Polymerase-dependent DNA synthesis from phosphoramidate-activated nucleotides

Nucleoside triphosphate mimetics, which are substrates for polymerases, can be used in the enzymatic synthesis of nucleic acids. Alternatively, they might also become reversible or irreversible enzyme inhibitors. In order to analyze the effects of 5'-phosphoramidate modification of deoxynucleotide in DNA synthesis, 3-phosphono-L-Ala-dNMP (N = A, T, or G) were evaluated as substrates of HIV-1 RT, Vent (exo(-)), and Therminator polymerase, respectively. The DNA-dependent DNA polymerase activity is significantly higher for Vent exo(-) polymerase than for HIV-1 RT, which is reflected by the capacity of Vent exo(-) polymerase to efficiently synthesize DNA without stalling effects. In addition, Vent (exo(-)) polymerase proved to be more accurate than Therminator polymerase, based on Watson-Crick base-pairing. The optimal yield (88%-97%) of full-length elongation can be obtained in 60 minutes by Vent (exo(-)) polymerase at 0.025 U/μL, with the phosphoramidate analogues as substrates. These data led us to conclude that the optimal pyrophosphate mimetic for the enzyme-catalyzed synthesis of DNA is polymerase dependent.     

Synthesis and recognition by DNA polymerases of a reactive nucleoside, 1-(2-deoxy-beta-D-erythro-pentofuranosyl)-imidazole-4-hydrazide

We report the synthesis of a new nucleoside, 1-(2-deoxy-beta-D-erythro-pentofuranosyl)-imidazole-4-hydrazide (dY(NH2)) as a reactive monomer for DNA diversification. The 5'-triphosphate derivative (dY(NH2)TP, 1) was evaluated in vitro as a substrate for several DNA polymerases. Primer extension reactions showed that dYNH2TP was well tolerated by KF (exo(-)) and Vent (exo-) DNA polymerases. One dYNH2MP was incorporated opposite each canonical base with an efficiency depending on the template base (A approximately T > G > C). Significant elongation after YNH2 incorporation was observed independently of the YNH2:N base pair formed. When the nucleobase YNH2 was incorporated into synthetic oligodeoxynucleotides via the phosphoramidite derivative 11, it directed the insertion of natural bases as well as itself. The mutagenicity of dYNH2TP was evaluated by PCR amplification using Vent (exo-) DNA polymerase. The triphosphate dY(NH2)TP was preferentially incorporated as a dATP or dGTP analogue and led to misincorporations at frequencies of approximately 2 x 10(-2) per base per amplification. A high proportion of transversions with a large distribution of all possible mutations was obtained. The reactivity of the nucleobase YNH2 within a template with several aldehydes was demonstrated.     

In vitro replication slippage by DNA polymerases from thermophilic organisms

Replication slippage of DNA polymerases is a potential source of spontaneous genetic rearrangements in prokaryotic and eukaryotic cells. Here we show that different thermostable DNA polymerases undergo replication slippage in vitro, during single-round replication of a single-stranded DNA template carrying a hairpin structure. Low-fidelity polymerases, such as Thermus aquaticus (Taq), high-fidelity polymerases, such as Pyrococcus furiosus (Pfu) and a highly thermostable polymerase from Pyrococcus abyssi (Pyra exo(-)) undergo slippage. Thermococcus litoralis DNA polymerase (Vent) is also able to slip; however, slippage can be inhibited when its strand-displacement activity is induced. Moreover, DNA polymerases that have a constitutive strand-displacement activity, such as Bacillus stearothermophilus DNA polymerase (Bst), do not slip. Polymerases that slip during single-round replication generate hairpin deletions during PCR amplification, with the exception of Vent polymerase because its strand-displacement activity is induced under these conditions. We show that these hairpin deletions occurring during PCR are due to replication slippage, and not to a previously proposed process involving polymerization across the hairpin base.     

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.     

Enzymatic incorporation in DNA of 1,5-anhydrohexitol nucleotides

The ability of several DNA polymerases to catalyze the template-directed synthesis of duplex oligonucleotides containing a base pair between a nucleotide with anhydrohexitol ring and its natural complement has been investigated. All DNA polymerases were able to accept the chemically synthesized anhydrohexitol triphosphate as substrate and to catalyze the incorporation of one anhydrohexitol nucleotide. However, only family B DNA polymerases succeeded in elongating the primer after the incorporation of an anhydrohexitol nucleotide. In this family, Vent (exo(-)) DNA polymerase is the most successful one and was therefore selected for further investigation. Results revealed that at high enzyme concentrations six hATPs could be incorporated; however, a selective incorporation proved only feasible under experimental conditions where no more than two analogues could be inserted. Also the synthesis of a mixed HNA-DNA sequence was examined. Kinetic parameters for incorporation of one anhydrohexitol adenine nucleoside were similar to those of its natural analogue.     

