Identification of two DNA-binding sites on the globular domain of histone H5.

The nature of the complexes of histones H1 and H5 and their globular domains (GH1 and GH5) with DNA suggested two DNA-binding sites which are likely to be the basis of the preference of H1 and H5 for the nucleosome, compared with free DNA. More recently the X-ray and NMR structures of GH5 and GH1, respectively, have identified two basic clusters on opposite sides of the domains as candidates for these sites. Removal of the positive charge at either location by mutagenesis impairs or abolishes the ability of GH5 to assemble cooperatively in ''tramline'' complexes containing two DNA duplexes, suggesting impairment or loss of its ability to bind two DNA duplexes. The mutant forms of GH5 also fail to protect the additional 20 bp of nucleosomal DNA that are characteristically protected by H1, H5 and wild-type recombinant GH5. They still bind to H1/H5-depleted chromatin, but evidently inappropriately. These results confirm the existence of, and identify the major components of, two DNA-binding sites on the globular domain of histone H5, and they strongly suggest that both binding sites are required to position the globular domain correctly on the nucleosome.     

Mg-induced transition to strongly cooperative binding of histone H1 to linear DNA

By addition of Mg²⁺ ions to histone H1-DNA complexes formed at 20mM NaCl a transition to strongly cooperative binding of histone H1 to DNA is induced. In the analytical ultracentrifuge, above a critical Mg²⁺ concentration of about 0.05 mM, the single component representing the original H1-DNA complex is replaced by two components: a higher order H1-DNA complex type characterized by a much higher sedimentation coefficient, and a slow-sedimenting component consisting of essentially H1-free DNA above 0.1 mM Mg^2-. The fast complex diappears upon removal of Mg²⁺, showing that the process is reversible, and also upon addition of urea. Electron microscopy shows the cooperatively formed H1-DNA complexes to appear predominatly as loosely twisted cable rings in unfixed specimens, and as strongly condensed circular structures of different diameter, but approximately uniform thickness (of about 12nm) after fixation with glutaraldehyde. Besides these higher order structures, only single fibres indistinguishable from control DNA may be seen; individual double fibres which, in the absence of Mg²⁺, represent the predominant H1-DNA complexe structure at about 0.4–0.8 w/w H1/DNA are no longer visible. The transition to strongly cooperative binding of H1 occurs at approximately the same Mg²⁺ concentration which is known to induce the folding of the 10 nm nucleosome chain into the 30nm solenoid structure of chromatin.     

Histone H1 preferentially binds to superhelical DNA molecules of higher compaction.

In chromatin, the physiological amount of H1 is one molecule per nucleosome or, roughly, one molecule per 200 bp of DNA. We observed that at such a stoichiometry, H1 selectively binds to supercoiled DNA with magnitude of sigma > or = 0.012 (both negative and positive), leaving relaxed, linear, or nicked DNA molecules unbound. When negative and positive DNA topoisomers of varying superhelicity are simultaneously present in the binding mixture, H1 selectively binds to the molecules with highest superhelicity; less supercoiled forms are gradually involved in binding upon increasing the amount of input protein. We explain this topological preference of H1 as the consequence of an increased probability for more than one H1-DNA contact provided by the supercoiling. The existence of simultaneous contacts of H1 with both intertwined DNA strands in the supercoiled DNA molecules is also inferred by topoisomerase relaxation of H1-DNA complexes that had been prefixed with glutaraldehyde.     

The combination of DNA methylation and H1 histone binding inhibits the action of a restriction nuclease on plasmid DNA.

