays have great potential to provide a high-throughput platform for investigation of sequence-specific DNA/protein interactions involved in gene expression regulation, restriction and so on.     

Detection of head-to-tail DNA sequences of human bocavirus in clinical samples

Parvoviruses are single stranded DNA viruses that replicate in a so called "rolling-hairpin" mechanism, a variant of the rolling circle replication known for bacteriophages like φX174. The replication intermediates of parvoviruses thus are concatemers of head-to-head or tail-to-tail structure. Surprisingly, in case of the novel human bocavirus, neither head-to-head nor tail-to-tail DNA sequences were detected in clinical isolates; in contrast head-to-tail DNA sequences were identified by PCR and sequencing. Thereby, the head-to-tail sequences were linked by a novel sequence of 54 bp of which 20 bp also occur as conserved structures of the palindromic ends of parvovirus MVC which in turn is a close relative to human bocavirus.     

Identification of a candidate regulatory region in the human CD8 gene complex by colocalization of DNase I hypersensitive sites and matrix attachment regions which bind SATB1 and GATA-3

To locate elements regulating the human CD8 gene complex, we mapped nuclear matrix attachment regions (MARs) and DNase I hypersensitive (HS) sites over a 100-kb region that included the CD8B gene, the intergenic region, and the CD8A gene. MARs facilitate long-range chromatin remodeling required for enhancer activity and have been found closely linked to several lymphoid enhancers. Within the human CD8 gene complex, we identified six DNase HS clusters, four strong MARs, and several weaker MARs. Three of the strong MARs were closely linked to two tissue-specific DNase HS clusters (III and IV) at the 3' end of the CD8B gene. To further establish the importance of this region, we obtained 19 kb of sequence and screened for potential binding sites for the MAR-binding protein, SATB1, and for GATA-3, both of which are critical for T cell development. By gel shift analysis we identified two strong SATB1 binding sites, located 4.5 kb apart, in strong MARs. We also detected strong GATA-3 binding to an oligonucleotide containing two GATA-3 motifs located at an HS site in cluster IV. This clustering of DNase HS sites and MARs capable of binding SATB1 and GATA-3 at the 3' end of the CD8B gene suggests that this region is an epigenetic regulator of CD8 expression.     

Sequence specific recognition of DNA by tailor-made hairpin conjugates of achiral seco-cyclopropaneindoline-2-benzofurancarboxamide and pyrrole-imidazole polyamides

Hairpin conjugates of achiral seco-cyclopropaneindoline-2-benzofurancarboxamide (achiral seco-CI-Bf) and three diamides (ImPy 1, PyIm 2, and PyPy 3, where Py is pyrrole, and Im is imidazole), linked by a gamma-aminobutyrate group, were synthesized. The sequence-specific covalent alkylation of the achiral CI moiety with adenine-N3 in the minor groove was ascertained by thermally induced DNA cleavage experiments. The results provide evidence that hairpin conjugates of achiral seco-CI-Bf-gamma-polyamides could be tailored to target specific DNA sequences according to a set of general rules: the achiral CI moiety selectively reacts with adenine-N3, a stacked pair of imidazole/benzofuran prefers a G/C base pair, and a pyrrole/benzofuran prefers an A/T or T/A base pair. Models for the binding of hairpin conjugates 1-3 with sequences 5'-TCA(888)G-3', 5'-CAA(857)C-3', and 5'-TTA(843)C-3' are proposed.     

CD46 short consensus repeats III and IV enhance measles virus binding but impair soluble hemagglutinin binding.

The binding of a recombinant soluble form of the measles virus (MV) hemagglutinin (sH) to cells expressing hybrid CD46/CD4 proteins was compared to that of purified virus. For binding of both ligands, both CD46 external short consensus repeats I and II (SCR I and II) in the natural order were essential. The addition of SCR III and IV enhanced virus binding but inhibited sH binding. Accordingly, this lowered the ability of sH to compete with MV binding. Antihemagglutinin monoclonal antibodies selectively inhibited the binding of either sH or MV. Thus, sH and MV share a common binding site in SCR I and II but differ in their apparent avidity to CD46 under the influence of SCR III and IV.     

