Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

The interaction between bovine serum albumin and surfactants.

1. Potassium n-decyl phosphate binds exothermically to bovine serum albumin at pH 7.0 to form a specific complex containing approx. 60 phosphate anions. 2. The formation of the complex is accompanied by changes in the u.v. difference spectrum of the protein. 3. At higher phosphate concentrations (above 0.4mM) surfactant molecules continue to be bound, and the protein undergoes a gross change in conformation. 4. n-Dodecyltri-methylammonium bromide binds endothermically to bovine serum albumin at pH7.0 but the extent of binding for a given free surfactant concentration is less than for the phosphate surfactant. 5. Binding is accompanied by a small change in the specific viscosity and by changes in the u.v. difference spectrum of the protein. 6. It is suggested that over the surfactant concentration ranges studied n-decyl phosphate ions first bind to the C-terminal part of the protein and then to the more compact N-terminal part whereas n-dodecyltrimethylammonium ions bind only to the C-terminal part of bovine serum albumin.     

Spectroscopic study of the interaction between lycopene and bovine serum albumin

The interaction of lycopene with bovine serum albumin (BSA) in aqueous solution was studied by fluorescence quenching, three‐dimensional fluorescence and circular dichroism spectroscopy. The data showed that the fluorescence of BSA was quenched by lycopene at different temperatures through a dynamic mechanism. The evaluation of three‐dimensional fluorescence spectra revealed a conformational modification of BSA induced by coupling with lycopene and an increase in protein diameter as a consequence of the ligand–protein interaction. Moreover, the information obtained from evaluation of the effect of lycopene on BSA conformation by circular dichroism strongly supported the existence of a slight unfolding of BSA induced by coupling to lycopene. Copyright © 2012 John Wiley & Sons, Ltd.     

Spectroscopic studies of interaction between CuO nanoparticles and bovine serum albumin

Recently, the great interests in manufacturing and application of metal oxide nanoparticles in commercial and industrial products have led to focus on the potential impact of these particles on biomacromolecules. In the present study, the interaction of copper oxide (CuO) nanoparticles with bovine serum albumin (BSA) was studied by spectroscopic techniques. The zeta potential value for BSA and CuO nanoparticles with average diameter of around 50 nm at concentration of 10 μM in the deionized (DI) water were ?5.8 and ?22.5 mV, respectively. Circular dichroism studies did not show any changes in the content of secondary structure of the protein after CuO nanoparticles interaction. Fluorescence data revealed that the fluorescence quenching of BSA by CuO nanoparticles was the result of the formed complex of CuO nanoparticles – BSA. Binding constants and other thermodynamic parameters were determined at three different temperatures. The hydrogen bond interactions are the predominant intermolecular forces to stabilize the CuO nanoparticle – BSA complex. This study provides important insight into the interaction of CuO nanoparticles with proteins, which may be of importance for further application of these nanoparticles in biomedical applications.     

Studies on the interaction between tetraphenylporphyrin compounds and bovine serum albumin.

The interaction of three porphyrin compounds with bovine serum albumin (BSA) was examined by fluorescence emission spectra at the excitation wavelength 280 nm and in UV-Vis absorption spectra. Through fluorescence quenching experiments, it was confirmed that the combination of three porphyrin compounds with BSA was a single static quenching process. The binding constant K(A), the thermodynamic parameters enthalpy change (DeltaH(0)), Gibbs free energy change (DeltaG(0)) and entropy change (DeltaS(0)) were obtained. It was found that hydrophobic interaction played a main role in tetraphenylporphyrin (TPP) or tetraparacholophenylporphyrin (TClPP) binding to BSA, while tetraparamethoxyphenylporphyrin (TMEOPP) mainly based on van der Waals' force. According to F?ster energy transfer, the separate distance r, the energy transfer efficiency E and F?ster radium R(0) were calculated. The results obtained from the above experiments showed that three porphyrin compounds were tightly bound to BSA.     

Spectroscopy and docking simulations of the interaction between lochnericine and bovine serum albumin

Lochnericine (LOC) is a component of Voacanga africana, which is a type of traditional medical food in Africa widely used for treating diseases. In this article, the interaction between LOC and bovine serum albumin (BSA) was studied by fluorescence spectroscopy. Furthermore, Fourier transform infrared (FTIR), Raman and circular dichroism (CD) were used to investigate the structural changes of BSA. The experimental results consistently indicated that LOC changed the secondary structure of BSA. Three structure‐similar components were used to study the interference experiments. The molecular modeling results showed that LOC could bind within not only sites I and II, but also bind the cavity of subdomain IB. Copyright © 2014 John Wiley & Sons, Ltd.     

