Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Automated synthesis of new ferrocenyl-modified oligonucleotides: study of their properties in solution

We have developed new ferrocenyl-modified oligonucleotide (ODN) probes for electrochemical DNA sensors. A monofunctional ferrocene containing phosphoramidite group has been prepared, and a new bisfunctional ferrocene containing phosphoramidite and dimethoxytrityl (DMT) groups has been developed. These ferrocenyl-phosphoramidites have been directly employed in an automated solid-phase DNA synthesizer using phosphoramidite chemistry. The advantages of this method are that it allows a non-specialist in nucleotide chemistry to access labeled ODNs and that it has demonstrated good results. ODNs modified at the 3′ and/or 5′ extremities have been prepared, with the incorporation of the ferrocenyl group into the chain. The 5′ position appears to be more important due to its particular behavior. The thermal stability and electrochemical properties of these new ODN ferrocenes were analyzed before and after hybridization with different ODNs. The feasibility of using these new ferrocenyl-labeled ODNs in DNA sensors has been demonstrated.     

Acridine-modified,clamp-forming antisense oligonucleotides synergize with cisplatin to inhibit c-Myc expression and B16-F0 tumor progression

The c-myc protooncogene plays a key role in the abnormal growth regulation of melanoma cells. We have targeted three polypurine sequences within the mouse myc mRNA with acridine-modified, clamp-forming antisense oligonucleotides (AS ODNs) in an effort to inhibit growth of murine melanoma cells. These ODNs are unique in that they hybridize to the target mRNA by both Watson–Crick and Hoogsteen hydrogen bond interactions, forming a triple-stranded structure. At a concentration of 3 µM E1C, E2C and E3C inhibit B16-F0 proliferation by 76, 66 and 78%, respectively. Both immunofluorescent staining and western blot analysis corroborate a proportional reduction in c-Myc expression by all three ODNs. There were clear distinctions in the ability of these ODNs to inhibit tumor progression in C57BL/6 mice as a function of Myc expression. There was no synergy demonstrated between ODN E1C with cisplatin (DDP), which inhibited tumor growth by 77% alone and 82% in combination. Although E2C inhibited growth by 54%, its effect was decreased to 32% with DDP, when compared with controls. E3C, on the other hand, demonstrated a synergistic effect with DDP, inhibiting growth by 72% in combination, but only by 1% as a single agent. Immunofluorescence analysis of tumors for each group revealed a concomitant reduction in c-Myc expression in tumors from mice treated with the most active clamp ODN alone (E1C) or clamp ODN + DDP (E1C/E3C + DDP). Western blot analysis confirmed this decrease in target protein expression. Our results document the growth-inhibitory activity of two myc-targeting antisense clamp ODNs; E1C, which has activity as a single agent, and E3C, which has in vivo synergy with DDP pretreatment. These data confirm the antiproliferative effects of these novel ODNs and document an interesting synergy with the chemotherapeutic agent DDP.     

Using genome-wide measurements for computational prediction of SH2–peptide interactions

Peptide-recognition modules (PRMs) are used throughout biology to mediate protein–protein interactions, and many PRMs are members of large protein domain families. Recent genome-wide measurements describe networks of peptide–PRM interactions. In these networks, very similar PRMs recognize distinct sets of peptides, raising the question of how peptide-recognition specificity is achieved using similar protein domains. The analysis of individual protein complex structures often gives answers that are not easily applicable to other members of the same PRM family. Bioinformatics-based approaches, one the other hand, may be difficult to interpret physically. Here we integrate structural information with a large, quantitative data set of SH2 domain–peptide interactions to study the physical origin of domain–peptide specificity. We develop an energy model, inspired by protein folding, based on interactions between the amino-acid positions in the domain and peptide. We use this model to successfully predict which SH2 domains and peptides interact and uncover the positions in each that are important for specificity. The energy model is general enough that it can be applied to other members of the SH2 family or to new peptides, and the cross-validation results suggest that these energy calculations will be useful for predicting binding interactions. It can also be adapted to study other PRM families, predict optimal peptides for a given SH2 domain, or study other biological interactions, e.g. protein–DNA interactions.     

