Comparison of thermodynamic stabilities between PNA (peptide nucleic acid)/DNA hybrid duplexes and DNA/DNA duplexes.

We have examined quantitatively stabilities of PNA/DNA hybrid duplexes with identical nearest-neighbor base pairs and compared stabilities between PNA/DNA and DNA/DNA. The average difference of stabilization energy of the short PNA/DNA was 0.9 kcal mol(-1), which suggests that the stability of the hybrids with identical nearest-neighbor base pairs can be predicted with the nearest-neighbor model as well as those of nucleic acid duplexes.     

Structural and thermodynamic features of spiroiminodihydantoin damaged DNA duplexes

Oxidation of guanine or 8-oxo-7,8-dihydroguanine can produce spiroiminodihydantoin (Sp) R and S stereoisomers. Both in vitro and in vivo experiments have shown that the Sp stereoisomers are highly mutagenic, causing G --> C and G --> T transversion mutations. Therefore, they are of interest as potential endogenous cancer causing lesions. However, their structural properties in DNA duplexes remain to be elucidated. We have employed computational methods to study the Sp lesions in 11-mer DNA duplexes with A, C, G, and T partners. Molecular dynamics simulations have been carried out to obtain ensembles of structures, and the trajectories were employed to analyze the structures and compute free energies. The structural and thermodynamic analyses reveal that the Sp stereoisomers energetically favor positioning in the B-DNA major groove, with minor groove conformers also low energy in some cases, depending on the partner base. The R and S stereoisomers adopt opposite orientations with respect to the 5' to 3' direction of the modified strand. Both syn and anti glycosidic bond conformations are energetically feasible, with partner base and stereochemistry determining the preference. The lesions adversely impact base stacking and Watson-Crick hydrogen bonding interactions in the duplex, and cause groove widening. The chemical nature of the partner base determines specific hydrogen bonding and stacking properties of the damaged duplexes. The structural characteristics may relate to observed mutagenic properties of the Sp stereoisomers, including possible stereoisomer-dependent differences.     

Effects of monofunctional adducts of platinum(II) complexes on thermodynamic stability and energetics of DNA duplexes

Effects of adducts of [PtCl(NH3)3]Cl or chlorodiethylenetriamineplatinum(II) on DNA stability were studied with emphasis on thermodynamic origins of that stability. Oligodeoxyribonucleotide duplexes (15-bp) containing the single, site-specific monofunctional adduct at G-residues of the central sequences TGT/ACA or 5'-AGT/5'-ACT were prepared and analyzed by differential scanning calorimetry, temperature-dependent ultraviolet absorption and circular dichroism. The unfolding of the platinated duplexes was accompanied by relatively small unfavorable free energy terms. This destabilization was enthalpic in origin. On the other hand, a relatively large reduction of melting temperature (T(m)) was observed as a consequence of the monofunctional adduct in the TGT sequence, whereas T(m) due to the adduct in the AGT sequence was reduced only slightly. We also examined the efficiency of the mammalian nucleotide excision repair system to remove from DNA the monofunctional adducts and found that these lesions were not recognized by this repair system. Thus, rather thermodynamic than thermal characterization of DNA adducts of monofunctional platinum compounds is a property implicated in the modulation of downstream effects such as protein recognition and repair.     

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.     

Thermal stability of homologous and heterologous bacterial DNA duplexes

Thermal stability of homologous and heterologous DNA duplexes renatured according to the renaturation-rate method of De Ley et al. (1970) for 35 min or 17 hr, was estimated from the melting profiles of the duplexes. Comparison of the melting points of native and renatured DNA revealed that in the first 35 min of renaturation highly stable homologous duplexes were mainly formed, whereas up to 7% mismatching occurred in duplexes renatured for 17 hr. Up to 8% more mismatching was found in heterologous DNA duplexes of moderately related coryneform bacteria than in homologous ones after 35 min renaturation. It can be concluded that mismatching in heterologous hybrids of closely related DNAs had been restricted to a few % and of moderately related DNAs to approximately 10% in the initial renaturation phase.     

