Molecular cloning and characterization of an inorganic pyrophosphatase from barley

A cDNA clone with sequence homology to soluble inorganic pyrophosphatase (IPPase) was isolated from a library of developing barley grains. The protein encoded by this clone was produced in transgenic Escherichia coli, and showed IPPase activity. In nondormant barley grains, the gene appeared to be expressed in metabolically active tissue such as root, shoot, embryo and aleurone. During imbibition, a continuous increase of the steady state mRNA level of IPPase was observed in embryos of non-dormant grains. In the embryos of dormant grains its production declined, after an initial increase. With isolated dormant and nondormant embryos, addition of recombinant IPPase, produced by E. coli, enhanced the germination rate. On the other hand, addition of pyrophosphate (PPi), substrate for this enzyme, appeared to reduce the germination rate. A role for this IPPase in germination is discussed.     

Molecular cloning and characterization of CD14 gene in goat

The present study was carried out in the Animal Genetics Division, Indian Veterinary Research Institute. The cDNA for CD14 gene of goat was amplified for the first time using PCR with ATGGTCTGCGTGCCCTACCTG as forward primer and GGAGCCCGAGGCTTCGCGTAA as reverse primer. The PCR product of 1122 bp was eluted, purified, cloned and sequenced by automated sequencer (ABI prism) using dideoxy chain termination method. CD14 cDNA (Gene bank Accession no. DQ457090) revealed 1122 bp nucleotide with ATG as start codon followed by an open reading frame of 1116 nucleotides and TAA as stop codon. GC content of caprine CD14 gene was found to be as high as 62.21%. The predicted peptide sequence revealed 373 amino acids precursor corresponding to coding sequence of CD14 gene and a 20 amino acid signal peptide. Caprine CD14 peptide is of higher Mol wt. than buffalo, but lesser than cattle. Caprine CD14 cDNA gene is 92.0, 92.5, 75.7, 76.1, 69.2 and 61.7% identical to buffalo, cattle, human, dog, mouse and rat cDNA.     

Molecular cloning and characterization of soybean peroxidase gene families

Plant peroxidases play major roles in many physiological processes. A soybean seedbud (21 days after flowering) Uni-ZAP XR cDNA library was screened with a peroxidase-specific probe. The probe was generated by 3′ rapid amplification of cDNA ends with soybean seedbud total RNA and a degenerate primer derived from a plant peroxidase conserved amino acid region (distal heme ligand). Positive clones were recovered by PCR using the degenerate peroxidase-specific primer and the vector primer T₇ flanking the cloning site. Four cDNAs, designated GmEpa1, GmEpa2, GmEpb1, and GmEpb2, contained 1298, 1326, 1171, and 1145 nucleotides, excluding poly(A) tail, and encoded mature proteins of 303, 303, 292, and 292 amino acids, respectively. The four predicted amino acid sequences showed homology to other peroxidases. GmEpa1 and GmEpa2 exhibited 97% amino acid identity, GmEpb1 and GmEpb2 exhibited 93% amino acid identity, and GmEpa1 and GmEpb1 exhibited 47% amino acid identity. GmEPa1 and GmEPb1 were expressed as fusion proteins in Escherichia coli. The recombinant fusion proteins were sequestered in inclusion bodies and active forms of the two denatured proteins were recovered after in vitro folding in a medium containing hemin, urea and Ca²⁺. GmEpa1 and GmEpa2 messages were detected in developing seed and root, while GmEpb1 and GmEpb2 messages were present in root, leaf, stem and seed pod. These cDNAs and cDNA-specific primers will allow investigations into peroxidase’s role in development, stress response and in other physiological processes.     

Molecular cloning,characterization and expression analysis of two catalase isozyme genes in barley

Clones representing two distinct barley catalase genes, Cat1 and Cat2, were found in a cDNA library prepared from seedling polysomal mRNA. Both clones were sequenced, and their deduced amino acid sequences were found to have high homology with maize and rice catalase genes. Cat1 had a 91% deduced amino acid sequence identity to CAT-1 of maize and 92% to CAT B of rice. Cat2 had 72 and 79% amino acid sequence identities to maize CAT-2 and-3 and 89% to CAT A of rice. Barley, maize or rice isozymes could be divided into two distinct groups by amino acid homologies, with one group homologous to the mitochondria-associated CAT-3 of maize and the other homologous to the maize peroxisomal/glyoxysomal CAT-1. Both barley CATs contained possible peroxisomal targeting signals, but neither had favorable mitochondrial targeting sequences. Cat1 mRNA occurred in whole endosperms (aleurones plus starchy endosperm), in isolated aleurones and in developing seeds, but Cat2 mRNA was virtually absent. Both mRNAs displayed different developmental expression patterns in scutella of germinating seeds. Cat2 mRNA predominated in etiolated seedling shoots and leaf blades. Barley genomic DNA contained two genes for Cat1 and one gene for Cat2. The Cat2 gene was mapped to the long arm of chromosome 4, 2.9 cM in telomeric orientation from the mlo locus conferring resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei).     