Synthesis,thermal stability and resistance to enzymatic hydrolysis of the oligonucleotides containing 5-(N-aminohexyl)carbamoyl-2'-O-methyluridines

The synthesis of oligonucleotides (ODNs) containing 5-(N-aminohexyl)carbamoyl-2′-O-methyluridine (D) is described, and thermal stability and resistance to enzymatic hydrolysis of the ODNs are compared with ODNs containing 5-(N-aminohexyl)carbamoyl-2′-deoxyuridine (H). The ODNs containing D and the complementary RNA demonstrated a duplex thermal stabilization of 0.4–3.9°C per modification depending on the position and the number, while the ODNs containing H with the RNA showed slightly less effective thermal stabilization. Further more, the ODNs containing D were found to be more resistant to nucleolytic hydrolysis, not only by snake venom phosphodiesterase (SVPD; a 3′-exonuclease) but also by DNase I (an endonuclease). The half-life of the 17mer containing five molecules of D against nucleolytic hydrolysis by SVPD was 240 times greater than the unmodified 17mer ODN, which is 1.8 times greater than the ODN containing 5Hs in the same sequence. Against DNase I, the same ODN containing 5Ds was 24 times greater stable than the unmodified 17mer and 15 times more stable than the ODN containing 5Hs. We also examined whether the duplexes formed by the ODNs containing D and the complementary RNAs could be a substrate of Escherichia coli RNase H. It was revealed that a minimum of five contiguous unmodified 2′-deoxyribonucleosides between Ds was required to constitute a substrate of E.coli RNase H. Thus, the ODN with Ds and at least five contiguous unmodified 2′-deoxyribonucleosides between Ds was found to be a candidate for a novel antisense molecule.     

Use of locked nucleic acid oligonucleotides to add functionality to plasmid DNA

The available reagents for the attachment of functional moieties to plasmid DNA are limiting. Most reagents bind plasmid DNA in a non-sequence- specific manner, with undefined stoichiometry, and affect DNA charge and delivery properties or involve chemical modifications that abolish gene expression. The design and ability of oligonucleotides (ODNs) containing locked nucleic acids (LNAs) to bind supercoiled, double-stranded plasmid DNA in a sequence-specific manner are described for the first time. The main mechanism for LNA ODNs binding plasmid DNA is demonstrated to be by strand displacement. LNA ODNs are more stably bound to plasmid DNA than similar peptide nucleic acid (PNA) ‘clamps’ for procedures such as particle-mediated DNA delivery (gene gun). It is shown that LNA ODNs remain associated with plasmid DNA after cationic lipid-mediated transfection into mammalian cells. LNA ODNs can bind to DNA in a sequence-specific manner so that binding does not interfere with plasmid conformation or gene expression. Attachment of CpG-based immune adjuvants to plasmid by ‘hybrid’ phosphorothioate–LNA ODNs induces tumour necrosis factor-α production in the macrophage cell line RAW264.7. This observation exemplifies an important new, controllable methodology for adding functionality to plasmids for gene delivery and DNA vaccination.     

Intracellular disposition and metabolism of fluorescently-labeled unmodified and modified oligonucleotides microinjected into mammalian cells.

The intracellular distribution and metabolism of microinjected fluorescently-labeled oligonucleotides (ODNs) have been evaluated using confocal fluorescence microscopy. Fluorescent phosphodiester ODNs, microinjected into the cytoplasm of mammalian cells, rapidly accumulate within the nucleus; the fluorescence disappears with a half-life of 15-20 minutes. Microinjected fluorescent phosphorothioate ODNs remain in the nucleus for more than 24 hours. The persistence of fluorescence depends on the length of the ODN. Modification of the 3' end of phosphodiester ODNs does not significantly slow the rapid disappearance of fluorescence, although certain 3' modifications localize ODNs into the cytoplasm. Using specially designed ODNs, endonuclease activity is demonstrated to exist in the cytoplasm and nucleus. Modification of the 2' position of the ribose rings of a fluorescent phosphodiester oligodeoxynucleotide with O-methyl or O-allyl does not alter its intracellular distribution; however, the 2'-O-allyl modification stabilizes the persistence of fluorescence more than 60-fold compared to the 2'-deoxy control. Thus, the experiments indicate that somatic cells contain nucleolytic activities which degrade microinjected ODNs; however, chemical modification can dramatically circumvent this process.     

