Characterization of a parallel-stranded DNA hairpin

Recently we have shown that synthetic DNA containing homooligomeric A-T base pairs can form a parallel-stranded intramolecular hairpin structure [van de Sande et al. (1988) Science (Washington, D.C.) 241, 551-557]. In the present study, we have employed NMR and optical spectroscopy to investigate the structure of the parallel-stranded (PS) DNA hairpin 3'-d(T)8C4(A)8-3' and the related antiparallel (APS) hairpin 5'-d(T)8C4(A)8-3'. The parallel orientation of the strands in the PS oligonucleotide is achieved by introducing a 5'-5' phosphodiester linkage in the hairpin loop. Ultraviolet spectroscopic and fluorescence data of drug binding are consistent with the formation of PS and APS structures, respectively, in these two hairpins. Vacuum circular dichroism measurements in combination with theoretical CD calculations indicate that the PS structure forms a right-handed helix. 31P NMR measurements indicate that the conformation of the phosphodiester backbone of the PS structure is not drastically different from that of the APS control. The presence of slowly exchanging imino protons at 14 ppm and the observation of nuclear Overhauser enhancement between imino protons and the AH-2 protons demonstrate that similar base pairing and base stacking between T and A residues occur in both hairpins. However, the small chemical shift dispersion observed in proton NMR spectra of the PS hairpin suggests that the stem of this hairpin is more regular than that of the APS hairpin. On the basis of NOESY measurements, we find that the orientation of the bases is in the anti region and that the sugar puckering is in the 2'-endo range.(ABSTRACT TRUNCATED AT 250 WORDS)     

Binding of netropsin to DNA and synthetic polynucleotides

The interaction of netropsin with DNA and synthetic polydeoxyribonucleotides was studied by absorption spectrophotometry and circular dichroism. The results are consistent with a model in which a netropsin molecule occupies five base pairs in binding and carries three reaction sites each capable of interacting with one AT base pair. We associate these reaction sites with the antibiotic peptide groups which probably interact with AT base pairs by a hydrogen bonding mechanism.     

Binding of netropsin to a DNA triple helix.

The interaction of netropsin, a minor groove binding drug, with T-A-T triple helix and A-T double helix was studied using circular dichroism spectroscopy and thermal denaturation. The triple helix was made by an oligonucleotide (dA)12-x-(dT)12-x-(dT)12, where x is a hexaethylene glycol chain bridged between the 3' phosphate of one strand and the 5' phosphate of the following strand. This oligonucleotide is able to fold back on itself to form a very stable triplex. Changing the conditions allows the same oligonucleotide in a duplex form with a (dT)12 dangling arm. Circular dichroism spectroscopy demonstrates that netropsin can bind to the triple helical structure. Spectral analysis shows that the bound drug exhibits a conformation and an environment similar in double-stranded and in triple-stranded structure. However, the binding constant to the triple-stranded structure is found smaller than the binding constant to the double-stranded one. Thermal denaturation experiments demonstrate that netropsin destabilizes the triplex whereas it stabilizes the duplex.     

Helix-coil transition of parallel-stranded DNA. Thermodynamics of hairpin and linear duplex oligonucleotides