Characterization of the interaction between reserpine and bovine serum albumin: spectroscopic approaches

The characteristics of the interaction between reserpine and bovine serum albumin (BSA) were studied by fluorescence, UV-vis absorption and Fourier transform infrared (FT-IR) spectroscopy. Spectroscopic analysis revealed that fluorescence quenching of BSA by reserpine was through a static quenching procedure. The binding constant K(A) of reserpine with BSA at 293, 301 and 309 K was 1.63, 1.78 and 2.35 x 10(5) moL(-1) L respectively, which indicated degree of binding force between reserpine and BSA. There was one binding site between reserpine and BSA. The entropy and enthalpy changes were positive, indicating that interaction of reserpine and BSA was driven mainly by hydrophobic forces. The average binding distance between the donor (BSA) and the acceptor (reserpine) was about 3.84 nm based on the Forster non-radiation energy transfer theory. Results of synchronous fluorescence and FT-IR spectra indicated that the conformation and microenvironment of BSA were changed by the binding of reserpine. The results may provide important insights into the physiological activity of reserpine.     

Electrostatic interaction and complex formation between gum arabic and bovine serum albumin

The interaction of gum arabic (GA) and bovine serum albumin (BSA) has been investigated through turbidity and light scattering intensity measurements and by the use of dynamic light scattering, laser Doppler velocimetry, and isothermal titration calorimetry. It has been shown that GA and BSA can form soluble and insoluble complexes depending on the solution pH and the mixing ratio and is a function of the net charge on the complex. Soluble complexes were obtained when the electrophoretic mobility was greater than ±1. 5 μm s(-1) V(-1) cm(-1). Changes in the value of the isoelectric point of the complexes with mixing ratio and isothermal titration calorimetric data indicated that complexes formed at pHs 3 and 4 consisted of ～60 BSA molecules for every GA molecule, while at pH 5 there were ～10 BSA molecules per GA molecule. Calorimetric studies also indicated that the interaction occurred in two stages at both pH 3 and pH 4, but that the nature of the interaction at these two pH values was significantly different. This was attributed to differences in the relative magnitude of the positive and negative charges on the BSA and GA, respectively, and possibly due to changes in the BSA conformation. The fact that there is an interaction at pH 5, which is above the isoelectric point of the BSA, is due to the interaction of the carboxylate groups on the GA with positive patches on the BSA or to the charge regulation of the protein-polysaccharide system brought about by changes in dissociation equilibria. Complexation is reduced as the ionic strength of the solvent increases and is prevented at a NaCl concentration of 120 mM.     

Studies on the interaction between benzophenone and bovine serum albumin by spectroscopic methods

The interaction between benzophenone (BP) and bovine serum albumin (BSA) was investigated by the methods of fluorescence spectroscopy combined with UV–Vis absorption and circular dichroism (CD) measurements under simulative physiological conditions. The experiment results showed that the fluorescence quenching of BSA by BP was resulted from the formation of a BP–BSA complex and the corresponding association constants (K _a) between BP and BSA at four different temperatures had been determined using the modified Stern–Volmer equation. The enthalpy change (ΔH) and entropy change (ΔS) were calculated to be –43.73 kJ mol⁻¹ and −53.05 J mol⁻¹ K⁻¹, respectively, which suggested that hydrogen bond and van der Waals force played major roles in stabilizing the BP–BSA complex. Site marker competitive experiments indicated that the binding of BP to BSA primarily took place in site I (sub-domain IIA). The conformational investigation showed that the presence of BP decreased the α-helical content of BSA and induced the slight unfolding of the polypeptides of protein, which confirmed some micro-environmental and conformational changes of BSA molecules.     

