Low-ultraviolet circular dichroism spectroscopy of sequential peptides 1-63, 64-95, 96-128, and 129-168 derived from myelin basic protein of rabbit

Four sequential peptides (sequences 1-63, 64-95, 96-128, and 129-168) derived from rabbit myelin basic protein by thrombic cleavage were examined by low-ultraviolet circular dichroism spectroscopy in 0.5 mM tris(hydroxymethyl)aminomethane hydrochloride (pH approximately 7.2) containing 0-92% trifluoroethanol (TFE). In the absence of the alcohol, all of the peptides contained a significant amount (17-29%) of beta-structure. In the presence of relatively low concentrations (up to 30%) of TFE, all of the peptides except 96-128 adopted considerable alpha-helix (16-33%). This involved a transition from the beta-structure in peptide 1-63 and transitions from the nonordered structure in peptides 1-63, 64-95, and 129-168. Furthermore, additional alpha-helix formed in peptide 1-63 between 30% and 92% TFE at the expense of nonordered structure, whereas the alpha-helix formation above 50% TFE in peptide 129-168 resulted largely from a beta-structure----alpha-helix transition. With the exception of the 129-168 peptide, approximately 65-100% of the maximum level of beta-structure persisted throughout the entire range of TFE concentration. In the case of peptide 129-168, however, most of the beta-structure was converted to alpha-helix and nonordered structure at 75% TFE. While the present results support our previous assignments of beta-structure- and alpha-helix-forming regions to specific amino acid sequences of the basic protein, they also demonstrate that the beta-structure----alpha-helix transitions evidenced at various concentrations of TFE were influenced to a considerable degree by the length of the peptide, presumably due to the presence or absence of interactions between noncontiguous portions of the myelin basic protein polypeptide chain.     

Hints of nonhierarchical folding of acidic fibroblast growth factor

We have analyzed by circular dichroism (CD) and proton nuclear magnetic resonance (NMR) the helical propensity of the all-beta protein acidic fibroblast growth factor (aFGF) and two peptides corresponding to beta-strand 8 (beta8 peptide, amino acids 95-107) and the beta-strand 8/turn/beta-strand 9 hairpin (beta8/9 peptide, amino acids 95-114), which has been involved in receptor binding. A secondary structure prediction of aFGF carried out by several procedures labels the 95-104 sequence as predominantly alpha-helical. A titration of aFGF with 2,2,2-trifluoroethanol (TFE) induces a change in the far-UV CD spectrum of the protein giving rise to a prominent alpha-helical shape (22% alpha-helix). The cooperativity of the transition and the moderate TFE concentrations used (midpoint at 24%) suggest that the effect of TFE is specific. Moreover, a titration performed at pH 2 yields a higher amount of alpha-helix (55%) at a smaller TFE concentration. Synthetic peptides containing the beta8 and beta8/9 sequences display a random coil conformation at pH 7 but acquire alpha-helical structure in the presence of TFE, methanol, and SDS micelles. At pH below 3.0 a significant amount (20-30%) of alpha-helical conformation is present in both the beta8 and beta8/9 peptides even in the absence of other solvent additives. The secondary structure of the peptides was determined by proton nuclear magnetic resonance (1H NMR). These results suggest that the 95-114 sequence of aFGF has helical propensity and that the protein may fold nonhierarchically in the early steps of folding, acquiring its final beta-structure by a later interaction with the rest of the polypeptide.     

Intramolecular alpha-helix-beta-structure-random coil transition in polypeptides. I. Equilibrium case

The present paper is devoted to the study of the conformational transition of polypeptides which are capable of forming alpha-helix, beta-structure and random coil conformations with the finite homogeneous chain model. The experimental results on the surfactant-induced conformational change of poly(L-lysine) can be well described by the present model assuming cooperative binding of the surfactant ions to the polypeptide side groups.     

Conformational analysis of a mitochondrial presequence derived from the F1-ATPase beta-subunit by CD and NMR spectroscopy.