To investigate the potentials of DNA methylation and H1 histone in regulating the action of DNA binding proteins, well ordered complexes were formed by slow salt gradient dialysis of mixtures of H1 histone with either methylated or nonmethylated DNA. The sites methylated in the plasmids were CCGG. Methylation of cytosine in this site protects the DNA against HpaII endonuclease but not against MspI. However, when the methylated DNA was complexed to H1, it was protected against MspI. The protection was only effective for a subset of the MspI restriction sites. The protection of DNA afforded by the combination of H1 binding and DNA methylation did not apply to EcoRI, PstI, or BamHI sites and so did not seem to be due to aggregation of the DNA by H1 histone. Gel retardation assays indicated that the affinity of H1 for methylated DNA was not detectably different from its affinity for nonmethylated DNA. Probably methylated DNA when bound to H1 is in a conformation that is resistant to MspI endonuclease. Such conformational changes induced by DNA methylation and H1 binding might affect the action of other DNA binding proteins, perhaps in chromatin as well as in H1.DNA complexes.     

Histone H1-DNA interactions and their relation to chromatin structure and function

The belief that histone H1 interacts primarily with DNA in chromatin and much less with the protein component has led to numerous studies of artificial H1-DNA complexes. This review summarizes and discusses the data on different aspects of the interaction between the linker histone and naked DNA, including cooperativity of binding, preference for supercoiled DNA, selectivity with respect to base composition and nucleotide sequence, and effect of H1 binding on the conformation of the underlying DNA. The nature of the interaction, the structure of the complexes, and the role histone H1 exerts in chromatin are also discussed.     

Identification of non-telomeric G4-DNA binding proteins in human,E. coli,yeast, and Arabidopsis

G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.     

Co-operative binding of the globular domain of histone H5 to DNA.

The globular domain of histone H5 (GH5) was prepared by trypsin digestion of H5 that was extracted from chicken erythrocyte nuclei with NaCl. Electron microscopy, sucrose gradient centrifugation, native agarose gel electrophoresis and equilibrium density gradient ultracentrifugation show that GH5 binds co-operatively to double-stranded DNA. The electron microscopic images suggest that the GH5-DNA complexes are very similar in structure to co-operative complexes of intact histone H1 (or its variants) with double-stranded DNA, studied previously, which have been proposed to consist of two parallel DNA double helices sandwiching a polymer of the protein. For complexes with GH5 or with intact H1, naked DNA co-sediments with the protein-DNA complexes through sucrose gradients, and DNA also appears to protrude from the ends and sides of the complexes; measurements of the protein-DNA stoichiometry in fractionated samples may not reflect the stoichiometry in the complexes. An estimate of the stoichiometry obtained from the buoyant density of fixed GH5-DNA complexes in CsCl suggests that sufficient GH5 is present in the complexes for the GH5s to be in direct contact, as required by a simple molecular mechanism for the co-operative binding. Chemical crosslinking demonstrates that GH5s are in close proximity in the complexes. In the absence of DNA, GH5-GH5 interactions are weak or non-existent.     

Crystal structure of the DNA binding domain of the replication initiation protein E1 from papillomavirus

Papillomaviral infection causes both benign and malignant lesions and is a necessary cause of cervical carcinoma. Replication of this virus requires the replication initiation proteins E1 and E2, which bind cooperatively at the origin of replication (ori) as an (E1)2-(E2)2-DNA complex. This is a precursor to larger E1 complexes that distort and unwind the ori. We present the crystal structure of the E1 DNA binding domain refined to 1.9 A resolution. Residues critical for DNA binding are located on an extended loop and an alpha helix. We identify the E1 dimerization surface by selective mutations at an E1/E1 interface observed in the crystal and propose a model for the (E1)2-DNA complex. These and other observations suggest how the E1 DNA binding domain orchestrates assembly of the hexameric helicase on the ori.     

Interaction of spermine with different forms of DNA. A conformational study

The energy of interaction of a spermine molecule with the A - and B -forms of DNA has been calculated, assuming that the molecule of spermine is fixed in the narrow groove of the DNA helix with the formation of hydrogen bonds between the amino groups of spermine and the phosphate groups of DNA. The atom–atom potentials method was used. Optimal structures for the A-DNA–spermine and B-DNA–spermine complexes are suggested. It is shown that, in agreement with the experimental data, the interaction of the spermine molecule with the A -DNA is energetically more favorable than that with the B -DNA. Two main factors are responsible for this: (1) the distance between neighboring phosphates of the chain in A -DNA (which is about 1 Å less than that in B -DNA) corresponds better to the distance between the amino groups of the propyl part of spermine; and (2) the orientation of phosphate groups in A -DNA inside the groove is preferable for complex formation with spermine to the outside groove arrangement of the phosphates in B -DNA. These conclusions are further confirmed by the calculations for DNA–propane diamine complexes.     