Oligonucleotide structure influences the interactions between cationic polymers and oligonucleotides

We examined the effect of oligodeoxynucleotide (ODN) structure on the interactions between cationic polymers and ODNs. Unstructured and hairpin structured ODNs were used to form complexes with the model cationic polymer, poly-L-lysine (pLL), and the characteristics of these polymer-ODN interactions were subsequently examined. We found that hairpin structured ODNs formed complexes with pLL at slightly lower pLL:ODN charge ratios as compared to unstructured ODNs and that, at high charge ratios, greater fractions of the hairpin ODNs were complexed, as measured by dye exclusion. The dissociation of pLL-ODN interactions was tested further by challenge with heparin, which induced complex disruption. Both the kinetics and heparin dose response of ODN release were determined. The absolute amount and the kinetic rate of ODN release from the complexes of pLL and unstructured ODN were greater, as compared to hairpin ODNs. Our results therefore highlight the role of ODN structure on the association-dissociation behavior of polymer-ODN complexes. These findings have implications for the selection of ODN sequences and design of polymeric carriers used for cellular delivery of ODNs.     

Fundamental differences in the equilibrium considerations for siRNA and antisense oligodeoxynucleotide design

Both siRNA and antisense oligodeoxynucleotides (ODNs) inhibit the expression of a complementary gene. In this study, fundamental differences in the considerations for RNA interference and antisense ODNs are reported. In siRNA and antisense ODN databases, positive correlations are observed between the cost to open the mRNA target self-structure and the stability of the duplex to be formed, meaning the sites along the mRNA target with highest potential to form strong duplexes with antisense strands also have the greatest tendency to be involved in pre-existing structure. Efficient siRNA have less stable siRNA–target duplex stability than inefficient siRNA, but the opposite is true for antisense ODNs. It is, therefore, more difficult to avoid target self-structure in antisense ODN design. Self-structure stabilities of oligonucleotide and target correlate to the silencing efficacy of siRNA. Oligonucleotide self-structure correlations to efficacy of antisense ODNs, conversely, are insignificant. Furthermore, self-structure in the target appears to correlate with antisense ODN efficacy, but such that more effective antisense ODNs appear to target mRNA regions with greater self-structure. Therefore, different criteria are suggested for the design of efficient siRNA and antisense ODNs and the design of antisense ODNs is more challenging.     

Integrating Solid-State NMR and Computational Modeling to Investigate the Structure and Dynamics of Membrane-Associated Ghrelin

The peptide hormone ghrelin activates the growth hormone secretagogue receptor 1a, also known as the ghrelin receptor. This 28-residue peptide is acylated at Ser3 and is the only peptide hormone in the human body that is lipid-modified by an octanoyl group. Little is known about the structure and dynamics of membrane-associated ghrelin. We carried out solid-state NMR studies of ghrelin in lipid vesicles, followed by computational modeling of the peptide using Rosetta. Isotropic chemical shift data of isotopically labeled ghrelin provide information about the peptide’s secondary structure. Spin diffusion experiments indicate that ghrelin binds to membranes via its lipidated Ser3. Further, Phe4, as well as electrostatics involving the peptide’s positively charged residues and lipid polar headgroups, contribute to the binding energy. Other than the lipid anchor, ghrelin is highly flexible and mobile at the membrane surface. This observation is supported by our predicted model ensemble, which is in good agreement with experimentally determined chemical shifts. In the final ensemble of models, residues 8–17 form an α-helix, while residues 21–23 and 26–27 often adopt a polyproline II helical conformation. These helices appear to assist the peptide in forming an amphipathic conformation so that it can bind to the membrane.     