Substrate Properties of New Fluorescently Labeled Deoxycytidine Triphosphates in Enzymatic Synthesis of DNA with Polymerases of Families A and B

The efficiency of the incorporation of fluorescently labeled derivatives of 2'-deoxycytidine in DNA synthesized de novo has been studied using PCR with Taq and Tth polymerases of family A and Vent (exo–) and Deep Vent (exo–) polymerases of family B. Four derivatives of 5'-triphosphate-2'-deoxycytidine (dCTP) have different chemical structures of the indodicarbocyanine dye and Cy5 analogue attached to position 5 of cytosine. The kinetics of the accumulation of the PCR products and the intensity of the fluorescent signals in the hybridization analysis with immobilized DNA probes depend on the modification of the fluorescently labeled dCTP counterpart, its concentration, and the type of DNA polymerase. All labeled triphosphates showed some inhibitory effects on PCR. The best balance between the efficiency of incorporating labeled cytidine derivatives and the negative effect on the PCR kinetics has been shown in the case of Hot Taq polymerase in combination with the Cy5-dCTP analogue, which contains containing electrically neutral chromophore, the axis of which is a continuation of the linker between the chromophore and the pyrimidine base.     

PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.

The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) < Deep Vent (2.7 x 10(-6)) < Vent (2.8 x 10(-6)) < Taq (8.0 x 10(-6)) < < exo- Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.     

New performance from an old member: SNP assay and de novo sequencing mediated by exo+ DNA polymerases

DNA polymerases without the 3' exonuclease function (exo(-) pol) have been widely used in sequencing and SNP genotyping. As a major player that expedited the coming of the postgenomic era, exo(-) polymerases worked remarkably well in the Human Genome Sequencing Project. However, it has become a challenge for this class of polymerases to efficiently screen the large number of SNPs that are found in the human genome. For more than three decades it has been recognized that polymerase fidelity varied according to the presence of proofreading activity that is mediated by its internal 3' exonuclease. Polymerases with proofreading function are famous for their high fidelity in DNA replication both in vivo and in vitro, but this well-known class of polymerases has been almost completely neglected in genetic analysis in the postgenomic era. We speculate that exo(+) polymerases may exhibit higher nucleotide identification ability when compared to exo- polymerases for an in vitro genetic analysis. With the application of exo(+) polymerases in SNP assays, a novel mechanism for the maintenance of DNA replication, the on/off switch, was discovered. Two new SNP assays have been developed to carry out genome-wide genotyping, taking advantage of the enzymatic properties of exo(+) polymerases. Furthermore, the on/off switch mechanism embodies a powerful nucleotide identification ability, which can be used to discriminate the bases that are upstream of the 3' terminus, and thus defines a new concept in de novo sequencing technology. Application of exo(+) polymerases to genetic analysis, and especially SNP assays, will greatly accelerate the pace to personalized medicine.     

Comparative kinetics of nucleotide analog incorporation by vent DNA polymerase

Comparative kinetic and structural analyses of a variety of polymerases have revealed both common and divergent elements of nucleotide discrimination. Although the parameters for dNTP incorporation by the hyperthermophilic archaeal Family B Vent DNA polymerase are similar to those previously derived for Family A and B DNA polymerases, parameters for analog incorporation reveal alternative strategies for discrimination by this enzyme. Discrimination against ribonucleotides was characterized by a decrease in the affinity of NTP binding and a lower rate of phosphoryl transfer, whereas discrimination against ddNTPs was almost exclusively due to a slower rate of phosphodiester bond formation. Unlike Family A DNA polymerases, incorporation of 9-[(2-hydroxyethoxy)methyl]X triphosphates (where X is adenine, cytosine, guanine, or thymine; acyNTPs) by Vent DNA polymerase was enhanced over ddNTPs via a 50-fold increase in phosphoryl transfer rate. Furthermore, a mutant with increased propensity for nucleotide analog incorporation (Vent(A488L) DNA polymerase) had unaltered dNTP incorporation while displaying enhanced nucleotide analog binding affinity and rates of phosphoryl transfer. Based on kinetic data and available structural information from other DNA polymerases, we propose active site models for dNTP, ddNTP, and acyNTP selection by hyperthermophilic archaeal DNA polymerases to rationalize structural and functional differences between polymerases.     