The stabilities have been determined of different DNA double helices constructed with the two constituent strands in a parallel orientation. These molecules incorporate polarity-inverting loop structures (hairpins) or nucleotide sequences (duplexes) which impose the desired polarity on the two strands constituting the sugar-phosphate backbone. The hairpins consisted of d(A.T)n stems (n = 8 or 10) and either a 5'-p-5' linkage in a d(C)4 loop (ps-C8 and ps-C10) or a 3'-p-3' linkage in a d(G)4 loop (ps-G10). The linear duplexes had 21-nt (ps-C2.C3) and 25-nt (ps-D1.D2, ps-D3.D4) mixed A,T sequences and normal chemical linkages throughout. Reference molecules with normal antiparallel helical orientations (hairpins aps-C8, aps-C10, and aps-G10 and duplexes aps-C3.C7, aps-D1.D3, and aps-D2.D4) were also synthesized and studied. Hydrogen bonding in ps-DNA is via reverse Watson-Crick base pairs, and the various constructs display spectroscopic, chemical, biochemical, and electrophoretic properties distinct from those of their aps counterparts. For example, both the ps and aps molecules show a pronounced UV absorption hyperchromicity upon melting, but the spectral distribution is not the same. Thus, the difference spectra (ps-aps) in the native state are characterized by a positive peak at 252 nm, an isosbestic point at 267 nm, and a negative peak at 282 nm. Temperature-dependent absorbances were recorded at selected wavelengths and in the form of complete spectra to derive the thermodynamic parameters for the helix-coil transitions.(ABSTRACT TRUNCATED AT 250 WORDS)     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Binding of netropsin to DNA in complexes with polypeptides containing repetitive lysine sequences

The interaction of the antibiotic netropsin with calf thymus DNA, T4 DNA and poly(dA-dT) . poly(dA-dT) in complexes with sequential polypeptides containing repetitive lysine sequences and histone H1 was investigated using circular dichroism spectroscopy and equilibrium dialysis. Both soluble DNA-polypeptide complexes and insoluble complexes showed binding of netropsin. The possibility of displacement of polypeptides from DNA binding sites by competition with netropsin molecules was eliminated by experiments using 14C-labelled polypeptides. From the analysis of CD titration behavior as well as from the results of equilibrium dialysis studies it follows that netropsin does not compete with polypeptides for DNA binding sites, which suggests that these two ligands occupy different sites. Various explanations for minor differences in the CD behavior of the bound netropsin in the saturation region are also discussed.     

Alternating d(G-A) sequences form a parallel-stranded DNA homoduplex.

The oligonucleotides d[(G-A)7G] and d[(G-A)12G] self-associate under physiological conditions (10 mM MgCl2, neutral pH) into a stable double-helical structure (psRR-DNA) in which the two polypurine strands are in a parallel orientation in contrast to the antiparallel disposition of conventional B-DNA. We have characterized psRR-DNA by gel electrophoresis, UV absorption, vacuum UV circular dichroism, monomer-excimer fluorescence of oligonucleotides end-labelled with pyrene, and chemical probing with diethyl pyrocarbonate and dimethyl sulfate. The duplex is stable at pH 4-9, suggesting that the structure is compatible with, but does not require, protonation of the A residues. The data support a model derived from force-field analysis in which the parallel-stranded d(G-A)n helix is right-handed and constituted of alternating, symmetrical Gsyn.Gsyn and Aanti.Aanti base pairs with N1H...O6 and N6H...N7 hydrogen bonds, respectively. This dinucleotide structure may be the source of a negative peak observed at 190 nm in the vacuum UV CD spectrum, a feature previously reported only for left-handed Z-DNA. The related sequence d[(GAAGGA)4G] also forms a parallel-stranded duplex but one that is less stable and probably involves a slightly different secondary structure. We discuss the potential intervention of psRR-DNA in recombination, gene expression and the stabilization of genomic structure.     

Break in the heat capacity change at 303 K for complex binding of netropsin to AATT containing hairpin DNA constructs

