Synthesis of d(GC) and d(CG) octamers containing alternating phosphorothioate linkages: effect of the phosphorothioate group on the B-Z transition

The synthesis of four oligonucleotides containing alternating phosphorothioate groups, (Rp)-and (Sp)-d[G(p(S)CpG)3p(S)C] and (Rp)- and (Sp)-d[C(p(S)GpC)p(S)G], by the phosphite approach is described. Silica gel to which 2'(3')-O-acetyluridine and 5'-succinyl groups were bound served as support for oligomer synthesis. The syntheses were carried out by dimer addition with presynthesized diastereomerically pure dinucleoside phosphorothioates as building blocks. The products were characterized by 31P NMR, nuclease P1 digestion, and oxidation to the corresponding all-phosphate-containing oligomers. The ability of each oligomer to adopt the Z conformation under high-salt conditions was screened for by circular dichroism spectroscopy. Both (Rp)-d[G(p(S)CpG)3p(S)C] and (Sp)-d[C(p(S)GpC)3p(S)G] are capable of forming Z-type structures at high NaCl concentrations. In the case of (Rp)-d[G(p(S)CpG)3p(S)C] where a phosphorothioate of the Rp configuration occurs 5' to a deoxycytidine residue, the B----Z transition is potentiated in comparison to the unmodified oligomer. (Sp)-d[G(p(S)CpG)3p(S)C] and (Rp)-d[C(p(S)GpC)3p(S)G] retain the B conformation even at high NaCl concentration.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Evidence for DAPI intercalation in CG sites of DNA oligomer [d(CGACGTCG)]2: a 1H NMR study.

The interaction between 4',6-diamidino-2-phenylindole (DAPI) and the DNA oligomer [d(CGACGTCG)]2 has been investigated by proton one- and two-dimensional NMR spectroscopy in solution. Compared with the minor groove binding of the drug to [d(GCGATCGC)]2, previously studied by NMR spectroscopy, the interaction of DAPI with [d(CGACGTCG)]2 appears markedly different and gives results typical of a binding mechanism by intercalation. C:G imino proton signals of the [d(CGACGTCG)]2 oligomer as well as DAPI resonances appear strongly upfield shifted and sequential dipolar connectivities between cytosine and guanine residues show a clear decrease upon binding. Moreover, protons lying in both the minor and major grooves of the DNA double helix appear involved in the interaction, as evidenced principally by intermolecular drug-DNA NOEs. In particular, the results indicate the existence of two stereochemically non-equivalent intercalation binding sites located in the central and terminal adjacent C:G base pairs of the palindromic DNA sequence. Different lifetimes of the complexes were also observed for the two sites of binding. Moreover, due to the fast exchange on the NMR timescale between free and bound species, different interactions in dynamic equilibrium with the observed intercalative bindings were not excluded.     

Effect of distortions in the deoxyribose phosphate backbone conformation of duplex oligodeoxyribonucleotide dodecamers containing GT, GG, GA, AC, and GU base-pair mismatches on 31P NMR spectra

We have previously suggested that variations in the 31P chemical shifts of individual phosphates in duplex oligonucleotides are attributable to torsional angle changes in the deoxyribose phosphate backbone. This hypothesis is not directly supported by analysis of the 1H/31P two-dimensional J-resolved spectra of a number of mismatch dodecamer oligonucleotide duplexes including the following sequences: d-(CGTGAATTCGCG), d(CGUGAATTCGCG), d(CGGGAATTCGCG), d(CGAGAATTCGCG), and d(CGCGAATTCACG). The 31P NMR signals of the dodecamer mismatch duplexes were assigned by 2D 1H/31P pure absorption phase constant time (PAC) heteronuclear correlation spectra. From the assigned H3' and H4' signals, the 31P signals of the base-pair mismatch dodecamers were identified. JH3'-P coupling constants for each of the phosphates of the dodecamers were obtained from 1H/31P J-resolved selective proton flip 2D spectra. By use of a modified Karplus relationship, the C4'-C3'-O3'-P torsional angles (epsilon) were obtained. JH3'-P coupling constants were measured for many of the oligonucleotides as a function of temperature. There exists a good linear correlation between 31P chemical shifts and the epsilon torsional angle. This correlation can be further extended to the C3'-O3'-P-O5' torsional angle (zeta) by using a linear relationship between epsilon and zeta obtained from crystal structure studies. The 31P chemical shifts follow the general observation that the more internally the phosphate is located within the oligonucleotide sequence, the more upfield the 31P resonance occurs. In addition, 31P chemical shifts show sequence- and site-specific variations. Analysis of the backbone torsional angle variations from the coupling constant analysis has provided additional information regarding the origin of these variations in 31P chemical shifts.     

