共查询到20条相似文献,搜索用时 31 毫秒
1.
Yang Leilei Liu Bing Li Yang Wang Shaoxia Xu Yuan Wang Dongping Ye Huahu Shang Shichen Zhang Guangzhou Peng Ruiyun Zeng Lin Li Wenlong 《PloS one》2014,9(12)
iRhom1 and iRhom2 are inactive homologues of rhomboid intramembrane serine proteases lacking essential catalytic residues, which are necessary for the maturation of TNFα-converting enzyme (TACE). In addition, iRhoms regulate epidermal growth factor family secretion. The functional significance of iRhom2 during mammalian development is largely unclear. We have identified a spontaneous single gene deletion mutation of iRhom2 in Uncv mice. The iRhom2Uncv/Uncv mice exhibit hairless phenotype in a BALB/c genetic background. In this study, we observed dysplasia hair follicles in iRhom2Uncv/Uncv mice from postnatal day 3. Further examination found decreased hair matrix proliferation and aberrant hair shaft and inner root sheath differentiation in iRhom2Uncv/Uncv mutant hair follicles. iRhom2 is required for the maturation of TACE. Our data demonstrate that iRhom2Uncv cannot induce the maturation of TACE in vitro and the level of mature TACE is also significantly reduced in the skin of iRhom2Uncv/Uncv mice. The activation of Notch1, a substrate of TACE, is disturbed, associated with dramatically down-regulation of Lef1 in iRhom2Uncv/Uncv hair follicle matrix. This study identifies iRhom2 as a novel regulator of hair shaft and inner root sheath differentiation. 相似文献
2.
Osamu Suzuki Minako Koura Yoko Noguchi Kozue Uchio-Yamada Junichiro Matsuda 《Experimental Animals》2013,62(3):267-273
We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR
strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a
mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an
Hrhr allele. Using PCR with multiple pairs of primers
designed to amplify multiple overlapping regions covering the entire Hr
gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR
mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was
the same as that of Hrhr in the HRS/J strain. Based on the
sequence, we developed a genotyping method using PCR to determine zygosities. Three
primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and
R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the
Hrhr allele (275-bp amplicon), and S607 and R850
identified the wild-type Hr allele (244-bp amplicon). Applying PCR using
these three primers, we confirmed that it is possible to differentiate among homozygous
Hrhr (longer amplicons only), homozygous wild-type
Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and
Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains,
and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same
Hrhr gene mutation. Our genotyping method will facilitate
further research using hairless mice, and especially immature mice, because pups can be
genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age. 相似文献
3.
Chun-hong Xia Bo Chang Adam M. DeRosa Catherine Cheng Thomas W. White Xiaohua Gong 《PloS one》2012,7(12)
The mouse semi-dominant Nm2249 mutation displays variable cataracts in heterozygous mice and smaller lenses with severe cataracts in homozygous mice. This mutation is caused by a Gja8R205G point mutation in the second extracellular loop of the Cx50 (or α8 connexin) protein. Immunohistological data reveal that Cx50-R205G mutant proteins and endogenous wild-type Cx46 (or α3 connexin) proteins form diffuse tiny spots rather than typical punctate signals of normal gap junctions in the lens. The level of phosphorylated Cx46 proteins is decreased in Gja8R205G/R205G mutant lenses. Genetic analysis reveals that the Cx50-R205G mutation needs the presence of wild-type Cx46 to disrupt lens peripheral fibers and epithelial cells. Electrophysiological data in Xenopus oocytes reveal that Cx50-R205G mutant proteins block channel function of gap junctions composed of wild-type Cx50, but only affect the gating of wild-type Cx46 channels. Both genetic and electrophysiological results suggest that Cx50-R205G mutant proteins alone are unable to form functional channels. These findings imply that the Gja8R205G mutation differentially impairs the functions of Cx50 and Cx46 to cause cataracts, small lenses and microphthalmia. The Gja8R205G mutation occurs at the same conserved residue as the human GJA8R198W mutation. This work provides molecular insights to understand the cataract and microphthalmia/microcornea phenotype caused by Gja8 mutations in mice and humans. 相似文献
4.