Studies performed in our laboratory demonstrated the formation of two thermodynamically distinct complexes on binding of netropsin to a number of hairpin-forming DNA sequences containing AATT-binding regions. These two complexes were proposed to differ only by a bridging water molecule between the drug and the DNA in the lower affinity complex. A temperature-dependent isothermal titration calorimetry (ITC)-binding study was performed using one of these constructs (a 20-mer hairpin of sequence 5'-CGAATTCGTCTCCGAATTCG) and netropsin. This study demonstrated a break in the heat capacity change for the formation of the complex containing the bridging water molecule at approximately 303 K. In the plot of the binding enthalpy change versus temperature, the slope (DeltaCp) was -0.67 kcal mol-1 K-1 steeper after the break at 303 K. Because of the relatively low melting temperature of the 20-mer hairpin (341 K (68 degrees C)), the enthalpy change for complex formation might have included some energy of refolding of the partially denatured hairpin, giving the suggestion of a larger DeltaCp. Studies done on the binding of netropsin to similar constructs, a 24-mer and a 28-mer, with added GC basepairs in the hairpin stem to increase thermal stability, exhibit the same nonlinearity in DeltaCp over the temperature range of from 275 to 333 K. The slopes (DeltaCp) were -0.69 and -0.64 kcal mol-1 K-1 steeper after 303 K for the 24-mer and 28-mer, respectively. This observation strengthens the argument regarding the presence of a bridging water molecule in the lower affinity netropsin/DNA complex. The DeltaCp data seem to infer that because the break in the heat capacity change function for the lower affinity binding occurs at the isoequilibrium temperature for water, water may be included or trapped in the complex. The fact that this break does not occur in the heat capacity change function for formation of the higher affinity complex can similarly be taken as evidence that water is not included in the higher affinity complex.     

Reactivity of parallel-stranded DNA to chemical modification reagents

Four 25-nt long oligonucleotides containing dA and dT (D1, D2, D3, and D4) which are capable of forming parallel-stranded (ps) or antiparallel-stranded (aps) duplexes have been synthesized [Rippe, K., Ramsing, N. B., & Jovin, T. M. (1989) Biochemistry 28, 9536-9541]. In the present study, the OsO4-pyridine complex (Os,py), diethyl pyrocarbonate (DEPC), KMnO4, and the 1,10-phenanthroline-cuprous complex [(OP)2Cu+] were used to investigate the conformation-dependent reactivity of ps, aps, and single-stranded (ss) oligonucleotides. The products were analyzed by polyacrylamide gel electrophoresis with single-nucleotide resolution. The results confirm the duplex nature of the ps combinations of oligonucleotides and reveal structural differences in comparison with the aps molecules. Under conditions in which ss-DNA is substantially sensitive to Os,py, both the ps and aps duplexes are very unreactive. A similar result was observed with KMnO4 and DEPC, although with the latter reagent the modification pattern of the labeled strands D1* and D4* was slightly different for the parallel than for the antiparallel duplex. The (OP)2Cu+ complex efficiently cleaves the aps but not the ps duplex and shows a preference for TAT steps. We also tested the effect of monovalent and divalent cation concentrations on the chemical reactivity of the ps, aps, and ss species. Elevated NaCl concentration leads to a dramatic increase in the Os,py and KMnO4 modification of ss molecules and the ps, but not the aps, duplex. We attribute the apparent reaction with ps-DNA to a destabilization of this conformation under the conditions of reaction. In contrast, all reactions with DEPC are somewhat depressed at high salt concentration.(ABSTRACT TRUNCATED AT 250 WORDS)     

Binding properties and DNA sequence-specific recognition of two bithiazole-linked netropsin hybrid molecules.