Synthesis and high stability of complementary complexes of N-(2-hydroxyethyl)phenazinium derivatives of oligonucleotides.

Two simple methods for the synthesis of oligonucleotides bearing a N-(2-hydroxyethyl)phenazinium (Phn) residue at the 5'- and/or 3'-terminal phosphate groups are proposed. By forming complexes between a dodecanucleotide d(pApApCpCpTpGpTpTpTpGpGpC), a heptanucleotide d(pCpCpApApApCpA), and Phn derivatives of the latter, it is shown that the introduction of a dye at the end of an oligonucleotide chain strongly stabilizes its complementary complexes. The Tmax and the thermodynamic parameters (delta H, delta S, delta G) of complex formation were determined. According to these data, coupling of a dye with the 5'-terminal phosphate group is the most advantageous: delta G(37 degrees C) is increased by 3.59 +/- 0.04 kcal/mol compared to 2.06 +/- 0.04 kcal/mol for 3'-Phn derivatives. The elongation of the linker, which connects the dye to the oligonucleotide, from a dimethylene up to a heptamethylene usually leads to destabilization of the oligonucleotide complex. The complementary complex formed by the 3',5'-di-Phn derivative of the heptanucleotide was found to be the most stable among all duplexes investigated. Relative to the unmodified complex the increase in free energy was 4.96 +/- 0.04 kcal/mol. The association constant of this modified complex at 37 degrees C is 9.5 x 10(6) M-1, whereas the analogous value for the unmodified complex is only 3 x 10(3) M-1.     

Solution structure of [d(ATGAGCGAATA)]2. Adjacent G:A mismatches stabilized by cross-strand base-stacking and BII phosphate groups.

The solution structure of a rather unusual B-form duplex [d(ATGAGCGAATA)]2 has been determined using two-dimensional nuclear magnetic resonance (2D-NMR) and distance geometry methods. This sequence forms a stable ten base-pair B-form duplex with 3' overhangs and two pairs of adjacent G:A mismatches paired via a sheared hydrogen-bonding scheme. All non-exchangeable protons, including the stereo-specific H-5'S/H-5'R of the 3G and 7G residues, were assigned by 2D-NMR. The phosphorus spectrum was assigned using heteronuclear correlation with H-3' and H-4' reasonances. The complete assignments reveal several unusual nuclear Overhauser enhancements (NOEs) and unusual chemical shifts for the neighboring G:A mismatch pairs and their adjacent nucleotides. Inter-proton distances were derived from time-dependent NOEs and used to generate initial structures, which were further refined by iterative back-calculation of the two-dimensional nuclear Overhauser enhancement spectra; 22 final structures were calculated from the refined distance bounds. All these final structures exhibit fully wound helical structures with small penalty values against the refined distance bounds and small pair-wise root-mean-square deviation values (typically 0.5 A to 0.9 A). The two helical strands exchange base stacking at both of the two G:A mismatch sites, resulting in base stacking down each side rather than down each strand of the twisted duplex. Very large twist angles (77 degrees) were found at the G:A mismatch steps. All the final structures were found to have BII phosphate conformations at the adjacent G:A mismatch sites, consistent with observed downfield 31P chemical shifts and Monte-Carlo conformational search results. Our results support the hypothesis that 31P chemical shifts are related to backbone torsion angles. These BII phosphate conformations in the adjacent G:A mismatch step suggest that hydrogen bonding of the G:A pair G-NH2 to a nearby phosphate oxygen atom is unlikely. The unusual structure of the duplex may be stabilized by strong interstrand base stacking as well as intrastrand stacking, as indicated by excellent base overlap within the mismatch stacks.     