Sequence effects of aminofluorene-modified DNA duplexes: thermodynamic and circular dichroism properties

Circular dichroism (CD) and UV-melting experiments were conducted with 16 oligodeoxynucleotides modified by the carcinogen 2-aminofluorene, whose sequence around the lesion was varied systematically [d(CTTCTNG[AF]NCCTC), N = G, A, C, T], to gain insight into the factors that determine the equilibrium between base-displaced stacked (S) and external B-type (B) duplex conformers. Differing stabilities among the duplexes can be attributed to different populations of S and B conformers. The AF modification always resulted in sequence-dependent thermal (T_m) and thermodynamic (−ΔG°) destabilization. The population of B-type conformers derived from eight selected duplexes (i.e. -AG*N- and -CG*N-) was inversely proportional to the −ΔG° and T_m values, which highlights the importance of carcinogen/base stacking in duplex stabilization even in the face of disrupted Watson–Crick base pairing in S-conformation. CD studies showed that the extent of the adduct-induced negative ellipticities in the 290–350 nm range is correlated linearly with −ΔG° and T_m, but inversely with the population of B-type conformations. Taken together, these results revealed a unique interplay between the extent of carcinogenic interaction with neighboring base pairs and the thermodynamic properties of the AF-modified duplexes. The sequence-dependent S/B heterogeneities have important implications in understanding how arylamine–DNA adducts are recognized in nucleotide excision repair.     

Enhanced thermal stability and mismatch discrimination of mutation-carrying DNA duplexes and their kinetic and thermodynamic properties in microchannel laminar flow

This article reports the enhancement of thermal stability involving normal duplex and mutation-carrying DNA duplexes in microchannel laminar flow. The application of an in-house temperature-controllable microchannel-type flow cell is demonstrated for improved discrimination of mismatch base pairs such as A-G and T-G that are difficult to distinguish due to the rather small thermal destabilizations. Enhancement in thermal stability is reflected by an increased thermal melting temperature achieved in microchannel laminar flow as compared with batch reactions. To examine the kinetics and thermodynamics of duplex-coil equilibrium of DNA oligomers, denaturation-renaturation hysteresis curves were measured. The influence of microchannel laminar flow on DNA base mismatch analysis was described from the kinetic and thermodynamic perspectives. An increasing trend was observed for association rate constant as flow rate increased. In contrast, an apparent decrease in dissociation rate constant was observed with increasing flow rate. The magnitudes of the activation energies of dissociation were nearly constant for both the batch and microchannel laminar flow systems at all flow rates. In contrast, the magnitudes of activation energies of association decreased as flow rate increased. These results clearly show how microchannel laminar flow induces change in reaction rate by effecting change in activation energy. We anticipate, therefore, that this approach based on microchannel laminar flow system holds great promise for improved mismatch discrimination in DNA analyses, particularly on single-base-pair mismatch, by pronouncedly enhancing thermal stability.     

Parallel thermodynamic analysis of duplexes on oligodeoxyribonucleotide microchips.

A microchip method has been developed for massive and parallel thermodynamic analyses of DNA duplexes. Fluorescently labeled oligonucleotides were hybridized with oligonucleotides immobilized in the 100 x 100 x 20 mum gel pads of the microchips. The equilibrium melting curves for all microchip duplexes were measured in real time in parallel for all microchip duplexes. Thermodynamic data for perfect and mismatched duplexes that were obtained using the microchip method directly correlated with data obtained in solution. Fluorescent labels or longer linkers between the gel and the oligonucleotides appeared to have no significant effect on duplex stability. Extending the immobilized oligonucleotides with a four-base mixture from the 3'-end or one or two universal bases (5-nitroindole) from the 3'- and/or 5'-end increased the stabilities of their duplexes. These extensions were applied to increase the stabilities of the duplexes formed with short oligonucleotides in microchips, to significantly lessen the differences in melting curves of the AT- and GC-rich duplexes, and to improve discrimination of perfect duplexes from those containing poorly recognized terminal mismatches. This study explored a way to increase the efficiency of sequencing by hybridization on oligonucleotide microchips.     

A neural network for predicting the stability of DNA/DNA duplexes

A back-propagation neural network method has been developed to predict the stability of DNA/DNA duplexes. Calculated Tm with the present parameters fits the experimental values within reasonable errors (AD = 1.86 K, SEP = 1.99151, R2 = 0.9894 for NN1; AD = 1.59667 K, SEP = 2.03824, R2 = 0.99371 for NN2) and it has the advantage that the determinations of thermodynamic parameters are not needed.     