We report the DNA binding properties of two hybrid molecules which result from the combination of the DNA sequence-specific minor groove ligand netropsin with the bithiazole moiety of the antitumor drug bleomycin. The drug-DNA interaction has been investigated by means of electric linear dichroism (ELD) spectroscopy and DNase I footprinting. In compound 1 the two moieties are linked by a flexible aliphatic tether while in compound 2 the two aromatic ring systems are directly coupled by a rigid peptide bond. The results are consistent with a model in which the netropsin moiety of compound 1 resides in the minor groove of DNA and where the appended bithiazole moiety is projected away from the DNA groove. This monocationic hybrid compound has a weak affinity for DNA and shows a strict preference for A and T stretches. ELD measurements indicate that in the presence of DNA compound 2 has an orientation typical of a minor groove binder. Similar orientation angles were measured for netropsin and compound 2. This ligand which has a biscationic nature tightly binds to DNA (Ka = 6.3 x 10(5) M-1) and is mainly an AT-specific groove binder. But, depending on the nature of the sequence flanking the AT site first targeted by its netropsin moiety, the bithiazole moiety of 2 can accommodate various types of nucleotide motifs with the exception of homooligomeric sequences. As evidenced by footprinting data, the bithiazole group of bleomycin acts as a DNA recognition element, offering opportunities to recognize GC bp-containing DNA sequences with apparently a preference (although not absolute) for a pyrimidine-G-pyrimidine motif. Thus, the bithiazole unit of bleomycin provides an additional anchor for DNA binding and is also capable of specifically recognizing particular DNA sequences when it is appended to a strongly sequence selective groove binding entity. Finally, a model which schematizes the binding of compound 2 to the sequence 5'-TATGC is proposed. This model readily explains the experimentally observed specificity of this netropsin-bithiazole conjugate.     

Fluorescent 2-pyrimidinone nucleoside in parallel-stranded DNA

Stretches of parallel-stranded (ps) double-helical DNA can arise within antiparallel-stranded (aps) Watson-Crick DNA in looped structures or in the presence of sequence mismatches. Here we studied an effect of a pyrimidinone-G (PG) base pair on the stability and conformation of the ps DNA to explore whether P is useful as a structural probe.     

Binding of DNA to liposomes containing different derivatives of sphingosine

Binding of DNA to dimyristoylphosphatidylcholine (DMPC) liposomes containing different sphingosine derivatives was investigated. DNA labelled with adriamycin was used as a fluorescence quencher and its membrane association was observed by resonance energy transfer from liposomes incorporating a pyrene-derivatized lipid bisPDPC as a donor and containing 19 mol% of sphingosine, dihydro-, phyto- or dimethylsphingosine. As revealed by differential scanning calorimetry, the thermal phase behaviour of multilamellar liposomes containing these sphingolipids was also significantly altered by DNA. Attachment of DNA to liposomes containing sphingosylphosphorylcholine was much weaker, and no binding of DNA to membranes containing N-acetylsphingosine, N-stearoylsphingosine or sphingomyelin was observed. The membrane binding of DNA was dependent on pH and could be reversed by the inclusion of phosphatidic acid (eggPA) into the liposomes. Analogously, the association of cytochrome c with eggPA could be reversed by the DNA-binding sphingosines. These findings lend support to our previous proposal that the DNA-sphingosine interaction is electrostatic and requires the presence of a positive charge in the latter. Accordingly, sphingosines carrying a protonated amino group attach DNA to membranes, while blocking of the amino group by N-acylation abolishes this interaction.     

The osmotic sensitivity of netropsin analogue binding to DNA

The binding of a netropsin analogue to random sequence DNA, monitored by CD, is seen dependent on the concentration of neutral solutes. The binding free energy decreases linearly with solute osmolal concentration and the magnitude of the effect is insensitive to the chemical identity of the solute fur betaine, sorbitol, and triethylene glycol. These solutes appear to modulate binding through their effect on water activity and changes in the hydration of the drug and DNA in the complex reaction, not through a direct interaction with the reactants or the product. The dependence of binding constant on solute concentration can be interpreted as an additional binding of some 50–60 extra solute excluding water molecules by the complex. A water sensitivity of drug binding is further seen from the dependence of binding constants on the type of anion in solution. Anions in the Hofmeister series strongly affect bulk water free energies and entropies. The differences in netropsin analogue binding to DNA with Cl⁻, F⁻, and CIO are consistent with the effect observed with neutral solutes. The ability to measure changes in water binding associated with a specific DNA interaction is a first step toward correlating changes in hydration with the strength and specificity of binding. © 1995 John Wiley & Sons, Inc.     