Large‐scale survey and database of high affinity ligands for peptide recognition modules

Many proteins involved in signal transduction contain peptide recognition modules (PRMs) that recognize short linear motifs (SLiMs) within their interaction partners. Here, we used large‐scale peptide‐phage display methods to derive optimal ligands for 163 unique PRMs representing 79 distinct structural families. We combined the new data with previous data that we collected for the large SH3, PDZ, and WW domain families to assemble a database containing 7,984 unique peptide ligands for 500 PRMs representing 82 structural families. For 74 PRMs, we acquired enough new data to map the specificity profiles in detail and derived position weight matrices and binding specificity logos based on multiple peptide ligands. These analyses showed that optimal peptide ligands resembled peptides observed in existing structures of PRM‐ligand complexes, indicating that a large majority of the phage‐derived peptides are likely to target natural peptide‐binding sites and could thus act as inhibitors of natural protein–protein interactions. The complete dataset has been assembled in an online database (http://www.prm‐db.org) that will enable many structural, functional, and biological studies of PRMs and SLiMs.     

Antisense delivery using protamine–oligonucleotide particles

Protamine, a polycationic peptide (mol. wt 4000–4500), was evaluated as a potential penetration enhancer for phosphodiester antisense oligonucleotides (ODNs). Unique complexes in the form of nanoparticles were spontaneously formed, which we call ‘proticles’. The stability of the particles and the ODNs bound into the proticles was examined in foetal calf serum and cell culture medium. FITC-labelled ODNs bound to protamine showed an increased cellular uptake into human histiocytic lymphoma U 937 cells compared to free ODNs. Proticles significantly decreased cellular growth in a cell proliferation assay using ODNs against the c-myc proto-oncogene.     

Probing dynamics of HIV-1 nucleocapsid protein/target hexanucleotide complexes by 2-aminopurine

The nucleocapsid protein (NC) plays an important role in HIV-1, mainly through interactions with the genomic RNA and its DNA copies. Though the structures of several complexes of NC with oligonucleotides (ODNs) are known, detailed information on the ODN dynamics in the complexes is missing. To address this, we investigated the steady state and time-resolved fluorescence properties of 2-aminopurine (2Ap), a fluorescent adenine analog introduced at positions 2 and 5 of AACGCC and AATGCC sequences. In the absence of NC, 2Ap fluorescence was strongly quenched in the flexible ODNs, mainly through picosecond to nanosecond dynamic quenching by its neighboring bases. NC strongly restricted the ODN flexibility and 2Ap local mobility, impeding the collisions of 2Ap with its neighbors and thus, reducing its dynamic quenching. Phe¹⁶→Ala and Trp³⁷→Leu mutations largely decreased the ability of NC to affect the local dynamics of 2Ap at positions 2 and 5, respectively, while a fingerless NC was totally ineffective. The restriction of 2Ap local mobility was thus associated with the NC hydrophobic platform at the top of the folded fingers. Since this platform supports the NC chaperone properties, the restriction of the local mobility of the bases is likely a mechanistic component of these properties.     

Protection of oligonucleotides against enzymatic degradation by pegylated and nonpegylated branched polyethyleneimine

Among the cationic polymers, polyethyleneimine (PEI) is a promising candidate for delivery of oligodeoxynucleotides (ODNs). In this study, we wondered whether pegylation of PEI influences the complexation with ODNs. We especially aimed to investigate whether ODNs are differently protected against enzymatic degradation in PEI and polyethylene glycol-polyethyleneimine (PEG-PEI) polyplexes. Using fluorescence resonance energy transfer combined with fluorescence correlation spectroscopy, we found that PEI/ODN polyplexes remain to protect the ODNs they carry over a prolonged period of time while in PEG-PEI/ODN polyplexes the degradation of the ODNs slowly proceeds. We attribute this to the fact that PEI seems to compact the ODNs more firmly in the polyplexes' core than PEG-PEI, which apparently also results in a better protection against enzymatic degradation. These observations may also influence the efficiency of PEI-based ODN delivery in vivo, where pegylation is an attractive strategy to enhance the stability of the polyplexes in the blood stream.     