High Field 1H-NMR Analysis of the 1:1 Intercalation Complex of the Antitumor Agent Mitoxantrone and the DNA Duplex [d(CpGpCpG)]2

Abstract

Complete ¹H-nmr assignment has been achieved of the stoichiometric 1:1 complex of the antitumor agent mitoxantrone with the duplex oligomer [d(CpGpCpG)]₂. The techniques used included 2D-COSY, 1D-NOE and 2D-HH-INADEQUATE. Comparisons of ¹H and ¹³C chemical shift changes upon addition of drug suggest symmetrical intercalative binding to the center of the tetramer. NOE difference measurements and ³¹P studies suggest binding of the terminal OH groups of the side chains to the central phosphate groups such that the methylene groups are proximate to C(3)6, C(3)6 and G(4)8 base protons all in the major groove. The data suggest that the side chains bind to the neighboring base pairs from the intercalation site. This is in accord with independent evidence of G,C base preference for binding from spectroscopic and electron microscopy studies.     

Oligodeoxyribonucleoside methylphosphonates. NMR and UV spectroscopic studies of Rp-Rp and Sp-Sp methylphosphonate (Me) modified duplexes of (d[GGAATTCC])2.

1H NMR chemical shift assignments for the title compounds were made for most of the 1H signals using two-dimensional nuclear Overhauser effect (2D-NOE) data, which were also used to establish the absolute configuration at the modified phosphorus. The chemical shifts were similar to those reported [Broido, M.S., et al. (1985) Eur. J. Biochem. 150, 117-128] for the unmodified, parent, B-type duplex [d(GGAATTCC)]2. Differences in chemical shifts were mostly localized to the nucleotides on the 5'- and 3'-sides of the modified phosphorus. The Rp-Rp isomers exhibited UV-derived Tm values similar to that of the parent duplex. On the other hand, the Sp-Sp isomers generally exhibited lower Tm values which correlated with P-CH3--H3' (n-1 nucleotide) cross peak intensities and 31P spectral parameters. The combined data argue for increased steric interactions with the Sp-P-Me methyl group as the modification position is moved toward the center of the oligomer. All of the Tm results can be explained in terms of three factors which result from replacement of a phosphate by a methylphosphonate group: reduction of oligomer charge; electronic and other substituent effects; steric interactions.     

1H and 31P NMR investigations of actinomycin D binding selectivity with oligodeoxyribonucleotides containing multiple adjacent d(GC) sites

Imino proton and 31P NMR studies were conducted on the binding of actinomycin D (ActD) to self-complementary oligodeoxyribonucleotides with adjacent 5'-GC-3' sites. ActD showed very high specificity for binding to GC sites regardless of oligomer length and surrounding sequence. For a first class of duplexes with a central GCGC sequence, a mixture of 1:1 complexes was observed due to the two different orientations of the ActD phenoxazone ring system. Analysis of 1H chemical shifts suggested that the favored 1:1 complex had the benzenoid side of the phenoxazone ring over the G base in the central base pair of the GCGC sequence. This is the first case in which an unsymmetrical intercalator has been shown to bind to DNA in both possible orientations. A unique 2:1 complex, with significantly different 1H and 31P chemical shifts relative to those of the 1:1 complexes, was formed with these same oligomers, again with the benzenoid side of the ActD molecule over the G base of the central GC base pair. There is considerable anticooperativity to binding of the second ActD in a GCGC sequence. In titrations of oligomers with the GCGC sequence, only the two 1:1 complexes are found up to ratios of one ActD per oligomer. Increasing the ActD concentration, however, resulted in stoichiometric formation of the unique 2:1 adduct. Spectrophotometric binding studies indicated that the apparent binding equilibrium constant for a GC site adjacent to a bound site is reduced by approximately a factor of 20 relative to the ActD binding constant to an isolated GC site.     