Salt-dependent co-operative interaction of histone H1 with linear DNA

The nature of the complexes formed between histone H1 and linear double-stranded DNA is dependent on ionic strength and on the H1 : DNA ratio. At an input ratio of less than about 60% (w/w) H1 : DNA, there is a sharp transition from non-co-operative to co-operative binding at a critical salt concentration that depends on the DNA size and is in the range 20 to 50 mM-NaCl. Above this critical ionic strength the H1 binds to only some of the DNA molecules leaving the rest free, as shown by sedimentation analysis. The ionic strength range over which this change in behaviour occurs is also that over which chromatin folding is induced. Above the salt concentration required for co-operative binding of H1 to DNA, but not below it, H1 molecules are in close proximity as shown by the formation of H1 polymers upon chemical cross-linking. The change in binding mode is not driven by the folding of the globular domain of H1, since this is already folded at low salt in the presence of DNA, as indicated by its resistance to tryptic digestion. The H1-DNA complexes at low salt, where H1 is bound distributively to all DNA molecules, contain thickened regions about 6 nm across interspersed with free DNA, as shown by electron microscopy. The complexes formed at higher salt through co-operative interactions are rods of relatively uniform width (11 to 15 nm) whose length is about 1.6 times shorter than that of the input DNA, or are circular if the DNA is long enough. They contain approximately 70% (w/w) H1 : DNA and several DNA molecules. These thick complexes can also be formed at low salt (15 mM-NaCl) when the H1 : DNA input ratio is sufficiently high (approximately 70%).     

DNA cleavage assay for the identification of topoisomerase I inhibitors

The inhibition of DNA topoisomerase I (Top1) has proven to be a successful approach in the design of anticancer agents. However, despite the clinical successes of the camptothecin derivatives, a significant need for less toxic and more chemically stable Top1 inhibitors still persists. Here, we describe one of the most frequently used protocols to identify novel Top1 inhibitors. These methods use uniquely 3'-radiolabeled DNA substrates and denaturing polyacrylamide gel electrophoresis to provide evidence for the Top1-mediated DNA cleaving activity of potential Top1 inhibitors. These assays allow comparison of the effectiveness of different drugs in stabilizing the Top1-DNA intermediate or cleavage (cleavable) complex. A variation on these assays is also presented, which provides a suitable system for determining whether the inhibitor blocks the forward cleavage or religation reactions by measuring the reversibility of the drug-induced Top1-DNA cleavage complexes. This entire protocol can be completed in approximately 2 d.     

Methylated DNA Immunoprecipitation

The identification of DNA methylation patterns is a common procedure in the study of epigenetics, as methylation is known to have significant effects on gene expression, and is involved with normal development as well as disease ^1-4. Thus, the ability to discriminate between methylated DNA and non-methylated DNA is essential for generating methylation profiles for such studies. Methylated DNA immunoprecipitation (MeDIP) is an efficient technique for the extraction of methylated DNA from a sample of interest ^5-7. A sample of as little as 200 ng of DNA is sufficient for the antibody, or immunoprecipitation (IP), reaction. DNA is sonicated into fragments ranging in size from 300-1000 bp, and is divided into immunoprecipitated (IP) and input (IN) portions. IP DNA is subsequently heat denatured and then incubated with anti-5''mC, allowing the monoclonal antibody to bind methylated DNA. After this, magnetic beads containing a secondary antibody with affinity for the primary antibody are added, and incubated. These bead-linked antibodies will bind the monoclonal antibody used in the first step. DNA bound to the antibody complex (methylated DNA) is separated from the rest of the DNA by using a magnet to pull the complexes out of solution. Several washes using IP buffer are then performed to remove the unbound, non-methylated DNA. The methylated DNA/antibody complexes are then digested with Proteinase K to digest the antibodies leaving only the methylated DNA intact. The enriched DNA is purified by phenol:chloroform extraction to remove the protein matter and then precipitated and resuspended in water for later use. PCR techniques can be used to validate the efficiency of the MeDIP procedure by analyzing the amplification products of IP and IN DNA for regions known to lack and known to contain methylated sequences. The purified methylated DNA can then be used for locus-specific (PCR) or genome-wide (microarray and sequencing) methylation studies, and is particularly useful when applied in conjunction with other research tools such as gene expression profiling and array comparative genome hybridization (CGH) ⁸. Further investigation into DNA methylation will lead to the discovery of new epigenetic targets, which in turn, may be useful in developing new therapeutic or prognostic research tools for diseases such as cancer that are characterized by aberrantly methylated DNA ^{2, 4, 9-11}.     