A novel strategy for the identification of protein–DNA contacts by photocrosslinking and mass spectrometry

Photochemical crosslinking is a method for studying the molecular details of protein–nucleic acid interactions. In this study, we describe a novel strategy to localize crosslinked amino acid residues that combines laser-induced photocrosslinking, proteolytic digestion, Fe³⁺-IMAC (immobilized metal affinity chromatography) purification of peptide–oligodeoxynucleotide heteroconjugates and hydrolysis of oligodeoxynucleotides by hydrogen fluoride (HF), with efficient matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS). The new method is illustrated by the identification of the DNA-binding site of the restriction endonuclease MboI. Photoactivatable 5-iododeoxyuridine was incorporated into a single site within the DNA recognition sequence (GATC) of MboI. Ultraviolet irradiation of the protein–DNA complex with a helium/cadmium laser at 325 nm resulted in 15% crosslinking yield. Proteolytic digestion with different proteases produced various peptide–oligodeoxynucleotide adducts that were purified together with free oligodeoxynucleotide by Fe³⁺-IMAC. A combination of MS analysis of the peptide–nucleosides obtained after hydrolysis by HF and their fragmentation by MS/MS revealed that Lys²⁰⁹ of MboI was crosslinked to the MboI recognition site at the position of the adenine, demonstrating that the region around Lys²⁰⁹ is involved in specific binding of MboI to its DNA substrate. This method is suitable for the fast identification of the site of contact between proteins and nucleic acids starting from picomole quantities of crosslinked complexes.     

Substrate-gated docking of pore subunit Tha4 in the TatC cavity initiates Tat translocase assembly

The twin-arginine translocase (Tat) transports folded proteins across tightly sealed membranes. cpTatC is the core component of the thylakoid translocase and coordinates transport through interactions with the substrate signal peptide and other Tat components, notably the Tha4 pore-forming component. Here, Cys–Cys matching mapped Tha4 contact sites on cpTatC and assessed the role of signal peptide binding on Tha4 assembly with the cpTatC–Hcf106 receptor complex. Tha4 made contact with a peripheral cpTatC site in nonstimulated membranes. In the translocase, Tha4 made an additional contact within the cup-shaped cavity of cpTatC that likely seeds Tha4 polymerization to form the pore. Substrate binding triggers assembly of Tha4 onto the interior site. We provide evidence that the substrate signal peptide inserts between cpTatC subunits arranged in a manner that conceivably forms an enclosed chamber. The location of the inserted signal peptide and the Tha4–cpTatC contact data suggest a model for signal peptide–gated Tha4 entry into the chamber to form the translocase.     

Preparation of DNA-modified nanoparticles and preliminary study for colorimetric SNP analysis using their selective aggregations

DNA-modified nanospheres were prepared by anchoring amino-terminated oligodeoxynucleotides (ODNs) with carboxylates onto a colored polystyrene sphere surface through amido bonds. About 220 ODN molecules were immobilized onto a nanosphere 40 nm in diameter. Preliminary studies using the microspheres with 1 μm diameter reveal that the specificity of hybridization was retained after modification. Three kinds of differently colored (RGB, red/green/blue) nanospheres bearing unique ODNs on their surface were prepared for detecting the p53 gene. Each ODN is complementary to a different part in the 45mer sample that is a part of a conservative region of the p53 gene containing one of the hot spots. In a binary system using spheres R and G, the wild-type 45mer made the aggregates with yellow emission as the result of mixing both colors. The mutant 45mer containing one nucleotide displacement did not give such aggregates with distinct colors. The study of fluorescence resonance energy transfer (FRET) showed that spheres R and G directly contact each other in the aggregates with the wild type. The RGB ternary system gave aggregates with specific colors corresponding to the added ODN samples, wild type or mutant. In addition, in the presence of both samples, all of the spheres formed aggregates with white emission as a consequence of mixing three primary colors of light. This means that the present technique should allow us to conduct an allele analysis.     