Dynamics of bases in hydrated [d(CGCGAATTCGCG)]2

Solid-state 2H NMR spectroscopy has been used to investigate the dynamics of a DNA oligonucleotide with a defined sequence, [d(CGCGAATTCGCG)]2, which contains the EcoRI binding site. Quadrupole echo line shapes and spin-lattice relaxation times were obtained as a function of hydration on two different deuterated samples, both in the form of the Na salt. In one sample, the C8 protons of all purines in the self-complementary dodecamer were exchanged for deuterons. In the other sample, a specifically labeled thymidine (C6 deuterated) was synthetically incorporated at the seventh position (counting 5' to 3') in the sequence. The general trends for both samples were quite similar. At all levels of hydration, the data reveal the presence of a rapid, small-amplitude libration of the bases (tau c less than or equal to 1 ns, 6 degrees-10 degrees amplitude). At the higher hydration levels (80% relative humidity or higher), the results indicate the presence of a much slower motion (tau c approximately 10-100 microseconds), which at 80% relative humidity is of small amplitude (approximately 5 degrees) and at higher hydration levels may be of larger amplitude. There is no evidence for large-amplitude (greater than +/- 10 degrees) motion on a nanosecond or faster time scale under any hydration condition. The 2H NMR results were analyzed with a dynamical model which treats the oligonucleotide as a deformable filament and which can include collective torsional fluctuations. The slow motion observed at high hydration levels is attributed to the uniform twisting mode (of the entire helix).(ABSTRACT TRUNCATED AT 250 WORDS)     

Preparation and characterization of oligonucleotides containing S-[2-(N7-guanyl)ethyl]glutathione.

S-[2-(N7-Guanyl)ethyl]glutathione is the major adduct derived from modification of DNA with 1,2-dibromoethane in biological systems and is postulated to be a mutagenic lesion [Humphreys, W. G., Kim, D.-H., Cmarik, J. L., Shimada, T., & Guengerich, F. P. (1990) Biochemistry 29, 10342-10350]. Oligonucleotides containing this modified base were prepared by treatment of oligonucleotides with S-(2-chloroethyl)glutathione and purified by chromatography. The self-complementary oligonucleotide d(ATGCAT), when thus modified at the single guanine, appeared to associate with itself as judged by UV measurements, but CD and NMR measurements indicated a lack of hybridization, with a decrease in the melting temperature of greater than 10 degrees C. The same lack of self-association was noted when d(ATGCAT) was modified to contain an N-acetyl-S-[2-(N7-guanyl)ethyl]cysteine methyl ester moiety. The oligomer d-(C1A2T3G4C5C6T7) was modified to contain a single S-[2-(N7-guanyl)ethyl]glutathione moiety at the central position, and UV, CD, and 1H NMR studies indicated that this oligomer hybridized to its normal complement d(A8G9G10C11A12T13G14), although the binding was considerably weakened by adduction (imino proton NMR spectroscopy in the presence of H2O indicated that the hydrogen bond signals seen in the oligomer were all broadened upon modification). All proton resonances were identified using two-dimensional 1H NMR spectroscopy. Adduct formation affected the chemical shifts of the base and 1', 2', and 2" protons of T3 and C5, the 2" proton of C6, and the 8 and 1' protons of C11, while little effect was observed on other protons. No cross-peaks were detected between the glutathione and oligomer moieties in two-dimensional nuclear Overhauser enhanced NMR studies. These results suggest that a rather local structural perturbation occurs in the DNA oligomer upon modification and that the glutathione moiety appears to be relatively unperturbed by its placement in the duplex. When the cytosine in the normal d(AGGCATG) complement to d-(CATGCCT) was changed to each of the other three potential bases at the central position, no hybridization with the oligomer d(CATGCCT) containing S-[2-(N7-guanyl)ethyl]glutathione was detected. We conclude that these N7-guanyl derivatives destabilize hybridization and that bases other than cytosine do not appear to show preferential thermodynamic bonding to these adducts, at least in the sequences examined to date.(ABSTRACT TRUNCATED AT 400 WORDS)     

1H NMR assignment and melting temperature study of cis-syn and trans-syn thymine dimer containing duplexes of d(CGTATTATGC).d(GCATAATACG)