Julie M. Jones James T. Elder Karl Simin Scott A. Keller Miriam H. Meisler 《Mammalian genome》1993,4(11):639-643
5.
Susanne Diener Sieglinde Bayer Sibylle Sabrautzki Thomas Wieland Birgit Mentrup Gerhard K. H. Przemeck Birgit Rathkolb Elisabeth Graf Wolfgang Hans Helmut Fuchs Marion Horsch Thomas Schwarzmayr Eckhard Wolf Eva Klopocki Franz Jakob Tim M. Strom Martin Hrabě de Angelis Bettina Lorenz-Depiereux 《Mammalian genome》2016,27(3-4):111-121
We performed exome sequencing for mutation discovery of an ENU (N-ethyl-N-nitrosourea)-derived mouse model characterized by significant elevated plasma alkaline phosphatase (ALP) activities in female and male mutant mice, originally named BAP014 (bone screen alkaline phosphatase #14). We identified a novel loss-of-function mutation within the Fam46a (family with sequence similarity 46, member A) gene (NM_001160378.1:c.469G>T, NP_001153850.1:p.Glu157*). Heterozygous mice of this mouse line (renamed Fam46a E157*Mhda) had significantly high ALP activities and apparently no other differences in morphology compared to wild-type mice. In contrast, homozygous Fam46a E157*Mhda mice showed severe morphological and skeletal abnormalities including short stature along with limb, rib, pelvis, and skull deformities with minimal trabecular bone and reduced cortical bone thickness in long bones. ALP activities of homozygous mutants were almost two-fold higher than in heterozygous mice. Fam46a is weakly expressed in most adult and embryonic tissues with a strong expression in mineralized tissues as calvaria and femur. The FAM46A protein is computationally predicted as a new member of the superfamily of nucleotidyltransferase fold proteins, but little is known about its function. Fam46a E157*Mhda mice are the first mouse model for a mutation within the Fam46a gene. 相似文献
6.
Johnson KR Lane PW Cook SA Harris BS Ward-Bailey PF Bronson RT Lyons BL Shultz LD Davisson MT 《Genomics》2003,81(1):6-14
In the outcrossing of a new recessive mouse mutation causing hair loss, a new wavy-coated phenotype appeared. The two distinct phenotypes were shown to be alternative manifestations of the same gene mutation and attributable to a single modifier locus. The new mutation, curly bare (cub), was mapped to distal Chr 11 and the modifier (mcub) was mapped to Chr 5. When homozygous for the recessive mcub allele, cub/cub mice appear hairless. A single copy of the dominant Mcub allele confers a full, curly coat in cub/cub mice. Reciprocal transfer of full-thickness skin grafts between mutant and control animals showed that the skin phenotype was tissue autonomous. The hairless cub/cub mcub/mcub mice show normal contact sensitivity responses to oxazolone. The similarity of the wavy coat phenotype to those of Tgfa and Egfr mutations and the map positions of cub and mcub suggest candidate genes that interact in the EGF receptor signal transduction pathway. 相似文献
7.
Akira ISHIKAWA Makoto SUGIYAMA Eiichi HONDO Keiji KINOSHITA Yuki YAMAGISHI 《Experimental Animals》2015,64(2):207-220
Oca2p-cas (oculocutaneous albinism II; pink-eyed dilution
castaneus) is a coat color mutant gene on mouse chromosome 7 that arose spontaneously in
wild Mus musculus castaneus mice. Mice homozygous for
Oca2p-cas usually exhibit pink eyes and gray coat hair on
the non-agouti genetic background, and this ordinary phenotype remains unchanged
throughout life. During breeding of a mixed strain carrying this gene on the C57BL/6J
background, we discovered a novel spontaneous mutation that causes darkening of the eyes
and coat hair with aging. In this study, we developed a novel mouse model showing this
unique phenotype. Gross observations revealed that the pink eyes and gray coat hair of the
novel mutant young mice became progressively darker in color by approximately 3 months
after birth. Light and transmission-electron microscopic observations revealed a marked
increase in melanin pigmentation of coat hair shafts and choroid of the eye in the novel
mice compared to that in the ordinary mice. Sequence analysis of
Oca2p-cas revealed a 4.1-kb deletion involving exons 15
and 16 of its wild-type gene. However, there was no sequence difference between the two
types of mutant mice. Mating experiments suggested that the novel mutant phenotype was not
inherited in a simple fashion, due to incomplete penetrance. The novel spontaneous mutant
mouse is the first example of progressive hair darkening animals and is an essential
animal model for understanding of the regulation mechanisms of melanin biosynthesis with
aging. 相似文献
8.