Biochemical studies on the mutagen, 6-N-hydroxylaminopurine. Synthesis of the deoxynucleoside triphosphate and its incorporation into DNA in vitro

The nucleotide analogue, 6-N-hydroxylaminopurine deoxynucleoside triphosphate (dHAPTP) has been synthesized from 6-chloropurine by a procedure involving both enzymatic and chemical reagents. In a series of experiments involving several different DNA polymerases including 3 procaryotic and 2 eucaryotic enzymes, it was shown that dHAPTP is ambiguous in its base-pairing characteristics, since it can replace both dATP and dGTP in DNA synthesis. It was also shown that different enzymes have different capacities to distinguish dHAPTP from the canonical deoxynucleoside triphosphates. These results are consistent with (but do not prove) the hypothesis that the mechanism of 6-N-hydroxylaminopurine mutagenesis seen in both eucaryotic and procaryotic organisms is due to its conversion, in vivo, to a deoxynucleoside triphosphate which is incorporated ambiguously for dATP and dGTP during DNA replication.     

Replication slippage of different DNA polymerases is inversely related to their strand displacement efficiency.

Replication slippage is a particular type of error caused by DNA polymerases believed to occur both in bacterial and eukaryotic cells. Previous studies have shown that deletion events can occur in Escherichia coli by replication slippage between short duplications and that the main E. coli polymerase, DNA polymerase III holoenzyme is prone to such slippage. In this work, we present evidence that the two other DNA polymerases of E. coli, DNA polymerase I and DNA polymerase II, as well as polymerases of two phages, T4 (T4 pol) and T7 (T7 pol), undergo slippage in vitro, whereas DNA polymerase from another phage, Phi29, does not. Furthermore, we have measured the strand displacement activity of the different polymerases tested for slippage in the absence and in the presence of the E. coli single-stranded DNA-binding protein (SSB), and we show that: (i) polymerases having a strong strand displacement activity cannot slip (DNA polymerase from Phi29); (ii) polymerases devoid of any strand displacement activity slip very efficiently (DNA polymerase II and T4 pol); and (iii) stimulation of the strand displacement activity by E. coli SSB (DNA polymerase I and T7 pol), by phagic SSB (T4 pol), or by a mutation that affects the 3' --> 5' exonuclease domain (DNA polymerase II exo(-) and T7 pol exo(-)) is correlated with the inhibition of slippage. We propose that these observations can be interpreted in terms of a model, for which we have shown that high strand displacement activity of a polymerase diminishes its propensity to slip.     

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.     

2'-Fluoro modified nucleic acids: polymerase-directed synthesis, properties and stability to analysis by matrix-assisted laser desorption/ionization mass spectrometry.

Fragmentation is a major factor limiting mass range and resolution in the analysis of DNA by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS). Protonation of the nucleobase leads to base loss and backbone cleavage by a mechanism similar to the depurination reactions employed in the chemical degradation method of DNA sequencing. In a previous study [Tang,W., Zhu,L. and Smith,L.M. (1997) Anal. Chem ., 69, 302-312], the stabilizing effect of substituting the 24 hydrogen with an electronegative group such as hydroxyl or fluorine was investigated. These 24 substitutions stabilized the N-glycosidic linkage, blocking base loss and subsequent backbone cleavage. For such chemical modifications to be of practical significance, it would be useful to be able to employ the corresponding 24-modified nucleoside triphosphates in the polymerase-directed synthesis of DNA. This would provide an avenue to the preparation of 24-modified PCR fragments and dideoxy sequencing ladders stabilized for MALDI analysis. In this paper methods are described for the polymerase-directed synthesis of 24-fluoro modified DNA, using commercially available 24-fluoronucleoside triphosphates. The ability of a number of DNA and RNA polymerases to incorporate the 24-fluoro analogs was tested. Four thermostable DNA polymerases [Pfu (exo-), Vent (exo-), Deep Vent (exo-) and UlTma] were found that were able to incorporate 24-fluoronucleotides with reasonable efficiency. In order to perform Sanger sequencing reactions, the enzymes' ability to incorporate dideoxy terminators in conjunction with the 24-fluoronucleotides was evaluated. UlTma DNA polymerase was found to be the best of the enzymes tested for this purpose. MALDI analysis of enzymatically produced 24-fluoro modified DNA using the matrix 2,5-dihydroxy benzoic acid showed no base loss or backbone fragmentation, in contrast to the extensive fragmentation evident with unmodified DNA of the same sequence.     