Molecular cloning and characterization of a senescence-induced tau-class Glutathione S-transferase from barley leaves

Glutathione S-transferases (GSTs) (EC 2.5.1.18) are multifunctional proteins involved in such diverse intracellular events as primary and secondary metabolism, signaling and stress metabolism. In this study, we found a senescence-induced tau-class GST (SIGST) in senescent leaves of barley (Hordeum vulgare L.). The SIGST was purified 19-fold to homogeneity from initial crude extracts by three steps of chromatography with a yield of 5%. The purified SIGST had a GSH-conjugating activity and peroxidase (POD) activity at the same level of 1.7 micromol min(-1) mg protein(-1), although restricted substrate selectivity could be seen in POD activity. Barley SIGST is a slightly acidic protein with a molecular weight of 49 k and is composed of two subunits. The enzyme exhibited a single pH optimum at pH 8.3. The K(m) values were 0.285 mM for GSH and 0.293 mM for 1-chloro-2,4-dinitrobenzene. In most respects, the barley enzyme resembles those that have been reported from other higher plants. The SIGST gene was cloned from cDNA of senescent barley leaves. DNA sequence analysis shows that the cloned SIGST had only one base different from the barley embryo GST, ECGST. The obtained sequence indicates that SIGST is classified into the plant-specific tau class. mRNA expression analysis showed that in addition to senescence, SIGST was strongly induced by treatment with a herbicide and low temperature. The responses to these stresses suggest that SIGST may be involved at least partly in the secondary metabolism as an antioxidant and enhancement of enzymatic activity during senescence.     

Molecular cloning and characterization of Hymenolepis diminuta alpha-tubulin gene.

To isolate a full-length alpha-tubulin cDNA from an eucestode, Hymenolepis diminuta, a lambda phage cDNA library was constructed. The alpha-tubulin gene was cloned, sequenced and characterized. The H. diminuta alpha-tubulin consisted of 450 amino acids. This protein contained putative sites for all posttranslational modifications as detyrosination/tyrosination at the carboxyl-terminal of protien, phosphorylation at residues R79 and K336, glycylation/glutamylation at residue G445 and acetylation at residue K40. Comparisons of H. diminuta alpha-tubulin with all full-length alpha-tubulin proteins revealed that H. diminuta alpha-tubulin possesses 10 distinctive residues, which are not found in any other alpha-tubulins. Phylogenetic analysis showed that H. diminuta alpha-tubulin has grouped in a separated branch adjacent eucestode and trematodes branch with 92% bootstrap value (1000 replicates). In conclusion, this is the first report of H. diminuta cDNA library construction, cloning and characterization of H. diminuta alpha-tubulin gene.     

Molecular cloning and characterization of Rab6 gene in duck.

Rab (ras-like in rat brain) proteins are small GTP-binding proteins that belong to largest subfamily in the small G protein, which are important for molecular modulation of membrane in the vesicular trafficking pathways. We have cloned and sequenced full length cDNA of Rab6 gene in duck. The cDNA sequence consists of 761 nucleotides and contains a complete open reading frame (ORF) of 627 nucleotides; the putative protein includes 208 amino acids. The CDS of duck Rab6 gene shares 86.1-90.0% homology with house mouse, silurana tropicalis, dog, human and orangutan, which indicates the Rab6 gene is high evolutional conservation in above animals.     

Molecular cloning and characterization of canine metalloproteinase-9 gene promoter

This paper describes the cloning and characterization of the canine matrix metalloproteinase-9 (MMP-9) gene promoter. The 5' untranslated region was obtained by genome walking upstream of the canine MMP-9 translation start site using canine genomic DNA as template. A DNA fragment of 1894 bp was isolated and on analysis demonstrated regions of sequence homology with the MMP-9 promoter sequences already determined for other species. In general, conserved regions correlated with DNA binding motifs such as a TATA-like box, AP-1 sites, GC boxes and a nuclear factor-kappaB binding domain. The DNA promoter fragment was sufficient to drive basal expression of a luciferase reporter gene in Madin Darby canine kidney (MDCK) cells and to a lesser extent in feline embryonic fibroblast (FEA) cells. Activity of the promoter was enhanced by the treatment of transfected MDCK cells with phorbol 12-myristate 13-acetate but no effect was observed in the FEA cells. Promoter deletion studies revealed that regions of promoter were necessary for induction of reporter gene expression.