Previous studies on mitochondrial targeting presequences have indicated that formation of an amphiphillic helix may be required for efficient targeting of the precursor protein into mitochondria, but the structural details are not well understood. We have used CD and NMR spectroscopy to characterize in detail the structure of a synthetic peptide corresponding to the presequence for the beta-subunit of F1-ATPase, a mitochondrial matrix protein. Although this peptide is essentially unstructured in water, alpha-helix formation is induced when the peptide is placed in structure-promoting environments, such as SDS micelles or aqueous trifluoroethanol (TFE). In 50% TFE (by volume), the peptide is in dynamic equilibrium between random coil and alpha-helical conformations, with a significant population of alpha-helix throughout the entire peptide. The helix is somewhat more stable in the N-terminal part of the presequence (residues 4-10), and this result is consistent with the structure proposed previously for the presequence of another mitochondrial matrix protein, yeast cytochrome oxidase subunit IV. Addition of increasing amounts of TFE causes the alpha-helical content to increase even further, and the TFE titration data for the presequence peptide of the F1-ATPase beta-subunit are not consistent with a single, cooperative transition from random coil to alpha-helix. There is evidence that helix formation is initiated in two different regions of the peptide. This result helps to explain the redundancy of the targeting information contained in the presequence for the F1-ATPase beta-subunit.     

Synthesis and spectroscopy of membrane receptor proteins. The gamma subunit of the IgE receptor.

The high-affinity receptor for IgE is a tetrameric complex of subunits of the type alpha beta gamma 2. We report here conformational studies of the intact gamma subunit in trifluoroethanol and water/liposomes by circular dichroism and Fourier-transform infrared (FTIR) spectroscopy. In trifluoroethanol, the FTIR amide I' frequencies were consistent with two predominant conformational components, the beta-turn and alpha-helix, whilst in liposomes consisting of D2O and dimyristoylglycerophosphocholine (Myr2GroPCho), three components were observed. The third component present may contain some left-handed extended helix. Spectral simulation was carried out to demonstrate that the CD spectra were consistent with the component conformations identified from FTIR spectroscopy. The stimulated CD spectra were in excellent agreement with the experimental spectra. The intact gamma subunit conformation in trifluoroethanol was shown to possess 72% alpha-helical and 28% beta-turn conformations. In water/Myr2GroPCho liposomes the percentage of each conformational component present is 37%, 38% and 25% for the alpha-helix, beta-turn and extended structures, respectively. Assuming that the transmembrane fragment was alpha-helical, an excellent correlation was found between this derived alpha-helical content in water/liposomes (37%) and from hydrophobicity plots where the percentage of amino acids in the transmembrane domain is predicted by others to be 34%. It is suggested that the beta-turn detected by CD and FTIR was attributable to a 3(10) helix rather than a type I or type III reverse turn.     

Intramolecular alpha-helix-beta-structure-random coil transition in polypeptides. II. Dynamic case

The conformational changes of polypeptides which are capable of forming the alpha-helix. beta-structure and random coil (or the unordered) conformations are discussed. The kinetics of this system are studied as the time evolution of the probabilities describing the conformational states of the system. The time behavior of the average numbers of the alpha-helix and the beta-structure reveals the existence of intermediate states which are not found and not stable at equilibrium. These intermediates make the kinetics of this system more complex. Such situations can occur in protein folding and unfolding processes in such a way that a conformation absent in the tertiary structure appears in the intermediate stages and disappears finally, and the time course of the reaction is described by the sum of two or more exponential terms, in other words, the protein folding and unfolding processes display multiphasic kinetics. These intermediates, which are formed by short-range interactions, may usually be destroyed but sometimes can be stabilized by medium- and long-range interactions and remain stable for a fairly long time in the process of renaturation in real proteins.     

Role of phosphorylation in conformational adaptability of bovine myelin basic protein.

Controlled thrombic digestion of a preparation of components 2 + 3 isolated from the 18.5 kDa bovine myelin basic protein (MBP) yielded a polypeptide that was monophosphorylated on threonine 97 (component 3pT97). This is the first posttranslationally phosphorylated MBP isolated in pure form. We studied the effect of this single phosphate on the conformational adaptability of 18.5 kDa bovine MBP by comparing the circular dichroism (CD) spectrum of component 3pT97 with the spectra of highly purified nonphosphorylated components 1 and 2. The CD spectra of nonphosphorylated component 1 and component 2 [monodeamidated form(s) of component 1] were indistinguishable, while component 3pt97 exhibited a different spectrum. The singly phosphorylated MBP component exhibited 13% more ordered conformations than that adopted by nonphosphorylated MBP in dilute aqueous solutions. This was estimated from the CD spectra, and apparently involved about 17 additional amino acid residues in beta-structure(s).     