The preparation and spectroscopic characterization of duplex decamers containing site-specific cis-syn and trans-syn thymine dimers are described. Three duplex decamers, d(CGTATTATGC).d(GCATAATACG), d(CGTAT[c,s]TATGC).d(GCATAATACG), and d(CGTAT[t,s]TATGC).d(GCATAATACG), were prepared by solid-phase phosphoramidite synthesis utilizing cis-syn and trans-syn cyclobutane thymine dimer building blocks (Taylor et al., 1987; Taylor & Brockie, 1988). NMR spectra (500 MHz 2D 1H and 202 MHz 1D 31P) were obtained in "100%" D2O at 10 degrees C, and 1D exchangeable 1H spectra were obtained in 10% D2O at 10 degrees C. 1H NMR assignments for H5, H6, H8, CH3, H1', H2', and H2" were made on the basis of standard sequential NOE assignment strategies and verified in part by DQF COSY data. Comparison of the chemical shift data suggests that the helix structure is perturbed more to the 3'-side of the cis-syn dimer and more to the 5'-side of the trans-syn dimer. Thermodynamic parameters for the helix in equilibrium coil equilibrium were obtained by two-state, all or none, analysis of the melting behavior of the duplexes. Analysis of the temperature dependence of the T5CH3 1H NMR signal gave delta H = 44 +/- 4 kcal and delta S = 132 +/- 13 eu for the trans-syn duplex. Analysis of the concentration and temperature dependence of UV spectra gave delta H = 64 +/- 6 kcal and delta S = 178 +/- 18 eu for the parent duplex and delta H = 66 +/- 7 kcal and delta S = 189 +/- 19 eu for cis-syn duplex. It was concluded that photodimerization of the dTpdT unit to give the cis-syn product causes little perturbation of the DNA whereas dimerization to give the trans-syn product causes much greater perturbation, possibly in the form of a kink or dislocation at the 5'-side of the dimer.     

Structural studies of the O6meG.T interaction in the d(C-G-T-G-A-A-T-T-C-O6meG-C-G) duplex

High-resolution proton and phosphorus NMR studies are reported on the self-complementary d(C1-G2-T3-G4-A5-A6-T7-T8-C9-O6meG10-C11-G12) duplex (henceforth called O6meG.T 12-mer), which contains T3.O6meG10 interactions in the interior of the helix. The imino proton of T3 is observed at 9.0 ppm, exhibits a temperature-independent chemical shift in the premelting transition range, and broadens out at the same temperature as the imino proton of the adjacent G2.C11 toward the end of the helix at pH 6.8. We observed inter base pair nuclear Overhauser effects (NOEs) between the base protons at the T3.O6meG10 modification site and the protons of flanking G2.C11 and G4.C9 base pairs, indicative of the stacking of the T3 and O6meG10 bases into the helix. Two-dimensional correlated (COSY) and nuclear Overhauser effect (NOESY) studies have permitted assignment of the base and sugar H1', H2', and H2' nonexchangeable protons in the O6meG.T 12-mer duplex. The observed NOEs demonstrate an anti conformation about all the glycosidic bonds, and their directionality supports formation of a right-handed helix in solution. The observed NOEs between the T3.O6meG10 interaction and the adjacent G2.C11 and G4.C9 base pairs at the modification site exhibit small departures from patterns for a regular helix in the O6.meG.T 12-mer duplex. The phosphorus resonances exhibit a 0.5 ppm spectral dispersion indicative of an unperturbed phosphodiester backbone for the O6meG.T 12-mer duplex. We propose a model for pairing of T3 and O6meG10 at the modification site in the O6meG.T 12-mer duplex.(ABSTRACT TRUNCATED AT 250 WORDS)     

Phosphorus-31 NMR studies of E. coli ribosomes.