Modulation of oxidative DNA damage and DNA-crosslink formation induced by cis-diammine-tetrachloro-platinum(IV) in the presence of endogenous reductants

Platinum(IV) [Pt(IV)] complex, satraplatin, is currently in clinical trials for the treatment of various cancers. As a key step of the anti-cancer effect exertion, satraplatin is supposed to be reduced by endogenous reductants to platinum(II) [Pt(II)] complex. In this study, we investigated the interaction of DNA, Pt(IV), and the endogenous reductants such as ascorbic acid (AsA) and glutathione (GSH). As a model Pt(IV) compound, cis-diammine-tetrachloro-Pt(IV) [cis-Pt(IV)], which is a prodrug of cisplatin [cis-diammine-dichloro-Pt(II), cis-Pt(II)], was incubated with calf thymus DNA in the presence of AsA or GSH. In the presence of AsA, cis-Pt(IV) induced oxidative DNA damage. Hydroxyl radical scavengers suppressed the AsA-associated oxidative damage, thereby suggesting that hydroxyl radicals are involved in the DNA oxidation. cis-Pt(II)-like CD spectral change and crosslink formation in calf thymus DNA were also observed during this DNA oxidation, suggesting cis-Pt(IV) reduction by AsA and DNA conformational change induced by the newly formed cis-Pt(II) binding to DNA. GSH did not induce oxidative DNA damage likely due to its own hydroxyl radical scavenging ability. Further, GSH suppressed the Pt(II)-mediated DNA conformational change and crosslink formation, suggesting that GSH sequesters the cis-Pt(II) away from DNA by GSH-cis-Pt(II) complex formation.     

Characterization of a parallel-stranded DNA hairpin

Recently we have shown that synthetic DNA containing homooligomeric A-T base pairs can form a parallel-stranded intramolecular hairpin structure [van de Sande et al. (1988) Science (Washington, D.C.) 241, 551-557]. In the present study, we have employed NMR and optical spectroscopy to investigate the structure of the parallel-stranded (PS) DNA hairpin 3'-d(T)8C4(A)8-3' and the related antiparallel (APS) hairpin 5'-d(T)8C4(A)8-3'. The parallel orientation of the strands in the PS oligonucleotide is achieved by introducing a 5'-5' phosphodiester linkage in the hairpin loop. Ultraviolet spectroscopic and fluorescence data of drug binding are consistent with the formation of PS and APS structures, respectively, in these two hairpins. Vacuum circular dichroism measurements in combination with theoretical CD calculations indicate that the PS structure forms a right-handed helix. 31P NMR measurements indicate that the conformation of the phosphodiester backbone of the PS structure is not drastically different from that of the APS control. The presence of slowly exchanging imino protons at 14 ppm and the observation of nuclear Overhauser enhancement between imino protons and the AH-2 protons demonstrate that similar base pairing and base stacking between T and A residues occur in both hairpins. However, the small chemical shift dispersion observed in proton NMR spectra of the PS hairpin suggests that the stem of this hairpin is more regular than that of the APS hairpin. On the basis of NOESY measurements, we find that the orientation of the bases is in the anti region and that the sugar puckering is in the 2'-endo range.(ABSTRACT TRUNCATED AT 250 WORDS)     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Deoxycytidine methylation does not affect DNA.RNA hybrid formation or B-A transitions of (dG)n.(dC)n sequences.

Optical thermal denaturation and circular dichroism (CD) experiments were performed with the following non-selfcomplementary duplex DNA, RNA and DNA.RNA hybrids: (I) dGAG3C3G3CTC.dGAGC3G3C3TC, (II) dGAG3m5C3G3m5CTC.dGAGm5C3G3m5C3TC, (III) rGAG3C3G3CUC.rGAGC3G3C3UC, (IV) dGAG3C3G3CTC.rGAGC3G3C3UC, (V) rGAG3C3G3CUC.dGAGC3G3C3TC, (VI) dGAG3m5C3G3m5CTC.rGAGC3G3C3UC, (VII) rGAG3C3G3CUC.dGAGm5C3G3m5C3TC. Duplex stabilities (delta G degrees at 60 degrees C) increase in the order: I less than IV less than II = V = VI less than VII less than III. Large enthalpic stabilization is associated with intrastrand stacking of guanosine (rG) residues. CD spectroscopy indicates B-form conformations for the unmethylated and methylated DNA (I,II), A-form geometry for the RNA (III), and DNA.RNA hybrid (IV - VII) conformations resembling but not identical to A-RNA. C5-methyldeoxycytidine does not significantly influence DNA conformation, DNA.RNA hybrid formation, or the ability of DNA to adopt an A-type conformation in trifluoroethanol solutions.     

Two-step cleavage of hairpin RNA with 5' overhangs by human DICER

Background  

DICER is an RNase III family endoribonuclease that processes precursor microRNAs (pre-miRNAs) and long double-stranded RNAs, generating microRNA (miRNA) duplexes and short interfering RNA duplexes with 20~23 nucleotides (nts) in length. The typical form of pre-miRNA processed by the Drosha protein is a hairpin RNA with 2-nt 3' overhangs. On the other hand, production of mature miRNA from an endogenous hairpin RNA with 5' overhangs has also been reported, although the mechanism for this process is unknown.