The hairless (hr) and rhino (hrrh) mutations are autosomal recessive allelic mutations that map to mouse Chromosome 14. Both hairless and rhino mice have a number of skin and nail abnormalities and develop a striking form of total alopecia at approximately 3–4 weeks of age. The molecular basis of the hairless mouse phenotype was previously found to be the result of a murine leukemia proviral insertion in intron 6 of thehrgene that resulted in aberrant splicing. In this study, we report a 2-bp substitution in exon 4 of thehrgene in a second allele ofhr,rhino 8J (hrrh-8J), leading to a nonsense mutation. These findings document the molecular basis of the rhino phenotype for the first time and suggest that rhino is a functional knock-out of thehrgene. 相似文献
9.
10.
11.
12.
13.
K?rt Tomberg Rami Khoriaty Randal J. Westrick Heather E. Fairfield Laura G. Reinholdt Gary L. Brodsky Pavel Davizon-Castillo David Ginsburg Jorge Di Paola 《PloS one》2016,11(3)
During the analysis of a whole genome ENU mutagenesis screen for thrombosis modifiers, a spontaneous 8 base pair (bp) deletion causing a frameshift in exon 27 of the Nbeal2 gene was identified. Though initially considered as a plausible thrombosis modifier, this Nbeal2 mutation failed to suppress the synthetic lethal thrombosis on which the original ENU screen was based. Mutations in NBEAL2 cause Gray Platelet Syndrome (GPS), an autosomal recessive bleeding disorder characterized by macrothrombocytopenia and gray-appearing platelets due to lack of platelet alpha granules. Mice homozygous for the Nbeal2 8 bp deletion (Nbeal2gps/gps) exhibit a phenotype similar to human GPS, with significantly reduced platelet counts compared to littermate controls (p = 1.63 x 10−7). Nbeal2gps/gps mice also have markedly reduced numbers of platelet alpha granules and an increased level of emperipolesis, consistent with previously characterized mice carrying targeted Nbeal2 null alleles. These findings confirm previous reports, provide an additional mouse model for GPS, and highlight the potentially confounding effect of background spontaneous mutation events in well-characterized mouse strains. 相似文献
14.
15.
Marc Trimborn Mahdi Ghani Diego J. Walther Monika Dopatka Véronique Dutrannoy Andreas Busche Franziska Meyer Stefanie Nowak Jean Nowak Claus Zabel Joachim Klose Veronica Esquitino Masoud Garshasbi Andreas W. Kuss Hans-Hilger Ropers Susanne Mueller Charlotte Poehlmann Ioannis Gavvovidis Detlev Schindler Karl Sperling Heidemarie Neitzel 《PloS one》2010,5(2)
Mutations in the human gene MCPH1 cause primary microcephaly associated with a unique cellular phenotype with premature chromosome condensation (PCC) in early G2 phase and delayed decondensation post-mitosis (PCC syndrome). The gene encodes the BRCT-domain containing protein microcephalin/BRIT1. Apart from its role in the regulation of chromosome condensation, the protein is involved in the cellular response to DNA damage. We report here on the first mouse model of impaired Mcph1-function. The model was established based on an embryonic stem cell line from BayGenomics (RR0608) containing a gene trap in intron 12 of the Mcph1 gene deleting the C-terminal BRCT-domain of the protein. Although residual wild type allele can be detected by quantitative real-time PCR cell cultures generated from mouse tissues bearing the homozygous gene trap mutation display the cellular phenotype of misregulated chromosome condensation that is characteristic for the human disorder, confirming defective Mcph1 function due to the gene trap mutation. While surprisingly the DNA damage response (formation of repair foci, chromosomal breakage, and G2/M checkpoint function after irradiation) appears to be largely normal in cell cultures derived from Mcph1gt/gt mice, the overall survival rates of the Mcph1gt/gt animals are significantly reduced compared to wild type and heterozygous mice. However, we could not detect clear signs of premature malignant disease development due to the perturbed Mcph1 function. Moreover, the animals show no obvious physical phenotype and no reduced fertility. Body and brain size are within the range of wild type controls. Gene expression on RNA and protein level did not reveal any specific pattern of differentially regulated genes. To the best of our knowledge this represents the first mammalian transgenic model displaying a defect in mitotic chromosome condensation and is also the first mouse model for impaired Mcph1-function. 相似文献
16.