Phosphorus-31 nuclear magnetic resonance spectra, relaxation times and nuclear Overhauser (NOE) enhancement have been measured for E. coli ribosomes, subunits and rRNA. NOE and T1 experiments reveal that the phosphorus relaxation in this organelle is largely dipolar in origin. Moreover these results imply the presence of internal motion within the RNA chain with a correlation time of about 3-5 x 10(-9) sec. In all cases the predominant resonance is centered at about -1.5 ppm (relative to 85% H3PO4) as expected for a phosphodiester linkage where there is a large degree of double helix. The linewidth narrows by about a factor of four when the ribosomal proteins are removed indicating a substantial immobilization of the RNA when it is assembled into the ribosome. In addition to the phosphodiester resonance, ribosomes also reveal one or two narrower resonances shifted to low field by 1-4 ppm. Based on the observation that these resonances show a pH dependent chemical shift, we assign them to phosphate monoesters i.e. terminal 3' or 5' phosphate groups. These terminal phosphates are due to short oligomers of RNA derived from the terminus of the chain.     

Influence of terminal 3' phosphates or 2',3'-cyclic phosphates on the conformations of oligoriboadenylates, oligoribocytidylates, and the corresponding monomers

The circular dichroism spectra of chemically synthesized adenylate and cytidylate dinucleotides and trinucleotides bearing terminal 3' phosphates have been compared under a variety of conditions with the spectra obtained from the corresponding oligomers with 2',3'-terminal cyclic phosphate groups. Similar comparisons for the mononucleotides are also presented. Although the base stacking of an oligomer with a terminal cyclic phosphate might be expected to be greater than that of the corresponding oligomer with a 3' phosphate from charge repulsion considerations, the magnitudes of the Cotton effects in the former class are always considerably smaller than those in the latter class. This suggests a decreased stacking. The implications of these observations are discussed in light of the compelling crystallographic evidence that cytidine 2',3'-cyclic phosphate adopts an unusual sugar puckering and the syn conformation.     

Mechanisms of degradation of 2′-5′ oligoadenylates

We have studied the mechanisms of breakdown of 2'-5' oligoadenylates. We monitored the time-courses of degradation of ppp(A2'p5')nA (dimer to tetramer) and of 5'OH-(A2'p5')nA (dimer to pentamer) in unfractionated L1210 cell extract. The 5' triphosphorylated 2'-5' oligoadenylates are converted by a phosphatase activity. However, 2'-5' oligoadenylates are degraded mainly by phosphodiesterase activity which splits the 2'-5' phosphodiester bond sequentially at the 2' end to yield 5' AMP and one-unit-shorter oligomers. The nonlinear least-squares curve-fitting program CONSAM was used to fit these kinetics and to determine the degradation rate constant of each oligomer. Trimers and tetramers, whether 5' triphosphorylated or not, are degraded at the same rate, whereas 5' triphosphorylated dimer is rapidly hydrolyzed and 5'-OH dimer is the most stable oligomer. The interaction between degradation enzymes and the substrate strongly depends on the presence of a 5' phosphate group in the vicinity of the phosphodiester bond to be hydrolyzed; indeed, when this 5' phosphate group is present, as in pp/pA2'p5'A/or A2'/p5'A2'p5'A/, affinity is high and maximal velocity is low. Such a degradation pattern can control the concentration of 2'-5' oligoadenylates active on RNAse L either by limiting their synthesis (5' triphosphorylated dimer is the primer necessary for the formation of longer oligomers) and/or by converting them into inhibitory (e.g., monophosphorylated trimer) or inactive (e.g., nonphosphorylated oligomers) molecules.     

Determination of nucleic acid backbone conformation by 1H NMR.