Role of the helical structure of the N-terminal region of Plasmodium falciparum merozoite surface protein 2 in fibril formation and membrane interaction

Merozoite surface protein 2 (MSP2), an abundant glycosylphosphatidylinositol-anchored protein on the surface of Plasmodium falciparum merozoites, is a promising malaria vaccine candidate. MSP2 is intrinsically disordered and forms amyloid-like fibrils in solution under physiological conditions. The 25 N-terminal residues (MSP2(1-25)) play an important role in both fibril formation and membrane binding of the full-length protein. In this study, the fibril formation and solution structure of MSP2(1-25) in the membrane mimetic solvents sodium dodecyl sulfate (SDS), dodecylphosphocholine (DPC), and trifluoroethanol (TFE) have been investigated by transmission electronic microscopy, turbidity, thioflavin T fluorescence, circular dichroism (CD), and nuclear magnetic resonance (NMR) spectroscopy. Turbidity data showed that the aggregation of MSP2(1-25) was suppressed in the presence of membrane mimetic solvents. CD spectra indicated that helical structure in MSP2(1-25) was stabilized in SDS and DPC micelles and in high concentrations of TFE. The structure of MSP2(1-25) in 50% aqueous TFE, determined using NMR, showed that the peptide formed an amphipathic helix encompassing residues 10-24. Low concentrations of TFE favored partially folded helical conformations, as demonstrated by CD and NMR, and promoted MSP2(1-25) fibril formation. Our data suggest that partially folded helical conformations of the N-terminal region of MSP2 are on the pathway to amyloid fibril formation, while higher degrees of helical structure stabilized by high concentrations of TFE or membrane mimetics suppress self-association and thus inhibit fibril formation. The roles of the induced helical conformations in membrane interactions are also discussed.     

Quantitative IR spectrophotometry of peptide compounds in water (H2O) solutions. III. Estimation of the protein secondary structure

Infrared spectra of 13 globular proteins have been obtained in the 1800-1480-cm-1 region for H2O solutions. A method for estimating protein secondary structure from the ir spectrum has been developed. The method can also be used for estimating polypeptide and fibrous protein conformation. For the globular and fibrous proteins and polypeptides analyzed, the correlation coefficients between the ir and x-ray estimates of ordered helix, disordered helix, ordered beta-structure, disordered beta-structure, turns, and remainder were 0.98, 0.80, 0.99, 0.87, 0.90, and 0.92 respectively.     

A peptide analog of the calmodulin-binding domain of myosin light chain kinase adopts an alpha-helical structure in aqueous trifluoroethanol.

A 22-residue synthetic peptide encompassing the calmodulin (CaM)-binding domain of skeletal muscle myosin light chain kinase was studied by two-dimensional NMR and CD spectroscopy. In water the peptide does not form any regular structure; however, addition of the helix-inducing solvent trifluoroethanol (TFE) causes it to form an alpha-helical structure. The proton NMR spectra of this peptide in 25% and 40% TFE were assigned by double quantum-filtered J-correlated spectroscopy, total correlation spectroscopy, and nuclear Overhauser effect correlated spectroscopy spectra. In addition, the alpha-carbon chemical shifts were obtained from (1H,13C)-heteronuclear multiple quantum coherence spectra. The presence of numerous dNN(i, i + 1), d alpha N(i, i + 3), and d alpha beta(i, i + 3) NOE crosspeaks indicates that an alpha-helix can be formed from residues 3 to 20; this is further supported by the CD data. Upfield alpha-proton and downfield alpha-carbon shifts in this region of the peptide provide further support for the formation of an alpha-helix. The helix induced by TFE appears to be similar to that formed upon binding of the peptide to CaM.     

Solid phase synthesis and conformation of sequential glycosylated polytripeptide sequences related to antifreeze glycoproteins

Sequential glycopeptides [Thr(beta-D-galactose)-Ala-Ala]n, with n ranging from 2 to 7, as models of natural antifreeze glycoproteins were synthesized by the continuous flow, solid phase procedure. The conformational properties of these materials in solution were investigated by c.d. and 1H-n.m.r. spectroscopy. In aqueous solution the c.d. pattern is practically independent of chain length and is very similar to that of natural antifreeze glycoproteins. The results are interpreted in terms of random coil structure. The absence of ordered structures is further confirmed by n.m.r. data. A small amount of ordered conformation can be induced either by increasing the temperature of the aqueous solution or by addition of TFE. The c.d. pattern of all glycopeptides in water at temperatures higher than 50 degrees C are compatible with the presence of a small amount of alpha-helix or 3(10) helix. Since the glyco-hexapeptide is too short to form an alpha-helix, the hypothesis is made that in the glycopeptides in water at high temperature a small amount of 3(10) helix is formed. The same is observed for the 21-residue glycopeptide in presence of 85% (v/v) TFE. In this medium, the c.d. data on the glyco-hexapeptide are more compatible with the presence of a small amount of beta-structure.     