Graeme I. Lancaster Michael J. Kraakman Helene L. Kammoun Katherine G. Langley Emma Estevez Ashish Banerjee Raelene J. Grumont Mark A. Febbraio Steve Gerondakis 《PloS one》2014,9(11)
Alterations in the immune cell profile and the induction of inflammation within adipose tissue are a hallmark of obesity in mice and humans. Dual-specificity phosphatase 2 (DUSP2) is widely expressed within the immune system and plays a key role promoting immune and inflammatory responses dependent on mitogen-activated protein kinase (MAPK) activity. We hypothesised that the absence of DUSP2 would protect mice against obesity-associated inflammation and insulin resistance. Accordingly, male and female littermate mice that are either wild-type (wt) or homozygous for a germ-line null mutation of the dusp2 gene (dusp2−/−) were fed either a standard chow diet (SCD) or high fat diet (HFD) for 12 weeks prior to metabolic phenotyping. Compared with mice fed the SCD, all mice consuming the HFD became obese, developed glucose intolerance and insulin resistance, and displayed increased macrophage recruitment and markers of inflammation in epididymal white adipose tissue. The absence of DUSP2, however, had no effect on the development of obesity or adipose tissue inflammation. Whole body insulin sensitivity in male mice was unaffected by an absence of DUSP2 in response to either the SCD or HFD; however, HFD-induced insulin resistance was slightly, but significantly, reduced in female dusp2−/− mice. In conclusion, DUSP2 plays no role in regulating obesity-associated inflammation and only a minor role in controlling insulin sensitivity following HFD in female, but not male, mice. These data indicate that rather than DUSP2 being a pan regulator of MAPK dependent immune cell mediated inflammation, it appears to differentially regulate inflammatory responses that have a MAPK component. 相似文献
17.
《Matrix biology》2014
Decorin is a small leucine-rich proteoglycan harboring a single glycosaminoglycan chain, which, in skin, is mainly composed of dermatan sulfate (DS). Mutant mice with targeted disruption of the decorin gene (Dcn−/−) exhibit an abnormal collagen architecture in the dermis and reduced tensile strength, collectively leading to a skin fragility phenotype. Notably, Ehlers–Danlos patients with mutations in enzymes involved in the biosynthesis of DS display a similar phenotype, and recent studies indicate that DS is involved in growth factor binding and signaling. To determine the impact of the loss of DS-decorin in the dermis, we analyzed the glycosaminoglycan content of Dcn−/− and wild-type mouse skin. The total amount of chondroitin/dermatan sulfate (CS/DS) was increased in the Dcn−/− skin, but was overall less sulfated with a significant reduction in bisulfated ΔDiS2,X (X = 4 or 6) disaccharide units, due to the reduced expression of uronyl 2-O sulfotransferase (Ust). With increasing age, sulfation declined; however, Dcn−/− CS/DS was constantly undersulfated vis-à-vis wild-type. Functionally, we found altered fibroblast growth factor (Fgf)-7 and -2 binding due to changes in the micro-heterogeneity of skin Dcn−/− CS/DS. To better delineate the role of decorin, we used a 3D Dcn−/− fibroblast cell culture model. We found that the CS/DS extracts of wild-type and Dcn−/− fibroblasts were similar to the skin sugars, and this correlated with the lack of uronyl 2-O sulfotransferase in the Dcn−/− fibroblasts. Moreover, Ffg7 binding to total CS/DS was attenuated in the Dcn−/− samples. Surprisingly, wild-type CS/DS significantly reduced the binding of Fgf7 to keratinocytes in a concentration dependent manner unlike the Dcn−/− CS/DS that only affected the binding at higher concentrations. Although binding to cell-surfaces was quite similar at higher concentrations, keratinocyte proliferation was differentially affected. Higher concentration of Dcn−/− CS/DS induced proliferation in contrast to wild-type CS/DS. 3D co-cultures of fibroblasts and keratinocytes showed that, unlike Dcn−/− CS/DS, wild-type CS/DS promoted differentiation of keratinocytes. Collectively, our results provide novel mechanistic explanations for the reported defects in wound healing in Dcn−/− mice and possibly Ehlers–Danlos patients. Moreover, the lack of decorin-derived DS and an altered CS/DS composition differentially influence keratinocyte behavior. 相似文献
18.