TDP1 facilitates chromosomal single-strand break repair in neurons and is neuroprotective in vivo

Defective Tyrosyl-DNA phosphodiesterase 1 (TDP1) can cause spinocerebellar ataxia with axonal neuropathy (SCAN1), a neurodegenerative syndrome associated with marked cerebellar atrophy and peripheral neuropathy. Although SCAN1 lymphoblastoid cells show pronounced defects in the repair of chromosomal single-strand breaks (SSBs), it is unknown if this DNA repair activity is important for neurons or for preventing neurodegeneration. Therefore, we generated Tdp1-/- mice to assess the role of Tdp1 in the nervous system. Using both in vitro and in vivo assays, we found that cerebellar neurons or primary astrocytes derived from Tdp1-/- mice display an inability to rapidly repair DNA SSBs associated with Top1-DNA complexes or oxidative damage. Moreover, loss of Tdp1 resulted in age-dependent and progressive cerebellar atrophy. Tdp1-/- mice treated with topotecan, a drug that increases levels of Top1-DNA complexes, also demonstrated significant loss of intestinal and hematopoietic progenitor cells. These data indicate that TDP1 is required for neural homeostasis, and reveal a widespread requisite for TDP1 function in response to acutely elevated levels of Top1-associated DNA strand breaks.     

The C6 zinc cluster dictates asymmetric binding by HAP1.

Unlike other C6 zinc cluster proteins such as GAL4 and PPR1, HAP1 binds selectively to asymmetric DNA sites containing a direct repeat of two CGG triplets. Here, we show that the HAP1 zinc cluster is solely responsible for asymmetric binding by HAP1. An asymmetric interaction between two zinc clusters of a HAP1 dimer must position the zinc clusters in a directly repeated orientation, and enable them to recognize two CGG triplets in a direct repeat. Further, our data suggest that this asymmetric interaction acts cooperatively with the interaction between dimerization elements to promote HAP1 dimerization, and locks HAP1-DNA complexes in a stable, dimeric conformation.     

Complexes of DNA with histones f2a2 and f3. Circular dichroism studies.

Two histones from calf thymus, the slightly lysine-rich histone f2a2 and the arginine-rich f3, were combined separately, with homologous DNA. The complexes were reconstituted by means of guanidine hydrochloride gradient dialysis, and their circular dichroic (CD) spectra were examined in 0.14 M NaCl. The CD spectra of f2a2-DNA complexes are characterized by a positive band at 272 nm which is blue-shifted and greatly enhanced relative to the corresponding band for native DNA. This type of CD change was noted previously with f2a1-DNA and f2b-DNA complexes. In contrast, f3 histone causes only minor distortions in the DNA CD spectrum, and their character depends upon the state of the two sulfhydryl groups in f3. When the cysteines are reduced, f3-DNA complexes have a slightly increased positive band with a small blue shift; when oxidized disulfide is the predominant form, this CD band becomes slightly smaller than native DNA value. This laboratory has now examined complexes reconstituted from DNA and all five histones of calf thymus. The sum of the CD spectra of these complexes, although very similar to the CD curve for reconstituted complexes containing whole histone, does not approximate that of chromatin; the consequence of this observation is discussed.