Length-dependent formation of parallel-stranded DNA in alternating AT segments

Parallel-stranded DNA can be formed from alternating AT segments and is not restricted exclusively to homooligomeric AT sequences. DNA oligonucleotides 3'-d(AT)nxC4(AT)n-3' (where x indicates the location of the 5'-5' phosphodiester linkage) form parallel-stranded hairpin structures at micromolar strand concentration for n = 4 or 5 but not for n = 6, 7. The spectral properties of the parallel-stranded structures are similar to those of the hairpin structures containing homooligomeric AT stems. However, parallel-stranded structures formed in alternating AT segments are significantly less stable than either their corresponding antiparallel control or the homooligomeric parallel AT hairpins as evidenced by their lower helix-coil transition enthalpy, melting temperature, and stability constant. This results in a remarkable polymorphism which is most pronounced for 3'-d(AT)5xC4(AT)5-3'. This oligonucleotide can exist as a parallel-stranded hairpin, coil, or concatameric antiparallel structure(s), depending on temperature and strand concentration. These results suggest simple guidelines for the design of parallel-stranded DNA. In addition, we present a model for the assessment of the stability of parallel-stranded duplex structures formed from AT base pairs based on their sequence.     

Conformation dependent binding of netropsin and distamycin to DNA and DNA model polymers

The binding of the antibiotics netropsin and distamycin A to DNA has been studied by thermal melting, CD and sedimentation analysis. Netropsin binds strongly at antibiotic/nucleotide ratios up to at least 0.05. CD spectra obtained using DNA model polymers reveal that netropsin binds tightly to poly (dA) · poly (dT), poly (dA-dT) · poly(dA-dT) and poly (dI-dC) · poly (dI-dC) but poorly, if at all, to poly (dG) · poly (dC). Binding curves obtained with calf thymus DNA reveal one netropsin-binding site per 6.0 nucleotides (K_a=2.9 · 10⁵ M⁻¹); corresponding values for distamycin A are one site per 6.1 nucleotides with K_a= 11.6 · 10⁵ M⁻¹. Binding sites apparently involve predominantly A·T-rich sequences whose specific conformation determines their high affinity for the two antibiotics. It is suggested that the binding is stabilized primarily by hydrogen bonding and electrostatic interactions probably in the narrow groove of the DNA helix, but without intercalation. Any local structural deformation of the helix does not involve unwinding greater than approximately 3° per bound antibiotic molecule.     

Binding of the antitumor drug nogalamycin and its derivatives to DNA: structural comparison

The three-dimensional molecular structures of the complexes between a novel antitumor drug nogalamycin and its derivative U-58872 with a modified DNA hexamer d[m5CGT(pS)Am5CG] have been determined at 1.7- and 1.8-A resolution, respectively, by X-ray diffraction analyses. Both structures (in space group P6(1)) have been refined with constrained refinement procedure to final R factors of 0.208 (3386 reflections) and 0.196 (2143 reflections). In both complexes, two nogalamycins bind to the DNA hexamer double helix in a 2:1 ratio with the elongated aglycon chromophore intercalated between the CpG steps at both ends of the helix. The aglycon chromophore spans across the GC Watson-Crick base pairs with its nogalose lying in the minor groove and the aminoglucose lying in the major groove of the distorted B-DNA double helix. Most of the sugars remain in the C2'-endo pucker family, except three deoxycytidine residues (terminal C1, C7, and internal C5). All nucleotides are in the anti conformation. Specific hydrogen bonds are found in the complex between the drug and guanine-cytosine bases in both grooves of the helix. One hydroxyl group of the aminoglucose donates a hydrogen bond to the N7 of guanine, while the other receives a hydrogen bond from the N4 amino group of cytosine. The orientation of these two hydrogen bonds suggests that nogalamycin prefers a GC base pair with its aglycon chromophore intercalating at the 5'-side of a guanine (between NpG), or at the 3'-side of a cytosine (between CpN) with the sugars pointing toward the GC base pair. The binding of nogalamycin to DNA requires that the base pairs in DNA open up transiently to allow the bulky sugars to go through, suggesting that nogalamycin prefers GC sequences embedded in a stretch of AT sequences.     