Studies on the interaction between Oxaprozin-E and bovine serum albumin by spectroscopic methods

The interaction between Oxaprozin-E and bovine serum albumin (BSA) was studied by spectroscopic methods including fluorescence and UV–vis absorption spectroscopy. The quenching mechanism of fluorescence of BSA by Oxaprozin-E was discussed to be a dynamic quenching procedure. The number of binding sites n and apparent binding constant K was measured by fluorescence quenching method. The thermodynamics parameter ΔH, ΔG, ΔS were calculated. The results indicate the binding reaction was mainly entropy-driven and hydrophobic forces played major role in the binding reaction. The distance r between donor (BSA) and acceptor (Oxaprozin-E) was obtained according to Förster theory of non-radioactive energy transfer.     

Studies on the interaction between benzidine and bovine serum albumin by spectroscopic methods

The interaction between bovine serum albumin (BSA) and benzidine (BD) in aqueous solution was investigated by fluorescence spectroscopy, circular dichroism (CD) spectra and UV–Vis spectroscopy, as well as resonance light scattering spectroscopy (RLS). It was proved from fluorescence spectra that the fluorescence quenching of BSA by BD was a result of the formation of BD–BSA complex, and the binding constants (K _a) were determined according to the modified Stern–Volmer equation. The enthalpy change (ΔH) and entropy change (ΔS) were calculated to be ?34.11 kJ mol^?1 and ?25.89 J mol^?1 K^?1, respectively, which implied that van der Waals force and hydrogen bond played predominant roles in the binding process. The addition of increasing BD to BSA solution caused the gradual enhancement in RLS intensity, exhibiting the forming of the aggregate. Moreover, the competitive experiments of site markers suggested that the binding site of BD to BSA was located in the region of subdomain IIA (sudlow site I). The distance (r) between the donor (BSA) and the acceptor (BD) was 4.44 nm based on the Förster theory of non–radioactive energy transfer. The results of synchronous fluorescence and CD spectra demonstrated the microenvironment and the secondary conformation of BSA were changed.     

The investigation of the interaction between ribavirin and bovine serum albumin by spectroscopic methods

The interaction between ribavirin (RIB) with bovine serum albumin (BSA) has been investigated by fluorescence quenching technique in combination with UV–vis absorption and circular dichroism (CD) spectroscopies under the simulative physiological conditions. The quenching of BSA fluorescence by RIB was found to be a result of the formation of RIB–BSA complex. The binding constants and the number of binding sites were calculated at three different temperatures. The values of thermodynamic parameters ?H, ?S, ?G at different temperatures indicate that hydrophobic and hydrogen bonds played important roles for RIB–BSA association. The binding distance r was obtained according to the theory of FÖrster’s non–radiation energy transfer. The displacement experiments was performed for identifying the location of the binding site of RIB on BSA. The effects of common ions on the binding constant of RIB and BSA were also examined. Finally, the conformational changes of BSA in the presence of RIB were also analyzed by CD spectra and Synchronous fluorescence spectra.     

Study of the interaction between doxepin hydrochloride and bovine serum albumin by spectroscopic techniques

The binding of doxepin hydrochloride (DH) to bovine serum albumin (BSA) was investigated by spectroscopic (fluorescence, UV–vis absorption and circular dichroism) techniques. The binding parameters have been evaluated by fluorescence quenching method. The thermodynamic parameters, ΔH°, ΔS° and ΔG° calculated at different temperatures indicated that the hydrogen bond and hydrophobic forces played a major role in the interaction of DH with BSA. Based on the Förster's theory of non-radiation energy transfer, the binding average distance, r between the donor (BSA) and acceptor (DH) was evaluated and found to be 2.7 nm. Spectral results observed showed that the binding of DH to BSA induced conformational changes in BSA. The effect of common ions on the binding of DH to BSA was also examined.     

The investigation of the interaction between orientin and bovine serum albumin by spectroscopic analysis

In this paper, the interaction between orientin and bovine serum albumin (BSA) was examined using fluorescence and absorbance spectroscopy. The analysis of the quenching mechanism was done using Stern–Volmer plots which exhibit upward (positive) deviation. A linear response to orientin was shown in the concentration range between 3 and 50 μM. The experimental results showed the presence of a static quenching process between orientin and BSA. The thermodynamic parameters ΔH, ΔS and ΔG were also calculated and suggested that the hydrophobic and electrostatic interactions played an important role in the interaction between orientin and BSA. Furthermore, the distances between BSA and orientin were determined according to Förster non‐radiation energy transfer theory. In addition, the results of the synchronous fluorescence obtained indicated that the binding of orientin with BSA could affect conformation in BSA. Copyright © 2013 John Wiley & Sons, Ltd.     