Sudhir Kumar Birgit Rathkolb Elisabeth Kemter Sibylle Sabrautzki Dian Michel Thure Adler Lore Becker Johannes Beckers Dirk H. Busch Lillian Garrett Wolfgang Hans Sabine M. H?lter Marion Horsch Martin Klingenspor Thomas Klopstock Ildikó Rácz Jan Rozman Ingrid Liliana Vargas Panesso Alexandra Vernaleken Andreas Zimmer Helmut Fuchs Valérie Gailus-Durner Martin Hrabě de Angelis Eckhard Wolf Bernhard Aigner 《PloS one》2016,11(3)
19.
Lingxia Wang Xiao Liu Meng Liang Fanglin Tan Wenyu Liang Yiyong Chen Yongxiang Lin Li Huang Jianhong Xing Wei Chen 《PloS one》2014,9(1)
Salt stress is a major abiotic stress that limits crop productivity in many regions of the world. A comparative proteomic approach to identify salt stress-responsive proteins and to understand the molecular mechanisms was carried out in the woody halophyte Kandelia candel. Four-leaf-old K. candel seedlings were exposed to 150 (control), 300, 450, and 600 mM NaCl for 3 days. Proteins extracted from the leaves of K. candel seedlings were separated by two-dimensional gel electrophoresis (2-DE). More than 900 protein spots were detected on each gel, and 53 differentially expressed protein spots were located with at least two-fold differences in abundance on 2-DE maps, of which 48 were identified by matrix-assisted laser desorption ionization time-of-flight/time-of-flight mass spectrometry (MALDI-TOF-TOF/MS). The results showed that K. candel could withstand up to 450 mM NaCl stress by up-regulating proteins that are mainly involved in photosynthesis, respiration and energy metabolism, Na+ compartmentalization, protein folding and assembly, and signal transduction. Physiological data, including superoxide dismutase (SOD) and dehydroascorbate reductase (DHAR) activities, hydrogen peroxide (H2O2) and superoxide anion radicals (O2
−) contents, as well as Na+ content and K+/Na+ ratios all correlated well with our proteomic results. This study provides new global insights into woody halophyte salt stress responses. Identification of differentially expressed proteins promotes better understanding of the molecular basis for salt stress reduction in K. candel. 相似文献
20.
M.V. Cannon D.A. Dunn M.H. Irwin A.I. Brooks F.F. Bartol I.A. Trounce C.A. Pinkert 《Mitochondrion》2011,11(1):33-39
Xenomitochondrial mice, harboring evolutionarily divergent Mus terricolor mitochondrial DNA (mtDNA) on a Mus musculus domesticus nuclear background (B6NTac(129S6)-mtM. terricolor/Capt; line D7), were subjected to molecular and phenotypic analyses. No overt in vivo phenotype was identified in contrast to in vitro xenomitochondrial cybrid studies. Microarray analyses revealed differentially expressed genes in xenomitochondrial mice, though none were directly involved in mitochondrial function. qRT-PCR revealed upregulation of mt-Co2 in xenomitochondrial mice. These results illustrate that cellular compensatory mechanisms for mild mitochondrial dysfunction alter mtDNA gene expression at a proteomic and/or translational level. Understanding these mechanisms will facilitate the development of therapeutics for mitochondrial disorders. 相似文献