Fluorescence quenching of parallel-stranded DNA bound ethidium bromide: the effect of 7-deaza-2'-deoxyisoguanosine and 7-halogenated derivatives

Parallel stranded (ps) duplexes were constructed by incorporating 7-deaza-2′-deoxyisoguanosine (1a) or its 7-halogenated analogs 1b,c in place of 2′-deoxyisoguanosine. UV and T_m analyses prove the high affinity of ethidium bromide (EB) to these modified duplexes. Steady-state fluorescence measurement shows that the fluorescence is quenched when EB is bound to ps duplexes containing compounds 1a–c. The quenching effect depends on the 7-substituent of the nucleobase.     

Hydroxyl radical footprinting of the sequence-selective binding of netropsin and distamycin to DNA

Hydroxyl radicals, generated by allowing an iron (II).EDTA complex to react with hydrogen peroxide, have been employed to cleave the 160-base pair tyrT DNA fragment in the presence and absence of the minor groove-binding antibiotics netropsin and distamycin A. The control DNA cleavage pattern is practically independent of nucleotide sequence, which overcomes certain limitations of other footprinting techniques, so that additional information can be gained about the AT-rich sequence preference of the minor groove-binding ligands.     

Binding of hairpin pyrrole and imidazole polyamides to DNA: relationship between torsion angle and association rate constants

N-methylpyrrole (Py)-N-methylimidazole (Im) polyamides are small organic molecules that bind to DNA with sequence specificity and can be used as synthetic DNA-binding ligands. In this study, five hairpin eight-ring Py–Im polyamides 1–5 with different number of Im rings were synthesized, and their binding behaviour was investigated with surface plasmon resonance assay. It was found that association rate (k_a) of the Py–Im polyamides with their target DNA decreased with the number of Im in the Py–Im polyamides. The structures of four-ring Py–Im polyamides derived from density functional theory revealed that the dihedral angle of the Py amide carbonyl is 14∼18°, whereas that of the Im is significantly smaller. As the minor groove of DNA has a helical structure, planar Py–Im polyamides need to change their conformation to fit it upon binding to the minor groove. The data explain that an increase in planarity of Py–Im polyamide induced by the incorporation of Im reduces the association rate of Py–Im polyamides. This fundamental knowledge of the binding of Py–Im polyamides to DNA will facilitate the design of hairpin Py–Im polyamides as synthetic DNA-binding modules.     

Integron integrase binds to bulged hairpin DNA

Gene cassettes are short, monogenic DNA elements that translocate between integrons through site-specific excision and integration. These events require that an integron-coded tyrosine recombinase forms a reactive complex with two sites, at least one of which belongs to the attC class. An attC site can be divided into two pairs of short repeats flanking a palindromic central region. The nucleotide sequence of attC among different cassettes varies extensively, implying that the site contains a structural recognition determinant with low sequence constraints. Oligonucleotides representing many different sequence modifications in either strand of the site were examined for integrase binding by using an electrophoresis mobility shift assay. The inner repeats, a central triplet and two single-nucleotide asymmetries in the site had the strongest influence on binding strength and strand choice. Our data show that the recombinase binds to a bulged hairpin in attC and that the hairpin distortion due to bulging could define the appropriate orientation of the otherwise symmetrical site. This is consistent with the strong bias for binding of recombinase to the bottom-strand oligonucleotides in vitro. Moreover, it was observed that the mobility-shifted complexes persisted under protein-denaturing assay conditions, indicating that a covalent link is indeed formed between integrase and DNA. Upon substitution of the presumed DNA-attacking residue, Y312, with a phenylalanine, DNA binding remained but there was no covalent linkage.