Conformational changes and inactivation of bovine carbonic anhydrase II in 2,2,2-trifluoroethanol solutions

Changes in unfolding and enzymatic activity of bovine carbonic anhydrase II (BCA II) in different concentrations of 2,2,2-trifluoroethanol (TFE) were investigated by 1-anilino-8-naphthalenesulfonate (ANS) fluorescence emission spectra, far-UV CD spectra, and enzyme activity. The results showed that the activity and conformation of BCA II changed according to the concentration of TFE. Significant aggregation was observed when BCA II was denatured at TFE concentrations between 10 and 35% (v/v). When the concentration of TFE exceeded 40%, the aggregation of BCA II was not very obvious. The activity of BCA II decreased almost to zero as the TFE concentration reached 26%. The ANS fluorescence spectra indicated the tertiary conformations of BCA II were more stable in solutions with TFE concentrations lower than 15% (v/v) and higher than 40% (v/v). Far-UV CD spectra showed that high concentrations (higher than 25%) of TFE could induce BCA II to form more alpha-helix structures and caused these structures to be in relatively stable states. The native conformation of BCA II being destroyed after its inactivity indicated that the active sites of BCA II is situated in a limited region and has more flexibility than the whole enzyme molecule.     

Amyloid fibril formation by peptide LYS (11-36) in aqueous trifluoroethanol

Peptide LYS (11-36), derived from the beta-sheet region of T4 lysozyme, forms an amyloid fibril in aqueous trifluoroethanol (TFE) at elevated temperature. The peptide has a moderate alpha-helix content in 20 and 50% (v/v) TFE solution; large quantities of fibrils were formed after incubation at 55 degrees C for 2 weeks as monitored by a thioflavin T fluorescence assay. No fibrils were observed when the peptide initially existed predominantly as a random coil or as a complete alpha helix. Our results suggest that a moderate amount of alpha helix and random coil present in the peptide initially facilitates the fibril-formation process, but a high alpha-helix content inhibits fibril formation. Transmission electron microscopy revealed several types of fibril morphologies at different TFE concentrations. The fibrils were highly twisted and consisted of interleaved protofilaments in 50% TFE, while smooth and flat ribbonlike fibrils were found in 20% TFE. In 50% TFE, the fibril growth rate of LYS (11-36) was found to depend strongly on peptide concentration and seeding but was insensitive to solution pH and ionic strength.     

Conformational transition of parallel DNA in solutions with decreased water activity]

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.     

Vibrational CD of the amide II band in some model polypeptides and proteins.

The amide II vibrational CD (VCD) spectra of poly (L-glutamic acid) and poly (L-lysine) in various conformational forms and those of several proteins in H2O have been measured. Characteristic VCD patterns have been observed in the amide II region due to helix, beta-sheet, and coil conformations in polypeptides. Based on their x-ray crystal structures, the proteins studied have been assigned to six categories. Proteins in the same category give rise to similar amide II VCD. While the protein conformational type is indicated using the amide II VCD, discrimination between types is less characteristic than with the previously studied amide I' VCD in D2O.     

Effect of trifluoroethanol on the conformational stability of a hyperthermophilic esterase: a CD study

The conformational stability of the hyperthermophilic esterase AFEST from Archeoglobus fulgidus against the denaturing action of 2,2,2-trifluoroethanol (TFE) has been investigated by means of circular dichroism (CD) measurements. At room temperature far-UV and near-UV CD spectra point out the occurrence of a co-operative transition from the native structure to a denatured state characterized by a high content of alpha-helix. The TFE concentration at half-completion of the transition proves to be 3.5 M (25% v v(-1)), by recording the molar ellipticity at both 222 and 276 nm. Thermal transition curves of AFEST in the absence and in the presence of TFE indicate a significant stability decrease on increasing the TFE concentration. The denaturation temperature is 99 degrees C for native AFEST, but becomes 85 degrees C at 1.4 M TFE (10% v v(-1)), and 56 degrees C at 2.8 M TFE (20% v v(-1)). It is also shown that, even though AFEST is very resistant to temperature, its resistance towards the denaturing action of TFE is similar to that of mesophilic proteins, including an esterase from Escherichia coli, AES. The proposal of a general mechanism for the TFE action on globular proteins leads to a reliable rationale of experimental data.     

Structural requirements for thymosin beta4 in its contact with actin. An NMR-analysis of thymosin beta4 mutants in solution and correlation with their biological activity.