A conserved Tyr residue is required for sugar selectivity in a Pol alpha DNA polymerase

Many DNA polymerases select their natural substrates, deoxy- as opposed to ribonucleoside triphosphates, with a selectivity greater than 10000-fold. The function of a highly conserved residue, Tyr416, in the palm domain of the parental enzyme, an exo(-) derivative of RB69 DNA polymerase (gp43), a member of the pol alpha DNA polymerase family, was examined for its role in helping the polymerase discriminate between ribo-, dideoxyribo-, and deoxyribonucleoside triphosphates. The parental enzyme selected dNTPs vs rNTPs with about the same preference as dNTPs vs ddNTPs. Pre-steady-state kinetic analysis was carried out with the parental enzyme and two mutants, Y416A and Y416F. The Y416A mutant incorporated ribonucleotide residues much more efficiently than the parental enzyme, whereas the Y416F mutant was more permissive toward ddNTP vs rNTP utilization than either the Y416A mutant or the parental enzyme. We also found that both dCDP and rCDP inhibited dCTP incorporation by the Y416A mutant, while only dCDP but not rCDP inhibited dCTP incorporation by the parental enzyme and the Y416F mutant. The parental enzyme and the Y416A and Y416F mutants were all able to add araCTP (1-beta-D-arabinofuranosylcytosine-5'-triphosphate) to a primer but with reduced efficiency relative to dCTP. Based on our kinetic results, interpreted in the context of the crystal structure of the RB69 gp43 ternary complex, we suggest that sugar discrimination is provided mainly by the Tyr416 side chain which can sterically block the 2'-OH group of an incoming rNTP.     

3' to 5' exonuclease activity of herpes simplex virus type 1 DNA polymerase modulates its strand displacement activity

Using a minicircle DNA primer-template, the wild-type catalytic subunit of herpes simplex virus type 1 (HSV-1) DNA polymerase (pol) was shown to lack significant strand displacement activity with or without its processivity factor, UL42. However, an exonuclease-deficient (exo(-)) pol (D368A) was capable of slow strand displacement. Although UL42 increased the rate (2/s) and processivity of strand displacement by exo(-) pol, the rate was slower than that for gap-filling synthesis. High inherent excision rates on matched primer-templates and rapid idling-turnover (successive rounds of excision and polymerization) of exo-proficient polymerases correlated with poor strand displacement activity. The results suggest that the exo activity of HSV-1 pol modulates its ability to engage in strand displacement, a function that may be important to the viability and genome stability of the virus.     

Pre-steady-state kinetics of RB69 DNA polymerase and its exo domain mutants: effect of pH and thiophosphoryl linkages on 3'-5' exonuclease activity

DNA polymerases from the A and B families with 3'-5' exonucleolytic activity have exonuclease domains with similar three-dimensional structures that require two divalent metal ions for catalysis. B family DNA polymerases that are part of a replicase generally have a more potent 3'-5' exonuclease (exo) activity than A family DNA polymerases that mainly function in DNA repair. To investigate the basis for these differences, we determined pH-activity profiles for the exonuclease reactions of T4, RB69, and phi29 DNA polymerases as representatives of B family replicative DNA polymerases and the Klenow fragment (KF) as an example of a repair DNA polymerase in the A family. We performed exo assays under single-turnover conditions and found that excision rates exhibited by the B family DNA polymerases were essentially independent of pH between pH 6.5 and 8.5, whereas the exo activity of KF increased 10-fold for each unit increase in pH. Three exo domain mutants of RB69 polymerase had much lower exo activities than the wild-type enzyme and exhibited pH-activity profiles similar to that of KF. On the basis of pH versus activity data and elemental effects obtained using short double-stranded DNA substrates terminating in phosphorothioate linkages, we suggest that the rate of the chemical step is reduced to the point where it becomes limiting with RB69 pol mutants K302A, Y323F, and E116A, in contrast to the wild-type enzyme where chemistry is faster than the rate-determining step that precedes it.     

Structural and functional analysis of biopolymers and their complexes: Enzymatic synthesis of high-modified DNA

Here, we describe the synthesis and purification of six deoxyuridine triphosphate derivatives that contain protein-like functional groups and alkene linkers of various lengths. Using KOD XL and Deep Vent polymerases, these derivatives have been incorporated into single-stranded DNA, achieving a high degree of DNA modification. These polymerases are able to utilize highly modified DNA strands as templates for synthesizing unmodified DNA. The synthesized deoxyuridine triphosphate derivatives are promising as substrates for producing modified aptamers to various target proteins using, e.g., the systematic evolution of ligands by exponential enrichment (SELEX) methodology.     

Synthesis and enzymatic incorporation of photolabile dUTP analogues into DNA and their applications for DNA labeling

Two novel photolabile nucleotide triphosphate (NTP) analogues were synthesized through Sonogashira coupling and their enzymatic incorporation into DNA was evaluated with three different DNA polymerases (Taq, Vent exo- and T4) by polymerase chain reaction. Both nucleotide triphosphate analogues were recognized by these DNA polymerases as substrates for primer extension. Light irradiation of PCR products removed the photolabile group and released the amino and carboxyl moieties. Further site-specific dual-labeling for oligodeoxynucleotides (ODNs) and random labeling for a long DNA construct with fluorophores were successfully achieved with incorporation of the photolabile amine modified deoxyuridine triphosphate (dUnTP).