Thermal stability of PNA/DNA and DNA/DNA duplexes by differential scanning calorimetry

Thermodynamics of the thermal dissociation transitions of 10 bp PNA/DNA duplexes and their corresponding DNA/DNA duplexes in 10 mM sodium phosphate buffer (pH 7.0) were determined from differential scanning calorimetry (DSC) measurements. The PNA/DNA transition temperatures ranged from 329 to 343 K and the calorimetric transition enthalpies ranged from 209 +/- 6 to 283 +/- 37 kJ mol(-1). The corresponding DNA/DNA transition temperatures were 7-20 K lower and the transition enthalpies ranged from 72 +/- 29 to 236 +/- 24 kJ mol(-1). Agreement between the DSC and UV monitored melting (UVM) determined transition enthalpies validated analyzing the UVM transitions in terms of a two-state transition model. The transitions exhibited reversibility and were analyzed in terms of an AB = A + B two-state transition model which yielded van't Hoff enthalpies in agreement with the transition enthalpies. Extrapolation of the transition enthalpies and free energy changes to ambient temperatures yielded more negative values than those determined directly from isothermal titration calorimetry measurements on formation of the duplexes. This discrepancy was attributed to thermodynamic differences in the single-strand structures at ambient and at the transition temperatures, as indicated by UVM measurements on single DNA and PNA strands.     

Very stable mismatch duplexes: structural and thermodynamic studies on tandem G.A mismatches in DNA.

We have used ultraviolet melting techniques to compare the stability of several DNA duplexes containing tandem G.A mismatches to similar duplexes containing tandem A.G, I.A, and T.A base pairs. We have found that tandem G.A mismatches in 5'-Y-G-A-R-3' duplexes are more stable than their I.A counterparts and that they are sometimes more stable than tandem 5'-Y-T-A-R-3' sequences. This is not the case for tandem G.A mismatches in other base stacking environments, and it suggests that tandem G.A mismatches in 5'-Y-G-A-R-3' sequences have a unique configuration. In contrast to tandem 5'-G-A-3' mismatches, tandem 5'-A-G-3' mismatches were found to be unstable in all cases examined.     

Sequence effects on the relative thermodynamic stabilities of B-Z junction-forming DNA oligomeric duplexes

Circular dichroism (CD) and ultraviolet absorption techniques were employed in characterizing the sequence-dependent thermodynamic stabilities of B-Z junction-forming DNA duplexes. The Watson strand of the duplexes has the general sequence (5meC-G)4-NXYG-ACTG (where N = A or G and XY represents all permutations of pyrimidine bases). Duplexes were generated by mixing stoichiometric amounts of the complementary strands. Circular dichroism studies indicate that each duplex is fully right-handed at low salt (e.g., 115 mM Na+) but undergoes a salt-induced conformational transition to a structure that possesses both left- and right-handed conformations at high salt (4.5 M Na+), and hence a B-Z junction. Optical melting studies of the DNA duplexes at fixed DNA concentration with total Na+ concentration ranging from 15 mM to 5.0 M were determined. A nonlinear dependence of the melting temperature (Tm) on [Na+] was observed. Thermodynamic parameters at Na+ concentrations of 115 mM and 4.5 M with a wide range of DNA concentrations were determined from UV optical melting studies via construction of van't Hoff plots. A change of a single dinucleotide within these duplexes significantly affected the helix stabilities. The experimentally obtained free energies for the duplex to single-strand transitions were in close agreement with predicted values obtained from two different methods.     

The energetics of HMG box interactions with DNA: thermodynamic description of the target DNA duplexes

The thermal properties and energetics of formation of 10, 12 and 16 bp DNA duplexes, specifically interacting with the HMG box of Sox-5, have been studied by isothermal titration calorimetry (ITC) and differential scanning calorimetry (DSC). DSC studies show that the partial heat capacity of these short duplexes increases considerably prior to the cooperative process of strand separation. Direct extrapolation of the pre and post-transition heat capacity functions into the cooperative transition zone suggests that unfolding/dissociation of strands results in no apparent heat capacity increment. In contrast, ITC measurements show that the negative enthalpy of complementary strand association increases in magnitude with temperature rise, implying that strand association proceeds with significant decrease of heat capacity. Furthermore, the ITC-measured enthalpy of strand association is significantly smaller in magnitude than the enthalpy of cooperative unfolding measured by DSC. To resolve this paradox, the heat effects upon heating and cooling of the separate DNA strands have been measured by DSC. This showed that cooling of the strands from 100 degrees C to -10 degrees C proceeds with significant heat release associated with the formation of intra and inter-molecular interactions. When the enthalpy of residual structure in the strands and the temperature dependence of the heat capacity of the duplexes and of their unfolded strands have been taken into account, the ITC and DSC results are brought into agreement. The analysis shows that the considerable increase in heat capacity of the duplexes with temperature rise is due to increasing fluctuations of their structure (e.g. end fraying and twisting) and this effect obscures the heat capacity increment resulting from the cooperative separation of strands, which in fact amounts to 200(+/-40) JK(-1) (mol bp)(-1). Using this heat capacity increment, the averaged standard enthalpy, entropy and Gibbs energy of formation of fully folded duplexes from fully unfolded strands have been determined at 25 degrees C as -33(+/-2) kJ (mol bp)(-1), -93(+/-4) J K(-1) (mol bp)(-1) and -5.0(+/-0.5) kJ (mol bp)(-1), respectively.     