In DNA or RNA duplexes, the six-bond C3'-O3'-P-O5'-C5'-C4'-C3' backbone linkage connecting adjacent residues contains six torsion angles (epsilon, zeta, alpha, beta, gamma, delta) but only four protons. This seriously limits the ability to define the backbone conformation by NMR using purely 1H-1H distance geometry (DG) methods. The problem is further compounded by the inability to assign two of the four backbone protons, namely the poorly resolved H5' and H5' protons, and invariably leads to DG structures with poorly defined backbone conformations. We have developed and tested a reliable method to constrain the beta, gamma, and epsilon (and indirectly alpha and zeta) backbone torsion angles by lower-bound NOE distances to unassigned H5'/H5' resonances combined with either 1H line widths or the conservative use of sigma J measurements; the method relies only on 1H 2-D NMR data, does not involve any structural assumptions, and leads to much improved backbone convergence among DG structures. The C4'-C5' torsion angle gamma is constrained by lower-bound NOE distances from H2' and from H6/H8 to any H5'/H5', as well as by sigma JH4, coupling measurements in the 3.9-4.4 ppm region; delta is constrained by H1'-H4' NOE distances and by H3'-H4' and H3'-H2' J couplings in COSY data; epsilon is partially constrained by H3' line width and/or further constrained by subtracting the minimum possible sigma JH3'-H from the observed sigma JH3' (COSY) to arrive at the maximum possible JH3'-P, which is then converted to H3'-P distance bounds. The angle beta is partially constrained via H5'-P and H5'-P distance bounds consistent with the maximum H5'-P and H5'-P J couplings derived from the observed H5' and H5' line widths, while alpha and zeta are indirectly constrained by lower distance bounds on the observed (n)H1' to (n + 1)H5'/H5' NOEs combined with the prior partial constraints on beta, gamma, delta, and epsilon. The combined effects of these additional constraints in determining distance geometry structures have been demonstrated using a 12-base duplex, [d(GCCGTTAACGGC)]2. Coordinate RMSDs per atom between structures refined with these constraints from random-embedded DG structures, from ideal A-DNA, and from B-DNA starting structures were less than 0.4 A for the central 8 base pairs indicating good convergence. All backbone angles for the central 8 base pairs are very well constrained with less than 10 degrees variation in any of the 48 torsion angles.     

Novel DNA superstructures formed by telomere-like oligomers.

DNA oligomers containing three or more contiguous guanines form tetrastranded parallel complexes, G4-DNA, in the presence of alkali cations. However, oligomers that have a single multi-guanine motif at their 3' or 5' end, with a guanine as the terminal base, also form higher order products. Thus, the oligomer T8G3T forms a unique G4-DNA product at neutral pH in the presence of Na+, K+, or Rb+; however, its isomeric counterpart T9G3 in K+ or Rb+ generates an additional ladder of products of substantially lower gel mobility. We show that these larger complexes contain, respectively, 8, 12, or 16 distinct strands of oligomer. The octamer structure formed by T9G3 assembles in moderate salt at room temperature and melts around 60 degrees C in 100 mM KCl. Methylation protection experiments suggest a nested head-to-tail superstructure containing two tetraplexes bonded front-to-back via G quartets formed by out-of-register guanines. Naturally occurring chromosomal telomeres, which all have guanines at their 3' termini, may be able to form these superstructures.     

Sequential assignment of the 1H and 31P resonances of the double stranded deoxynucleotide d (ATGCAT)2 by 2D-NMR correlation spectroscopy

31p-1H and 1H-1H chemical shift correlation spectroscopy are jointly used for providing a complete assignment of sugar proton (except H5' and H5") and phosphorus resonances in the double stranded oligonucleotide d (ATGCAT)2. In contrast to previous methods the specific assignment of overcrowded H5' H5" proton resonances is not required. Using the H3'-P coupling and also the long range H4'-P coupling, this quite general method can be easily implemented on intermediate field spectrometer. The present results pave the way to the 1H and 31P resonance assignment of longer double-stranded oligonucleotides.     

Carbon-13 NMR in conformational analysis of nucleic acid fragments. 3. The magnitude of torsional angle epsilon in d(TpA) from CCOP and HCOP NMR coupling constants.

Carbon-13 NMR spectra of the deoxyribonucleotide d(TpA), 3',5'-cyclic AMP and 3',5'-cyclic dAMP were measured. It is shown that the different substitution of C2' in deoxyribonucleotides versus ribonucleotides does not affect the vicinal C2'-C3'-O3'-P coupling to a measurable extent. Therefore, the same set of Karplus parameters may be used for the C2'-C3-O3'-P couplings in ribonucleotides and in deoxyribonucleotides. Vicinal carbon-phosphorus and proton-phosphorus coupling constants are used to calculate the magnitude of the torsion angle epsilon (C4'-C3'-O3'-P), which amounts to 195(0) in the trans conformer and to 261(0) in the gauche(-) conformer.