The subsequent effect of interaction between Co(2+) and human serum albumin or bovine serum albumin.

A notable hysteretic effect has been observed in the interaction of Co(II) with human serum albumin (HSA) or bovine serum albumin (BSA) using UV-Visible spectrometry at physiological pH (7.43), which shows that the binding between Co(II) and HSA or BSA may induce a slow transition of HSA or BSA from the conformation of weaker affinity for Co(II) to one of stronger affinity (A-B transition). The rate constants and activation parameters of this transition were measured and are discussed. It is inferred that such a conformation transition may occur due to the binding of the first Co(II) ion with the peptide segment of N-terminal residues 1-3, which results in a 'hinged movement' of the relatively hydrophobic 'valley' in the IA subdomain. This process leads to a slow conformational transition in the albumins, makes the other binding sites of Co(II) exposed, and shows a positive cooperativity effect. The LMCT (ligand-to-metal charge transition) bands of the Co(II)-HSA and Co(II)-BSA systems also show a kind of hypochromic effect featuring a dipole-dipole interaction mechanism. This phenomenon is rarely reported.     

Study of the interaction of artemisinin with bovine serum albumin

The study on the interaction of artemisinin with bovine serum albumin (BSA) has been undertaken at three temperatures, 289, 296 and 303 K and investigated the effect of common ions and UV C (253.7 nm) irradiation on the binding of artemisinin with BSA. The binding mode, the binding constant and the protein structure changes in the presence of artemisinin in aqueous solution at pH 7.40 have been evaluated using fluorescence, UV–vis and Fourier transform infrared (FT-IR) spectroscopy. The quenching constant K_q, K_sv and the association constant K were calculated according to Stern–Volmer equation based on the quenching of the fluorescence of BSA. The thermodynamic parameters, the enthalpy (ΔH) and the entropy change (ΔS) were estimated to be −3.625 kJ mol⁻¹ and 107.419 J mol⁻¹ K⁻¹ using the van’t Hoff equation. The displacement experiment shows that artemisinin can bind to the subdomain IIA. The distance between the tryptophan residues in BSA and artemisinin bound to site I was estimated to be 2.22 nm using Föster's equation on the basis of fluorescence energy transfer. The decreased binding constant in the presence of enough common ions and UV C exposure, indicates that common ions and UV C irradiation have effect on artemisinin binding to BSA.     

Spectroscopic analysis of the binding interaction between tinidazole and bovine serum albumin (BSA)

The interaction between bovine serum albumin (BSA) and tinidazole (Tindamax; 1) in aqueous solution was investigated in detail by means of UV/VIS and fluorescence spectroscopy, as well as through resonance light-scattering (RLS) spectroscopy. The apparent binding constant and number of binding sites were determined at three different temperatures, as well as the average binding distances between 1 and the nearest amino acid residue(s) of BSA, as analyzed by means of F?rster's theory of non-radiation energy transfer. Compound 1 was found to quench the inner fluorescence of BSA by forming a tight 1:1 aggregate, based on both static quenching and non-radiation energy transfer. The entropy change upon complexation was positive, and the enthalpy change was negative, indicating that the observed spontaneous binding is mainly driven by electrostatic interactions.     

The specific hydraulic conductivity of bovine serum albumin.

Previous studies of extracellular matrix hydraulic conductivity have characterized the flow resistance of glycosaminoglycans, proteoglycans and collagen. This work focuses on serum albumin, present in significant quantities in many connective tissues, but not previously considered for its role in determining connective tissue flow resistance. The specific hydraulic conductivity of bovine serum albumin solutions, as a function of concentration, was calculated from sedimentation and ultrafiltration data available in the literature. A rigid particle hydrodynamic model compared favorably with these results. Experimental measurements on an albumin ultrafiltration cell were in agreement with this model (within experimental error); furthermore, the experimental data confirmed the theoretical prediction that there is no (or negligible) pressure drop through the concentration polarization layer. Use of the hydrodynamic model for albumin specific hydraulic conductivity with literature values for the hindrance of albumin when passing through a glycosaminoglycan (GAG) matrix allows an estimate of the relative importance of the albumin on tissue hydraulic conductivity: in non-cartilaginous tissues with moderate GAG concentrations, tissue levels of albumin can generate flow resistance effects comparable to those of the GAGs, although well less than the flow resistance of these tissues.