Solution structure and stability of the DNA undecamer duplexes containing oxanine mismatch

Solution structures of DNA duplexes containing oxanine (Oxa, O) opposite a cytosine (O:C duplex) and opposite a thymine (O:T duplex) have been solved by the combined use of (1)H NMR and restrained molecular dynamics calculation. One mismatch pair was introduced into the center of the 11-mer duplex of [d(GTGACO(6)CACTG)/d(CAGTGX(17)GTCAC), X = C or T]. (1)H NMR chemical shifts and nuclear Overhauser enhancement (NOE) intensities indicate that both the duplexes adopt an overall right-handed B-type conformation. Exchangeable resonances of C(17) 4-amino proton of the O:C duplex and of T(17) imino proton of O:T duplex showed unusual chemical shifts, and disappeared with temperature increasing up to 30 °C, although the melting temperatures were >50 °C. The O:C mismatch takes a wobble geometry with positive shear parameter where the Oxa ring shifted toward the major groove and the paired C(17) toward the minor groove, while, in the O:T mismatch pair with the negative shear, the Oxa ring slightly shifted toward the minor groove and the paired T(17) toward the major groove. The Oxa mismatch pairs can be wobbled largely because of no hydrogen bond to the O1 position of the Oxa base, and may occupy positions in the strands that optimize the stacking with adjacent bases.     

Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations

Accurate predictions of DNA stability in physiological and enzyme buffers are important for the design of many biological and biochemical assays. We therefore investigated the effects of magnesium, potassium, sodium, Tris ions, and deoxynucleoside triphosphates on melting profiles of duplex DNA oligomers and collected large melting data sets. An empirical correction function was developed that predicts melting temperatures, transition enthalpies, entropies, and free energies in buffers containing magnesium and monovalent cations. The new correction function significantly improves the accuracy of predictions and accounts for ion concentration, G-C base pair content, and length of the oligonucleotides. The competitive effects of potassium and magnesium ions were characterized. If the concentration ratio of [Mg (2+)] (0.5)/[Mon (+)] is less than 0.22 M (-1/2), monovalent ions (K (+), Na (+)) are dominant. Effects of magnesium ions dominate and determine duplex stability at higher ratios. Typical reaction conditions for PCR and DNA sequencing (1.5-5 mM magnesium and 20-100 mM monovalent cations) fall within this range. Conditions were identified where monovalent and divalent cations compete and their stability effects are more complex. When duplexes denature, some of the Mg (2+) ions associated with the DNA are released. The number of released magnesium ions per phosphate charge is sequence dependent and decreases surprisingly with increasing oligonucleotide length.     

Mismatches in DNA double strands: thermodynamic parameters and their correlation to repair efficiencies.

The helix-coil transitions of the 16 octadecameric DNA duplexes dCGTCGTTTXACAACGTCG X dCGACGTTGTX1AAACGACG with A, T, G, and C for X and X1 were measured by UV-absorption. This sequence was taken from former studies of in vivo determination of efficiencies of mismatch repair (Kramer, Kramer, and Fritz (1984) Cell 38, 879-887). The thermodynamic parameters for double strand and mismatch formation have been obtained by evaluating the partition function of a stack model which allowed for loop formation. As a result the mismatches could be classified into wobble base pairs (T/G, G/G, C/A, A/A, A/G), open base pairs, i.e. permanent loops (T/T, C/T, T/C, C/C), and intermediate or weak base pairs (G/T, A/C, G/A). There is no correlation between Tm and the biological repair efficiency of X/X1. The structure classes, however, as described above show a close correlation: Open base pairs show the lowest repair efficiencies, whereas mismatches with high repair efficiency always belong to the structural class of wobble base pairs. Because of the palindromic nearest neighbors of the variation site X/X1, the influence of next-nearest neighbor interactions could be detected and be estimated to about 1 kJ/mol for one stack.