We examined the conformational preferences of mutants of thymosin beta4, an actin monomer sequestering protein by NMR spectroscopy in 60% (v/v) trifluoroethanol. Under these conditions, the wild-type thymosin beta4 conformation consists of an alpha-helix (helix I) extending from residues 5-16 with a more stable fragment from lysine 11 to lysine 16 and a second alpha-helix (helix II) encompassing residues 31-39. The point mutations studied here are located in helix I or in the LKKTET segment (residues 17-22) that form the two main entities of interaction with the actin molecule. The alpha-1H conformational shifts allow us to investigate the helicity of the polypeptides at the residue level and to correlate these structures with their biological activity. We determine that an extension of helix I at its C-terminal end over the LKK-segment results in loss of activity. The correct termination of this helix is connected to a specific orientation of the polypeptide essential for a cooperative action of the thymosin beta4 binding entities required for full activity.     

Correlations between the conformations elucidated by CD spectroscopy and the antigenic properties of four peptides of the foot-and-mouth disease virus.

The conformational features of four related antigenic peptides (A, B, C and USA) from the foot-and-mouth disease virus (FMDV) (VP1; 141-160 of serotype A, subtype 12), assessed by CD, were found to correlate with the serological properties of these peptides. The CD spectra of the four peptides, obtained under cryogenic and solvent titration conditions, were consistent with three conformational components (a left-handed extended helix, an alpha-helix and a 3(10) helix) for peptides A and C and four components (a beta-turn of type II, an alpha-helix, a gamma-turn and a 3(10) helix) for peptides B and USA. The amino acid substitutions at positions 148 and 153, which distinguish the peptides, are therefore responsible for both their conformational and antigenic differences.     

Structural elements of human parathyroid hormone and their possible relation to biological activities.

Human parathyroid hormone (hPTH) and several deletion analogues were examined for the presence of secondary structure using circular dichroism spectroscopy. The spectra of hPTH and the deletion analogues 8-84, 34-53, 53-84, 1-34, 13-34, 1-19, and 20-34, in neutral, aqueous buffer, gave no evidence for extensive secondary structure. An alpha-helical-like spectral contribution was found to arise from a region within peptide 13-34. This spectral contribution was speculated to arise from partial stability of a helix consisting of residues 17-29. Molecular dynamics simulations of peptide 1-34 suggested that this peptide tends to fold with a bend defined by residues 10-14, with the amino-terminal and carboxyl-terminal residues tending to be in more extended forms and the other residues in helical-like conformations. The addition of trifluoroethanol promoted the formation of alpha-helix, mainly in the 1-34 region. The putative helix comprised of residues 17-29 was stabilized by the addition of 10-20% TFE, while a second putative helix proximal to the amino terminus, and comprised of residues 3-11, was stabilized by slightly higher concentrations of TFE. An amphiphilic sequence was identified within the 20-34 fragment. The development of alpha-helix on binding this fragment, and other analogues containing this sequence, to palmitoyloleoylphosphatidylserine vesicles provided experimental evidence for the potential role of this amphiphilic sequence in binding to membranes or to a membrane receptor. The relationships between these alpha-helical regions in 1-34, either potentiated by trifluoroethanol or lipid vesicles, are discussed in terms of different receptor-binding regions within hPTH.     

Differential effects of alcohols on conformational switchovers in alpha-helical and beta-sheet protein models

Organic solvents may induce non-native structures of proteins that mimic folding intermediates and/or conformations that occur in proximity to biological membranes. Here we systematically investigate the effects of simple (i.e., MeOH and EtOH) and fluorinated (i.e., trifluoroethanol, TFE) alcohols on the secondary structure and thermodynamic stability of two complementary model proteins using a combination of circular dichroism, fluorescence, and Fourier transform infrared (FTIR) detection methods. The selected proteins are alpha-helical Borrelia burgdorferi VlsE and beta-sheet human mitochondrial co-chaperonin protein 10 (cpn10). We find that switches between VlsE's native and non-native superhelical and beta-sheet structures readily occur (pH 7, 20 degrees C). The pathway depends on the alcohol: addition of MeOH induces a transition to a superhelical structure that is followed by conversion to beta-structure, whereas EtOH only unfolds the protein. TFE unfolds VlsE at low percentages but promotes the formation of a superhelical state upon further additions. For cpn10, both MeOH and TFE additions govern initial unfolding; however, further additions of MeOH result in the formation of a non-native beta-structure, whereas subsequent additions of TFE induce a superhelical structure. EtOH additions promptly unfold and precipitate cpn10. Both VlsE's and cpn10's non-native structures exhibit high stability toward chemical and thermal perturbations. This study demonstrates that in response to different alcohols, polypeptides can readily adopt both alpha- and beta-enriched conformations. The biological significance of these findings is discussed.