Detection of oligonucleotide hybridization at femtomolar level and sequence-specific gene analysis of the Arabidopsis thaliana leaf extract with an ultrasensitive surface plasmon resonance spectrometer

A flow-injection (FI) device is combined, through the use of a low-volume (4 µl) flow cell, with an ultrasensitive surface plasmon resonance (SPR) spectrometer equipped with a bi-cell photodiode detector. The application of this novel FI–SPR device for sequence-specific ultratrace analysis of oligodeoxynucleotides (ODNs) and polydeoxynucleotides was demonstrated. Self-assembled monolayers of ODN probes are tethered onto Au films with a mercaptohexyl group at the 3′ ends. The FI–SPR provides a detection level (≤54 fM) 2–3 orders of magnitude lower than other SPR devices and compares well with several ultrasensitive detection methods for labeled DNA targets (e.g. fluorophore-tagged and radiolabeled DNA samples). The technique is also highly selective, since a 47mer ODN target with a single-base mismatch yielded a much smaller SPR signal, and a specific interaction was detected when the complementary target was present at 0.001% of the total DNA. The FI–SPR was extended to the measurement of two individual genes in a cDNA mixture transcribed from an Arabidopsis thaliana leaf mRNA pool. The greatly enhanced sensitivity not only obviates the necessity of DNA labeling, but also significantly reduces sample consumption, allowing direct quantification of low abundance mRNAs in cellular samples without amplification.     

Subcellular trafficking of antisense oligonucleotides and down-regulation of bcl-2 gene expression in human melanoma cells using a fusogenic liposome delivery system

Antisense oligonucleotides (ODN) targeted to specific genes have shown considerable potential as therapeutic agents. The polyanionic charges carried by these molecules, however, present a barrier to efficient cellular uptake and consequently their biological effects on gene regulation are compromised. To overcome this obstacle, a rationally designed carrier system is desirable for antisense delivery. This carrier should assist antisense ODN penetrate the cell membrane and, once inside the cell, then release the ODN and make them available for target binding. We have developed a carrier formulation employing programmable fusogenic vesicles (PFV) as the antisense delivery mediator. This study investigates the intracellular fate of PFV–ODN and bioavailability of antisense ODN to cells. The subcellular distribution of PFV and ODN was examined by monitoring the trafficking of FITC-labeled ODN and rhodamine/phosphatidylethanolamine (Rh-PE)-labeled PFV using confocal microscopy. Fluorescently tagged ODN were first co-localized with the liposomal carrier in the cytoplasm, presumably in endosome/lysosome compartments, shortly after incubation of PFV–ODN with HEK 293 and 518A2 cells. Between 24 and 48 h incubation, however, separation of FITC–ODN from the carrier and subsequent accumulation in the nucleus was observed. In contrast, the Rh-PE label was localized to the cell cytoplasm. The enhanced cellular uptake achieved using the PFV carrier, compared to incubation of free ODN with cells, and subsequent release of ODN from the carrier resulted in significant down-regulation of mRNA expression. Specifically, G3139, an antisense construct targeting the apoptotic antagonist gene bcl-2, was examined in the human melanoma cell line 518A2. Upon exposure to PFV-encapsulated G3139, cells displayed a time-dependent reduction in bcl-2 message levels. The bcl-2 mRNA level was reduced by 50% after 24 h treatment and by ~80% after 72 h when compared to cells treated with free G3139, empty PFV or PFV–G3622, a control ODN sequence. Our results establish that ODN can be released from PFV after intracellular uptake and can then migrate to the nucleus and selectively down-regulate target mRNA.     

A homogeneous europium cryptate-based assay for the diagnosis of mutations by time-resolved fluorescence resonance energy transfer

Oligonucleotide ligation assay (OLA) is considered to be a very useful methodology for the detection and characterization of mutations, particularly for clinical purposes. The fluorescence resonance energy transfer between a fluorescent donor and a suitable fluorophore as acceptor has been applied in the past to several scientific fields. This technique is well adapted to nucleic acid analysis such as DNA sequencing, DNA hybridization and polymerase chain reaction. We describe here a homogeneous format based on the use of a rare earth cryptate label as donor: tris-bipyridine-Eu³⁺. The long-lived fluorescence of this label makes it possible to reach a high sensitivity by using a time-resolved detection mode. A non-radiative energy transfer technology, known as time-resolved amplification of cryptate emission (TRACE^®) characterized by a temporal and spectral selectivity has been developed. The TRACE^® detection of characterized single nucleotide polymorphism using the OLA for allelic discrimination is proposed. We demonstrate the potentialities of this OLA–TRACE^® methodology through the analysis of K-ras oncogene point mutations.